ID: 1019831719

View in Genome Browser
Species Human (GRCh38)
Location 7:3336774-3336796
Sequence ACACTTTCCCAGCCAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019831719_1019831720 16 Left 1019831719 7:3336774-3336796 CCACACTTTGGCTGGGAAAGTGT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1019831720 7:3336813-3336835 CACCCCATCTGTCTGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019831719 Original CRISPR ACACTTTCCCAGCCAAAGTG TGG (reversed) Intronic
900901304 1:5518126-5518148 AAACTTTCACAGCCACAGGGAGG - Intergenic
901941968 1:12669269-12669291 TGGCTTTCCCAGTCAAAGTGGGG + Intergenic
902853061 1:19176684-19176706 CCACTTGCCCACCCAAAGGGAGG + Exonic
904212408 1:28894752-28894774 ACACTTTCCCCGCATAGGTGTGG + Intronic
904434496 1:30485479-30485501 CTACTGTCCCAGCCAGAGTGTGG + Intergenic
914648397 1:149675247-149675269 ACAATTTGCCGGCCAATGTGAGG + Intergenic
915495715 1:156281606-156281628 ACTCTTTCACCGCCAAAATGTGG + Intronic
917153413 1:171968643-171968665 ACACATACCAAGCCAAAATGGGG - Intronic
917188722 1:172390723-172390745 ACACTTTCCTAGTCAATTTGAGG - Intronic
917447816 1:175121526-175121548 ACATTTTCCAGGCCACAGTGAGG + Intronic
920345399 1:205303040-205303062 ACTCATTCCCTGCCCAAGTGGGG - Exonic
922501325 1:226098915-226098937 TCCCTATCCCAGCCACAGTGAGG + Intergenic
922980799 1:229824989-229825011 AAACTTTGCTGGCCAAAGTGGGG + Intergenic
1063780722 10:9320121-9320143 ACACTTTCCCGACCAGAATGTGG + Intergenic
1065110979 10:22439159-22439181 AAACTTTCCCTGCCAAGATGTGG - Intronic
1068917388 10:62446952-62446974 ACCCTTTCTCAGCCAATTTGAGG + Intronic
1069434117 10:68365437-68365459 ACATTGTCCCAGCCTGAGTGTGG + Intronic
1069633765 10:69913263-69913285 CCACTTCCCCAGCCCAAGTAAGG + Intronic
1070715284 10:78716211-78716233 AAACTCTCCCACCTAAAGTGAGG + Intergenic
1071824236 10:89308657-89308679 ACATTTTCCAACCCAGAGTGTGG - Exonic
1072476111 10:95761428-95761450 CCACATTGCCAGTCAAAGTGTGG - Intronic
1072658613 10:97348192-97348214 CACCATTCCCAGCCAAAGTGAGG + Intergenic
1074575848 10:114668380-114668402 TCATATTCCCAGCCAAACTGAGG + Intronic
1075798807 10:125139712-125139734 CAACTTCCCCACCCAAAGTGTGG + Intronic
1076055988 10:127373280-127373302 ACATTTTTTCAGCCAGAGTGAGG + Intronic
1077744929 11:4891786-4891808 ACACTTTCACAGCTATAGAGTGG + Intronic
1078658588 11:13265399-13265421 TCACTTTCCCAGACAAATTTTGG + Intergenic
1085527951 11:77174953-77174975 ACCCTTGCCCAGCCAAAGCTGGG - Intronic
1086331474 11:85758743-85758765 ACACCTCACCATCCAAAGTGAGG + Intronic
1086841875 11:91695810-91695832 ACATTTTCCCAGTCAATCTGGGG - Intergenic
1087825314 11:102758181-102758203 ATCTTTTCCCAGCCAAAATGAGG + Intergenic
1089995061 11:122898714-122898736 ACATTTGGACAGCCAAAGTGAGG - Intronic
1092009161 12:5095093-5095115 ACAATTTCCCAGGAAAGGTGAGG + Intergenic
1092105252 12:5917170-5917192 CCAAATTCCCAGCCAAAGCGGGG + Intronic
1092725419 12:11480792-11480814 GCACCTTCCCAGCCACAGTCAGG + Intronic
1094189409 12:27682242-27682264 ACACTTTACTAGCCCAAGTTGGG + Intronic
1095652442 12:44628397-44628419 ACACAATCCAAGCCAAAATGTGG + Intronic
1095742502 12:45622575-45622597 ACACTTTTCCAGCCATTGAGGGG + Intergenic
1097943025 12:65333387-65333409 ACACTTTACCAGGCCAAGAGAGG + Intronic
