ID: 1019827176

View in Genome Browser
Species Human (GRCh38)
Location 7:3294023-3294045
Sequence TGATAAGTGAAATCACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019827176_1019827179 27 Left 1019827176 7:3294023-3294045 CCCTTAGGTGATTTCACTTATCA No data
Right 1019827179 7:3294073-3294095 TTTCACTCTTGCCTAGTGCTGGG No data
1019827176_1019827178 26 Left 1019827176 7:3294023-3294045 CCCTTAGGTGATTTCACTTATCA No data
Right 1019827178 7:3294072-3294094 ATTTCACTCTTGCCTAGTGCTGG No data
1019827176_1019827180 28 Left 1019827176 7:3294023-3294045 CCCTTAGGTGATTTCACTTATCA No data
Right 1019827180 7:3294074-3294096 TTCACTCTTGCCTAGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019827176 Original CRISPR TGATAAGTGAAATCACCTAA GGG (reversed) Intergenic
No off target data available for this crispr