ID: 1019834639

View in Genome Browser
Species Human (GRCh38)
Location 7:3370674-3370696
Sequence CTGGTGAAACAGATTGCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019834635_1019834639 16 Left 1019834635 7:3370635-3370657 CCATATGCCAAGATCTGGGCAGA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG No data
1019834636_1019834639 9 Left 1019834636 7:3370642-3370664 CCAAGATCTGGGCAGAATGTTCT 0: 1
1: 0
2: 2
3: 17
4: 156
Right 1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019834639 Original CRISPR CTGGTGAAACAGATTGCGAA TGG Intronic
No off target data available for this crispr