ID: 1019835488

View in Genome Browser
Species Human (GRCh38)
Location 7:3378929-3378951
Sequence AGGGGTCTGCTCCGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019835488_1019835497 -1 Left 1019835488 7:3378929-3378951 CCCCTTCCCCGGAGCAGACCCCT 0: 1
1: 0
2: 4
3: 32
4: 257
Right 1019835497 7:3378951-3378973 TGAGTCAGACAGTTCAAACGAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019835488 Original CRISPR AGGGGTCTGCTCCGGGGAAG GGG (reversed) Intronic
900115546 1:1026397-1026419 ATGGGGCTGCTCCAGGGAAGGGG + Intronic
900154014 1:1196902-1196924 AGGGGGCTGCTCTGAGGAGGGGG - Intronic
900322981 1:2094164-2094186 GGGGGGCTGCTCCCGGGACGGGG - Intronic
901456476 1:9365944-9365966 AGGGGTCTGCTCTGGCGAAGCGG + Intronic
901853254 1:12029340-12029362 ATGGGACTGCTCTGGGGCAGGGG - Intronic
902513066 1:16976582-16976604 AGGGGTCTCCTCAGGGCAAGGGG + Intronic
903848085 1:26290396-26290418 AGGGCTCTGCTTGAGGGAAGGGG - Intronic
904326126 1:29727931-29727953 AGGGGTCGGCCCGGGGGAGGTGG + Intergenic
904433381 1:30479331-30479353 AGGGGTCAGCTGTGGGGAGGTGG - Intergenic
905124666 1:35708221-35708243 AGGCCTCCGCGCCGGGGAAGAGG - Intergenic
905625655 1:39489345-39489367 TGGGGGCTGCTCAGGGGCAGGGG + Intergenic
907455427 1:54572429-54572451 AGGGGTCTGAGGAGGGGAAGAGG + Intronic
907459161 1:54594841-54594863 CGAGGTCTCCTCCAGGGAAGGGG + Intronic
912508413 1:110172255-110172277 AGGGGGCTGCTCCTGGGCATTGG + Intronic
913014313 1:114717077-114717099 AAGGGTCAGCTCAGGGGATGTGG - Exonic
914902889 1:151721398-151721420 AGGGGTGAGCTCCGGGGCGGGGG - Intronic
915605316 1:156946825-156946847 AGGGGTCTGGTCCCAGGCAGGGG - Intronic
917194461 1:172450712-172450734 ACGGGGCTGCTCCGGGGCAGGGG - Intronic
918001541 1:180502182-180502204 AGGGGACGACTCCGGGGAGGTGG - Exonic
918253031 1:182721574-182721596 AGGGATCTGCTAAGGGTAAGTGG + Intergenic
921006583 1:211099915-211099937 AGTGGCCTGGTCAGGGGAAGAGG - Intronic
921160179 1:212466907-212466929 AGGTGTCTTCCCAGGGGAAGTGG + Intergenic
922099943 1:222471747-222471769 CGTGTTCTGCTCTGGGGAAGGGG - Intergenic
922212390 1:223495980-223496002 AGGGGTCTCCTCCCGTGATGAGG + Intergenic
922462902 1:225826786-225826808 AGGGCTCTGGTCCAGGGGAGGGG + Intronic
922496680 1:226062830-226062852 GGGGCTCGGTTCCGGGGAAGCGG - Intronic
922774482 1:228208433-228208455 AAGGGTCAACTCCGGGGTAGAGG - Intronic
923192505 1:231633385-231633407 AGGGTTCTGCACTGGGGAGGGGG + Intronic
1062839596 10:659775-659797 AGTGGTCAGATCCCGGGAAGTGG - Intronic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1064116144 10:12579038-12579060 GTGTGTCTGCTCCAGGGAAGGGG + Intronic
1064354276 10:14603972-14603994 CGGGGGCCGCTGCGGGGAAGGGG - Intronic
1064901406 10:20299591-20299613 AGGGGTGTGTTCCTGGAAAGGGG + Intergenic
1065841239 10:29703325-29703347 GGGGGGCTGGTCTGGGGAAGGGG - Intronic
1066156755 10:32686550-32686572 TGGGGCCTGCTCCAGGGTAGAGG + Intronic
1067032000 10:42884494-42884516 AGCGGGCTGCTCAGGGGAAGTGG + Intergenic
1068477406 10:57546428-57546450 TGGGGTCTGCTGCGGGGTCGGGG - Intergenic
