ID: 1019812879

View in Genome Browser
Species Human (GRCh38)
Location 7:3177320-3177342
Sequence ATTCCTGGTAGAGGAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019812879_1019812882 -8 Left 1019812879 7:3177320-3177342 CCTGTGGTTCCTCTACCAGGAAT No data
Right 1019812882 7:3177335-3177357 CCAGGAATTTATCCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019812879 Original CRISPR ATTCCTGGTAGAGGAACCAC AGG (reversed) Intergenic
No off target data available for this crispr