1098394073 12:69999803-69999825 ACACTGGCAAAGCCAAAGTGTGG + Intergenic
1100210892 12:92397550-92397572 ACACCTTCACAACCTAAGTGGGG + Intergenic
1102034780 12:109764979-109765001 CCACTTGCCCAGCCCCAGTGAGG + Intronic
1104621332 12:130315073-130315095 TCACTGTGCCAGTCAAAGTGTGG + Intergenic
1104920071 12:132286062-132286084 TCACTTTCCCGGCCAGCGTGGGG + Intronic
1107243146 13:38261711-38261733 ACACTTTCGGAGGCAAAGTGGGG + Intergenic
1107419960 13:40236925-40236947 GCACTTTCCTGGCCAAATTGAGG + Intergenic
1109022552 13:57117255-57117277 AGACTTTCCCAGACAAACGGAGG - Intergenic
1111284092 13:86065499-86065521 ACACATTCCAAGCCAGAGAGTGG + Intergenic
1111911195 13:94313840-94313862 ACACTTTCAGAGCCAAAATAGGG + Intronic
1115505838 14:34093291-34093313 ACCCTTCCCCAGCCCAAGGGTGG - Intronic
1117068880 14:52038539-52038561 ACAGTGTCCCTGCCAAAGTCAGG - Intronic
1120106125 14:80497166-80497188 ACATTTTCCCAACCAAAATTTGG - Exonic
1121217163 14:92257334-92257356 ACACTTTCTCAGACAAGCTGAGG - Intergenic
1122036244 14:98951182-98951204 ACCTTTTCCCAGCCTAAATGGGG - Intergenic
1122735770 14:103840251-103840273 ATACTTTCTCAGCAAAAGTGTGG - Intronic
1125005127 15:34808138-34808160 ACACCTTCCCAGTGAAAGAGAGG - Intergenic
1127343475 15:58069507-58069529 ACAGTTTCTTAGCCAAATTGGGG - Intronic
1127346813 15:58109262-58109284 ACACCTTCCTAGCTTAAGTGTGG - Intronic
1127626203 15:60782347-60782369 ACACTTTCAAAGCAAAAGAGTGG - Intronic
1129415980 15:75380384-75380406 ACACATTCCCATCCAAAGTACGG + Intronic
1132603459 16:784017-784039 AGACTGTCCCAGCCAGAGAGGGG + Intergenic
1134037993 16:11046448-11046470 TCCCTTTCCCACCCCAAGTGTGG + Intronic
1134092971 16:11401371-11401393 ACTCTTCCCCAGCCACAGGGAGG + Exonic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134826960 16:17292778-17292800 ACACTTTCCTGCACAAAGTGGGG + Intronic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1135207907 16:20498825-20498847 CCACTTTGCCAGCCATAGTGGGG + Intergenic
1135210992 16:20524875-20524897 CCACTTTGCCAGCCATAGTGGGG - Intergenic
1140630332 16:76844799-76844821 ACCCTTTCTCAGACAAGGTGTGG - Intergenic
1143607993 17:8002218-8002240 AGACTTTGCCAGCCAAAGGATGG + Intergenic
1143783579 17:9241561-9241583 TCACTTTCCCGGCCAGAGTTTGG + Exonic
1148826269 17:50396698-50396720 ACAGTTTACCAGCCAAGCTGGGG + Intronic
1149361145 17:55897286-55897308 ACTCTTTCCAAGGCAAAGAGAGG - Intergenic
1149644524 17:58230293-58230315 ACTCCTTCCTATCCAAAGTGTGG - Intronic
1151238311 17:72737862-72737884 ACTCTTTCCCAGCCCCAGAGAGG - Intronic
1151428187 17:74044858-74044880 ACTCATTCCCAGCCAAAAGGGGG - Intergenic
1155434026 18:25792558-25792580 ACACTTTCCGTGCCTGAGTGGGG - Intergenic
1157438601 18:47692374-47692396 CCCCTTTCCCAGCCAACCTGGGG + Intergenic
1158941487 18:62409333-62409355 AGACTTCCCAAGCCCAAGTGGGG - Intergenic
1159012945 18:63075330-63075352 ACTCTTTCCCAGCCAAAATGCGG - Intergenic
1162668228 19:12233145-12233167 GCATCTTCCCAGCCAGAGTGAGG - Intronic
1163820934 19:19496232-19496254 ACACTCTCCCTGGCACAGTGTGG - Intronic
1163837361 19:19583009-19583031 ACTCTTTCCCAGCAAGAGAGCGG + Intronic
1164702995 19:30298991-30299013 TCACATTCCCTGCCAAAGGGGGG + Intronic
1165903068 19:39177815-39177837 ACAGTTTCCCAGCCAGGGAGGGG - Intronic
1166248883 19:41551856-41551878 CCTCCTTCCCAGCCAAAATGTGG - Intronic