1069695851 10:70384846-70384868 AAGGCTCTGCTTCTGGGAAGTGG + Intergenic
1070550628 10:77488286-77488308 AGGAAGCTGCTCTGGGGAAGGGG + Intronic
1073101818 10:101010480-101010502 AGGGGTAGGCACCGGGGATGGGG + Intronic
1073541556 10:104319555-104319577 TGGGATCCGATCCGGGGAAGCGG - Intronic
1074200017 10:111226178-111226200 AAGGATCAGCTCCTGGGAAGTGG + Intergenic
1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG + Intergenic
1076405032 10:130205938-130205960 TGGGGTCTGCTACGGGGGAGTGG + Intergenic
1077150970 11:1073056-1073078 AGGGAGCTGTTCTGGGGAAGAGG - Intergenic
1077161087 11:1113192-1113214 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161107 11:1113238-1113260 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161127 11:1113284-1113306 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161147 11:1113330-1113352 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161167 11:1113376-1113398 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161187 11:1113422-1113444 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077170627 11:1164444-1164466 AGGTGTCTGCGCAGGGGGAGCGG - Exonic
1077791834 11:5449441-5449463 AGGGGTATGGTGAGGGGAAGTGG + Intronic
1083625615 11:64070583-64070605 AGGGGGCCCCTCCGGGGGAGAGG - Intronic
1083769042 11:64856208-64856230 AGGGGGCAGCTCGGGGGAAGGGG - Intronic
1083878439 11:65536898-65536920 AGGGGGCTACTGGGGGGAAGGGG - Intronic
1084190467 11:67496289-67496311 AGGGGTCAGCCGCGTGGAAGAGG + Exonic
1089941286 11:122420199-122420221 AAGGGTGTGCTTCAGGGAAGAGG - Intergenic
1090436792 11:126693907-126693929 AGGGGTGGGATCTGGGGAAGGGG - Intronic
1091172727 11:133532670-133532692 AGGGCTGTGCTCCGGTGAGGGGG - Intergenic
1092261191 12:6954054-6954076 AGGGGTGTGCTTCGGGGAAAGGG + Intronic
1092261436 12:6955293-6955315 GGGGGACAGCTCAGGGGAAGTGG - Intronic
1093406793 12:18814062-18814084 TGTGGCCTGCTCCAGGGAAGGGG - Intergenic
1095752316 12:45727254-45727276 AGGTGACTGCTCCGGGGACTTGG - Intergenic
1096179419 12:49542467-49542489 TGGGGTCTGCTTCCAGGAAGAGG - Intronic
1096571297 12:52524751-52524773 AGGGGCCTGCTGGAGGGAAGCGG - Intergenic
1096811360 12:54172560-54172582 GGGGGTCTCCTGCGGGGCAGGGG + Intronic
1098036047 12:66302798-66302820 AGGCGTCTGCCCGGGGGATGGGG + Intronic
1098461448 12:70737038-70737060 AGGGGGCTGCTCCAGCGAAGTGG - Intronic
1102068162 12:109996102-109996124 AGGGGGCGGCCCCGGGGTAGGGG + Intronic
1102204273 12:111079483-111079505 AGGGGTCAGGGCCTGGGAAGGGG - Intronic
1102853798 12:116277016-116277038 AGGGGGCTGTGCCGGGGAAGGGG - Intronic
1103563701 12:121805054-121805076 AGGGGTCTGCCCATGGGGAGGGG + Intronic
1105034398 12:132908419-132908441 AGGCGTGCGCTTCGGGGAAGGGG - Intronic
1107133357 13:36919786-36919808 AGGGGACTGCTCTGGGGAGTTGG - Intronic
1108187030 13:47898258-47898280 AGGGGTTATCTCTGGGGAAGAGG + Intergenic
1110242324 13:73282885-73282907 AAGGGTAAGCTCCAGGGAAGAGG + Intergenic
1110394966 13:75019167-75019189 AGGGGCCTGTTGCGGGGTAGGGG + Intergenic
1111636604 13:90912809-90912831 TGGGGACTGCTAGGGGGAAGGGG - Intergenic
