ID: 1019821831

View in Genome Browser
Species Human (GRCh38)
Location 7:3249599-3249621
Sequence CTGGCTTTTACCGGTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019821831_1019821835 -2 Left 1019821831 7:3249599-3249621 CCAGGACAACCGGTAAAAGCCAG No data
Right 1019821835 7:3249620-3249642 AGGACTCTGCTGAGCCAACCAGG No data
1019821831_1019821836 7 Left 1019821831 7:3249599-3249621 CCAGGACAACCGGTAAAAGCCAG No data
Right 1019821836 7:3249629-3249651 CTGAGCCAACCAGGAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019821831 Original CRISPR CTGGCTTTTACCGGTTGTCC TGG (reversed) Intergenic
No off target data available for this crispr