ID: 1019824694

View in Genome Browser
Species Human (GRCh38)
Location 7:3274355-3274377
Sequence GAACAGATTCCTGTCTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019824694_1019824697 17 Left 1019824694 7:3274355-3274377 CCCTTTGAGACAGGAATCTGTTC No data
Right 1019824697 7:3274395-3274417 TCTAGTGCTACCACTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019824694 Original CRISPR GAACAGATTCCTGTCTCAAA GGG (reversed) Intergenic