1111937517 13:94572021-94572043 AGGGGTCTGGGGCGGGAAAGAGG + Intergenic
1111963165 13:94833721-94833743 AGGGGGCTCCTTTGGGGAAGGGG + Intergenic
1113208187 13:107941752-107941774 TGGAGCCTGCTCAGGGGAAGAGG - Intergenic
1113747772 13:112756814-112756836 AGGGGTCTGCTCCCAGCACGGGG + Intronic
1117500132 14:56343402-56343424 AGGGTTCTGCTCCGGGAGACTGG - Intergenic
1117830576 14:59745820-59745842 AGGGGTCTTCTCTTGGGTAGTGG + Exonic
1119277480 14:73371793-73371815 AGTTGTCTGTTCCGGAGAAGAGG - Intronic
1119633878 14:76258097-76258119 ACGGGGCTGCTCCAGGGAACAGG + Intergenic
1121369819 14:93346971-93346993 AGGGGTGTGCTGGGTGGAAGGGG + Intronic
1122894282 14:104748306-104748328 AGGGGTAAGCTCCTGGGGAGAGG + Intergenic
1123000707 14:105292760-105292782 AAGGGTCTGCGCCTGGGAAGGGG - Intronic
1123000717 14:105292795-105292817 AAGGGTCTGTGCCTGGGAAGGGG - Intronic
1123000744 14:105292867-105292889 AGGGGTCTGGACCTGGGGAGGGG - Intronic
1125596037 15:40886698-40886720 AGGGGCCTGGTCCTGGCAAGGGG + Intergenic
1129082563 15:73052979-73053001 AGGGGGCGCCACCGGGGAAGGGG + Intronic
1129501782 15:76045791-76045813 AGGGGGCTGGTTGGGGGAAGTGG + Intronic
1129740151 15:77986138-77986160 AGGGGTCTGCTCTGAGGGCGGGG - Intronic
1129845604 15:78766464-78766486 AGGGGTCTGCTCTGAGGGTGGGG + Exonic
1130256250 15:82327397-82327419 AGGGGTCTGCTCTGAGGGTGGGG - Intergenic
1130598702 15:85262590-85262612 AGGGGTCTGCTCTGAGGGTGGGG + Intergenic
1131032794 15:89200425-89200447 ATGGGGCGGCTCCCGGGAAGCGG + Exonic
1131974766 15:97933543-97933565 AGAGGTGTGCTGCAGGGAAGGGG - Intergenic
1134207901 16:12252725-12252747 AGGGGTGTGAGCCAGGGAAGCGG - Intronic
1134354364 16:13467319-13467341 AGTGTTCTGCTCTGGGGGAGTGG - Intergenic
1134625581 16:15720393-15720415 AGGGGGCTGTGCTGGGGAAGGGG - Intronic
1136407206 16:30054950-30054972 AAGGGTGGGCTCTGGGGAAGAGG + Intronic
1137566651 16:49537567-49537589 TTGGGTCTACTCTGGGGAAGCGG + Intronic
1139301226 16:65947056-65947078 AGGGCTCTGGGCTGGGGAAGGGG - Intergenic
1140457822 16:75115019-75115041 CGGGGTGTGGTCCGGGGACGTGG - Intronic
1141429529 16:83964479-83964501 AGGGGTTACCTCCGGGGATGGGG - Intronic
1141906310 16:87029112-87029134 AGGCGTCTGCTTGGGGGCAGTGG - Intergenic
1142508325 17:380018-380040 AGGGGTCAGCTCTGGGAACGAGG - Intronic
1142665388 17:1460332-1460354 TTGGGCCTGCTCTGGGGAAGTGG + Intronic
1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG + Exonic
1144761168 17:17708255-17708277 GGGGGTCTCCTCCTGGGGAGGGG - Intronic
1146484377 17:33231351-33231373 TGGAGTCTGGTCTGGGGAAGGGG + Intronic
1147181772 17:38691019-38691041 AGGGCTGTGCTCAGGGGAAATGG + Intergenic
1147240596 17:39088067-39088089 GGAGGGCTGCTCAGGGGAAGTGG - Intronic
1148055726 17:44794211-44794233 AGGGGTCTGCTCTGGGGAGGGGG - Intergenic
1148837040 17:50470735-50470757 AGGTGGCTGCTCCAGGGAAACGG + Intronic
1148851002 17:50555339-50555361 AGGGGGCAGCTCTGGGGAGGTGG - Intronic
1149575468 17:57708591-57708613 AGGCGTCTGCTGGGTGGAAGAGG - Intergenic
1152567087 17:81105116-81105138 AGGGGTCTGCCCCATGGCAGGGG + Intronic