1166985354 19:46656951-46656973 AGACTATGCCAGTCAAAGTGTGG - Intronic
1168439524 19:56351964-56351986 ACACTTTCTTACCCAAAGTCAGG + Intronic
1168459882 19:56545669-56545691 ACACATGCCCAGCCAAAGGGTGG + Intronic
925387406 2:3471844-3471866 CTACTTTCCCAGTCCAAGTGAGG - Intronic
925890060 2:8426187-8426209 ACACTCTGCCAGGCACAGTGGGG + Intergenic
926010969 2:9407662-9407684 ACACCCTCCCAGGCAGAGTGAGG + Intronic
928071621 2:28222930-28222952 ACACTTCCCCAGACAGAGTGCGG - Intronic
928294250 2:30069211-30069233 ACACTTTCACTGCCAAAGCCAGG + Intergenic
930093058 2:47545362-47545384 AGCCTTTCCAAGCCCAAGTGTGG - Intronic
933710747 2:85324068-85324090 GCACTTTACCACACAAAGTGTGG + Intronic
936400541 2:112161419-112161441 ACACTTTCCAAGGCACTGTGAGG + Intronic
936868145 2:117100741-117100763 ATTCTGTCCCAGCCACAGTGAGG + Intergenic
939261292 2:139813486-139813508 ACATTCTCTCAGCCAAAGTGTGG + Intergenic
941138304 2:161745042-161745064 AGACTTTCCCAGACAAAGTTGGG - Intronic
945042760 2:205755749-205755771 ACACTTTGCCATCCACAGAGGGG + Intronic
947913396 2:233817154-233817176 TCATTTTCCTAGCCAATGTGGGG - Intronic
948854598 2:240724300-240724322 ACTTTGTCCCAGCCCAAGTGGGG + Intronic
1169121947 20:3102025-3102047 CCACTTTCCCAGCCAAAAGTGGG - Intergenic
1169965506 20:11213224-11213246 ACACTTTGCTACTCAAAGTGTGG + Intergenic
1170094484 20:12630860-12630882 AGAGCTTCCCAGCCAAAGAGTGG + Intergenic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1171286371 20:23942301-23942323 ACACTTTCCCATCCAATGTAAGG + Intergenic
1172123363 20:32611294-32611316 ACCCTTGCCCAGCCAAGCTGTGG + Intergenic
1173099116 20:40067327-40067349 AGACTTTCCCAGACAAAGAAAGG + Intergenic
1178701014 21:34834312-34834334 ACACCTTCCCAGACCAACTGGGG - Intronic
1183383414 22:37501863-37501885 ACACTTTCCCAGCCTGACTCAGG + Intronic
1183498886 22:38166265-38166287 CCACCTTTCCAGCCAAAGGGAGG - Intronic
1183968725 22:41459841-41459863 ACACTTGTCCAGCTACAGTGGGG - Exonic
949214164 3:1545316-1545338 ACATTTTCCCAGCGTGAGTGTGG + Intergenic
950191029 3:10976286-10976308 CCACTGGCCAAGCCAAAGTGTGG - Intergenic
954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG + Intronic
955204978 3:56887670-56887692 ACAGGTTCCCAGCCAATTTGAGG + Intronic
956203293 3:66729926-66729948 GCACTTGCCAAGCCAAGGTGTGG - Intergenic
969229167 4:5817685-5817707 ACTCTTTCCAAGGCAGAGTGTGG - Intronic
972548262 4:40103056-40103078 ACACTTCCCCAACAAAAGTATGG + Exonic
977496142 4:97778152-97778174 TCCCTTTCCCAGCCAAAGGAAGG + Intronic
978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG + Exonic
981322471 4:143408877-143408899 ACACTTTCTCAGGAAAAGAGCGG + Intronic
983206334 4:164914114-164914136 ACACTTTCAAAACAAAAGTGAGG - Intergenic
983212348 4:164971709-164971731 ACACTTTCAAAACAAAAGTGAGG + Intronic
983786668 4:171740535-171740557 CCACCTTCCCAGCCACACTGGGG + Intergenic
984198346 4:176687344-176687366 ACTCTTCCCCAGCCAATGTGGGG - Exonic
988831511 5:34992045-34992067 ACATCTTTCCAGCCAGAGTGGGG - Intergenic
991910849 5:71559211-71559233 ACAGTTTCACAGTCAAAGTTGGG - Intronic
998425085 5:142019513-142019535 CCACATGACCAGCCAAAGTGGGG + Intergenic
999886026 5:155923925-155923947 ACCCTTTCACACCCACAGTGTGG - Intronic
1001448600 5:171806823-171806845 GCACTTGCCCTGCCAAGGTGGGG - Intergenic
