ID: 1019823309

View in Genome Browser
Species Human (GRCh38)
Location 7:3262557-3262579
Sequence CCACACATGGGGAAGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019823309_1019823317 -8 Left 1019823309 7:3262557-3262579 CCTGTCTGCTTCCCCATGTGTGG No data
Right 1019823317 7:3262572-3262594 ATGTGTGGGAACTACAAGGTGGG No data
1019823309_1019823316 -9 Left 1019823309 7:3262557-3262579 CCTGTCTGCTTCCCCATGTGTGG No data
Right 1019823316 7:3262571-3262593 CATGTGTGGGAACTACAAGGTGG No data
1019823309_1019823318 5 Left 1019823309 7:3262557-3262579 CCTGTCTGCTTCCCCATGTGTGG No data
Right 1019823318 7:3262585-3262607 ACAAGGTGGGCCACAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019823309 Original CRISPR CCACACATGGGGAAGCAGAC AGG (reversed) Intergenic
No off target data available for this crispr