1152782386 17:82232045-82232067 AGGGCGCTGCACCGGGGGAGGGG - Intronic
1152937902 17:83151349-83151371 AGGGGGCTGCGCCGAGGAACAGG - Intergenic
1155053217 18:22165677-22165699 CGGGGGCTGCGCCGGGCAAGGGG + Intergenic
1155248493 18:23933965-23933987 AGGGGAATCCTCCAGGGAAGAGG - Intronic
1156048451 18:32903730-32903752 AGGTTTCTGCTCTGGGGAAATGG + Intergenic
1157601853 18:48897686-48897708 AGGGAGCTGCTCCCGGGAAATGG - Intergenic
1160108835 18:76005940-76005962 AGGGGACAGCTAGGGGGAAGAGG - Intergenic
1161073411 19:2273602-2273624 GGGGGTCTCCTCCGTGGGAGGGG - Intronic
1161207273 19:3047464-3047486 AGGGGTCTTCTCGGAAGAAGGGG - Intronic
1161265036 19:3360003-3360025 TGGGGTCTGGCCCGGGGAGGGGG - Intronic
1161388715 19:4010278-4010300 AGGGGTGTGCTCCGGGAAGCGGG + Intronic
1161898444 19:7099699-7099721 AGGGGACTGCAGTGGGGAAGGGG + Intergenic
1162300725 19:9843343-9843365 AGGGGCCTGGTCGGGGAAAGAGG - Intronic
1162336247 19:10062214-10062236 AGGGGACAGCTTCGCGGAAGCGG - Intergenic
1165460106 19:35939396-35939418 AGGGGTGTCCTGCGGAGAAGAGG - Exonic
1166369906 19:42294929-42294951 AGGGGGCTGCTCCGTGGGAGTGG - Exonic
1167255015 19:48422103-48422125 AGGAGCCTGCTCCTGGGAGGAGG - Intronic
1168093807 19:54103021-54103043 AGGGGGCTCCTCCAGGGCAGGGG + Intronic
926698170 2:15785027-15785049 AGGTGTCTGCTCAGGGGCACAGG + Intergenic
928069700 2:28202351-28202373 AGGGGGAAGCTCCAGGGAAGGGG - Intronic
928397209 2:30951910-30951932 AGGGGTCTGGTCAGAGGCAGAGG + Intronic
928435693 2:31253222-31253244 AGGGGGTTGCTGTGGGGAAGAGG - Intronic
930095187 2:47561221-47561243 AGGGCTCTGCTCCGGGTGTGGGG + Intronic
931239677 2:60441034-60441056 AGGGGGCTGCTCCTGGGGATTGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935376111 2:102399487-102399509 AGGGGCCTGCGGAGGGGAAGCGG + Intergenic
936541575 2:113355985-113356007 AGGGGTTTGCTCAGGGGTAATGG + Intergenic
936733109 2:115407421-115407443 AGGGGGCTGCTTTGGGGAAATGG + Intronic
938653306 2:133406361-133406383 AGGGGGCTGCTCTGGAGAACTGG + Intronic
945974451 2:216259462-216259484 AGGGCCCTGCTCAGGGGCAGGGG + Exonic
946191402 2:218009857-218009879 AGGGGTGTGCGCTGGGGGAGGGG + Intergenic
946397175 2:219448947-219448969 ATGGCTCTGCTCCGGGTCAGCGG - Exonic
948100082 2:235366297-235366319 AGGGATTTGGTCCGGGGAATTGG + Intergenic
948268450 2:236656297-236656319 AGGGGTCAGCTCCTGGGAAGAGG - Intergenic
948384988 2:237575657-237575679 CGGGGTGTGCTCCCTGGAAGAGG + Intronic
1168800917 20:642693-642715 GGGGGTCAGGCCCGGGGAAGGGG + Intergenic
1169204434 20:3732246-3732268 AGGGGTCTGGGGCAGGGAAGTGG + Intergenic
1170419009 20:16173881-16173903 AGGGGTGTGCTGAGGGGAAGAGG + Intergenic
1171458278 20:25283932-25283954 AGGGGTCTTCTCATGGGAAAAGG - Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1172818639 20:37711876-37711898 AGGGGTCAGCTTCGGGGAGGAGG + Intronic
1173846656 20:46192841-46192863 ATGGGGGTGCTCCAGGGAAGGGG + Intronic
1173972778 20:47165481-47165503 AGGGGTCAGCTCTGGGCAAATGG - Intronic
1175942688 20:62545227-62545249 TGGGGTCAGCTCCAGGGAAGTGG + Intergenic
1176000229 20:62828346-62828368 AGGGCACTACTCCGGGGCAGAGG - Intronic