1006703329 6:35994981-35995003 ACACTTACACAGCCAATGAGTGG - Intronic
1006897952 6:37482728-37482750 GCACTTTCCAAGCCAAATAGTGG - Intronic
1007308385 6:40925073-40925095 ACATTTCCCCAGTCAAAGAGAGG - Intergenic
1007481550 6:42153679-42153701 ACTTTGTCTCAGCCAAAGTGGGG - Intergenic
1010933414 6:81831636-81831658 AGACTTTCCCAGTCAAATGGGGG - Intergenic
1017943461 6:159074349-159074371 CCACTCTCCCATCCAGAGTGTGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019831719 7:3336774-3336796 ACACTTTCCCAGCCAAAGTGTGG - Intronic
1022309701 7:29185349-29185371 ACATTTTCTCAGTCAATGTGGGG - Intronic
1023605667 7:41928591-41928613 GCACTTTCAGACCCAAAGTGAGG + Intergenic
1026100138 7:67377956-67377978 ACACTGTCCCAACCAAATTGTGG - Intergenic
1026185427 7:68079362-68079384 AAAGTTTCCCAGGCAAAGTGGGG + Intergenic
1026323785 7:69290591-69290613 ACACTCTCCCTGCCAAAGGTAGG - Intergenic
1027509693 7:79064900-79064922 ACACATTCCTGACCAAAGTGGGG - Intronic
1027750136 7:82133290-82133312 AAAGTTTCTGAGCCAAAGTGAGG - Intronic
1028197631 7:87925923-87925945 TCAATGTCCCAGCTAAAGTGTGG - Intergenic
1033558890 7:142512224-142512246 CCTCTTTCCCAGGAAAAGTGAGG - Intergenic
1034833322 7:154328813-154328835 ACACTTTGACAGACACAGTGTGG + Intronic
1035232415 7:157473715-157473737 ATACTTTCCCAGCAAAATTCAGG + Intergenic
1038389286 8:27180114-27180136 ACCATTTCCCAGCTACAGTGGGG - Intergenic
1043397754 8:79855274-79855296 ACACTTTGTCCGCCAAAGAGTGG + Intergenic
1045185458 8:99832587-99832609 AGAGTTTCCCAGACAGAGTGTGG + Exonic
1045246741 8:100448650-100448672 CCACTTTTCCAGCCTAAGTTAGG + Intergenic
1050090106 9:2009846-2009868 ACTCTTTTCCAGCCAAATTGAGG - Intergenic
1050392403 9:5158662-5158684 ATACTTTCCCAGCCAAAAAAAGG + Intronic
1051502228 9:17790405-17790427 ACACTTCCCCTGCCACAGTCAGG - Intronic
1052233887 9:26188030-26188052 CCCCTTTCCCAACCACAGTGTGG + Intergenic
1052780709 9:32779714-32779736 ACACTTTACCAGCCAGCATGTGG + Intergenic
1053378386 9:37627816-37627838 ATATTTTCCCAACCAAAGTCTGG - Intronic
1056393118 9:86156800-86156822 ACACTTTGGCACCCAATGTGGGG - Intergenic
1060163923 9:121392956-121392978 ACACTTTCCATGCAAAACTGTGG + Intergenic
1061168380 9:128937760-128937782 TCACCTTCACCGCCAAAGTGAGG - Intronic
1061258017 9:129464058-129464080 TAACTTTCCCAGCCCAACTGTGG + Intergenic
1186604040 X:11070416-11070438 ACACTTTCCAAACCAATGTCTGG - Intergenic
1188827839 X:34858262-34858284 ACTCTTTCCCTCCCCAAGTGAGG + Intergenic
1189178151 X:38978688-38978710 ACACCTTGCTACCCAAAGTGTGG - Intergenic
1189943478 X:46152685-46152707 ACATATTCCCAGCGAAAGTATGG + Intergenic
1189963245 X:46344914-46344936 ACACCTTCCCAGTGAAAATGGGG - Intergenic
1191049699 X:56178003-56178025 TCCCTTTCCCAGCCAAAGAAAGG - Intergenic
1192855777 X:75010246-75010268 AGACTTTCCCAGACAAAGAAAGG - Intergenic
1194402292 X:93453515-93453537 CCACTTTTCCAGGAAAAGTGTGG - Intergenic
1196235235 X:113272345-113272367 ACACATTCCTTTCCAAAGTGGGG + Intergenic
1196699520 X:118652978-118653000 AAACTTTCCCAGCCTGAGAGCGG - Intronic
1197997950 X:132400263-132400285 ACACTTTTGCAGCCAAACAGAGG - Intronic
1201636400 Y:16127791-16127813 ACATCTTCCCAGCCAGAATGGGG - Intergenic
1202135639 Y:21658008-21658030 ATTCTTTTCCAGTCAAAGTGTGG - Intergenic