ID: 1019812689

View in Genome Browser
Species Human (GRCh38)
Location 7:3175970-3175992
Sequence GCATTTGGGCGAGCTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019812689_1019812692 -7 Left 1019812689 7:3175970-3175992 CCTGAGAAAGCTCGCCCAAATGC No data
Right 1019812692 7:3175986-3176008 CAAATGCAAAGACAAACAAAAGG No data
1019812689_1019812693 6 Left 1019812689 7:3175970-3175992 CCTGAGAAAGCTCGCCCAAATGC No data
Right 1019812693 7:3175999-3176021 AAACAAAAGGAATTGATCATTGG No data
1019812689_1019812694 24 Left 1019812689 7:3175970-3175992 CCTGAGAAAGCTCGCCCAAATGC No data
Right 1019812694 7:3176017-3176039 ATTGGCTTTTGAACTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019812689 Original CRISPR GCATTTGGGCGAGCTTTCTC AGG (reversed) Intergenic
No off target data available for this crispr