1176048075 20:63102867-63102889 TGCGGGCCGCTCCGGGGAAGCGG + Intergenic
1177634486 21:23769391-23769413 AGGGGTCTGCTCCTTGGGATTGG + Intergenic
1178307676 21:31503971-31503993 AGAGATCTGCTCTGGGAAAGTGG - Intronic
1179585220 21:42370294-42370316 AGGGGTCTGCTCTGGGGCCTGGG - Intergenic
1179989570 21:44940140-44940162 AGGGGTCGCCTCCGGGGCAGGGG - Exonic
1180708477 22:17824055-17824077 AGGGGCCGGCTCCTGGGGAGGGG - Intronic
1180725972 22:17946858-17946880 AGGGGTGTTCCCCAGGGAAGAGG - Intronic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181330659 22:22088096-22088118 CGGGGTCTGCACAGGGGCAGTGG + Intergenic
1181585121 22:23848998-23849020 AGGGGCCTCCTGCGGGGGAGAGG - Intergenic
1181673098 22:24435052-24435074 ACTGGGCTGCTCCAGGGAAGGGG + Intronic
1181941868 22:26483928-26483950 AGGCGGCGGCTCCGCGGAAGAGG + Exonic
1184260150 22:43310297-43310319 AGAGGTCTGCCCGGGGTAAGGGG - Intronic
1184319110 22:43725487-43725509 AGGGCTCTGCCCCTGTGAAGGGG - Intronic
1184620215 22:45671544-45671566 AGGGGTCTCCCCCAGGGGAGGGG - Intergenic
1184814293 22:46858992-46859014 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814304 22:46859043-46859065 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814315 22:46859094-46859116 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814328 22:46859145-46859167 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814340 22:46859197-46859219 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814353 22:46859248-46859270 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814365 22:46859300-46859322 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814378 22:46859351-46859373 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814391 22:46859402-46859424 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814403 22:46859454-46859476 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814428 22:46859556-46859578 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814440 22:46859608-46859630 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814465 22:46859710-46859732 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814477 22:46859762-46859784 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814501 22:46859864-46859886 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814512 22:46859916-46859938 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814524 22:46859967-46859989 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814548 22:46860069-46860091 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814560 22:46860121-46860143 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814585 22:46860223-46860245 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814596 22:46860275-46860297 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814608 22:46860326-46860348 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814620 22:46860378-46860400 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814645 22:46860480-46860502 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184814668 22:46860583-46860605 AGGATTCTGGTCCCGGGAAGGGG - Intronic
