ID: 1019812619

View in Genome Browser
Species Human (GRCh38)
Location 7:3175602-3175624
Sequence GAGGCTGCCCAGATAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019812610_1019812619 9 Left 1019812610 7:3175570-3175592 CCCCACTGATAGAAAATAAAAAG No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data
1019812609_1019812619 10 Left 1019812609 7:3175569-3175591 CCCCCACTGATAGAAAATAAAAA No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data
1019812607_1019812619 29 Left 1019812607 7:3175550-3175572 CCCACAGAAAAATTCTTTGCCCC No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data
1019812613_1019812619 7 Left 1019812613 7:3175572-3175594 CCACTGATAGAAAATAAAAAGGG No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data
1019812611_1019812619 8 Left 1019812611 7:3175571-3175593 CCCACTGATAGAAAATAAAAAGG No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data
1019812608_1019812619 28 Left 1019812608 7:3175551-3175573 CCACAGAAAAATTCTTTGCCCCC No data
Right 1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019812619 Original CRISPR GAGGCTGCCCAGATAATTGG AGG Intergenic
No off target data available for this crispr