1184977315 22:48071620-48071642 AGGGGTCTGCGCAGGGTGAGGGG - Intergenic
1185296369 22:50057206-50057228 AGGGGTCAGCTCTGGGGTTGGGG + Intergenic
1185297061 22:50059628-50059650 CGGGGTCTGCTCCTGGGAATGGG - Exonic
952651249 3:35729356-35729378 AGGGGTGTGCTCTGGAGAGGTGG - Exonic
953119689 3:40027533-40027555 AGAGGGCTTCTCTGGGGAAGTGG - Intronic
953843432 3:46407875-46407897 ATGGTGCTGCTCTGGGGAAGTGG + Intronic
953916163 3:46922424-46922446 AGGGGGCTGCCCTGGGGAAGAGG + Intronic
956583573 3:70840520-70840542 AGGAGACTGCTCCTGGGCAGTGG - Intergenic
958716506 3:97789154-97789176 AGGGTTTAGCTCCTGGGAAGAGG - Intronic
959685671 3:109143102-109143124 TGTGCTCTGCTCCTGGGAAGGGG - Intergenic
960791557 3:121437012-121437034 AAAGGTCTACTCCAGGGAAGGGG + Intronic
961752092 3:129102774-129102796 AGGGGTCTGGTCTGGGGAAGGGG - Intronic
964236147 3:154530980-154531002 AAGGATCTCCTCTGGGGAAGAGG - Intergenic
964410339 3:156391059-156391081 AGGGATATGCTCCAGGGGAGGGG + Intronic
968066424 3:195761964-195761986 AGGGTTCTGCTCCAAGGAGGCGG + Intronic
968621185 4:1604147-1604169 AAGGTTCTGCCCCCGGGAAGGGG + Intergenic
968756254 4:2417906-2417928 GGGGGTCTGCTCCGGGCCCGCGG + Intronic
982437248 4:155393675-155393697 AGGTGTCTGTTCCTGGCAAGTGG - Intergenic
983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG + Intronic
983696908 4:170543602-170543624 TGGGGTCTGCTGGGGGGTAGAGG + Intergenic
986608476 5:9545699-9545721 AGGGGGCGGCTCTGGGGAAGTGG - Exonic
987661429 5:20883262-20883284 AGGGGTTTGCTGAGGGGAAAAGG - Intergenic
988762156 5:34322063-34322085 AGGGGTTTGCTGAGGGGAAAAGG + Intergenic
989229751 5:39073665-39073687 CGGCTTCTGCTCCGGGGACGGGG + Intronic
992842768 5:80712181-80712203 AGGGTTCTAGTCCAGGGAAGAGG + Intronic
996369323 5:122736441-122736463 AGTGGTCTCTTCTGGGGAAGTGG + Intergenic
997443103 5:133922606-133922628 AGAGGTCAGCGCCTGGGAAGGGG - Intergenic
998092760 5:139380762-139380784 TGGGGTCTGCACTGGGGAAAAGG - Intronic
999124116 5:149234009-149234031 AGTGCTCTGCTCTGGGGAAATGG + Intronic
1001242498 5:170081187-170081209 AGGTGCCTGTTCCAGGGAAGAGG - Intronic
1001969716 5:175945337-175945359 AGGAGTCTGCCCAGGAGAAGAGG + Intronic
1002247718 5:177898431-177898453 AGGTGTCTGCCCAGGAGAAGAGG - Intergenic
1002316713 5:178348678-178348700 GGGGGCCTGGTCCTGGGAAGGGG - Intronic
1002991714 6:2245182-2245204 AGGGGTCTGCTGCCGGGAGGTGG - Intronic
1003247672 6:4398162-4398184 AGGATTCTGCTCCGAAGAAGGGG - Intergenic
1006155124 6:32009677-32009699 AGGGGTCTGTGCAGGGCAAGGGG - Intergenic
1007978494 6:46126131-46126153 AGGAGTCTGCCCCGTGGATGAGG + Intergenic
1008529734 6:52445452-52445474 TGGGGACTGCTGCGGGGTAGGGG - Intronic
1010879208 6:81147490-81147512 AGGGGTCTGCTGGGGGGTGGGGG - Intergenic
1015276031 6:131384123-131384145 AGGGCACTGCTCTAGGGAAGGGG + Intergenic
1015936612 6:138411295-138411317 AGGAGGCTGCTGTGGGGAAGTGG - Intronic
1017882592 6:158572222-158572244 AGGCGTGTGCTGCGGGGATGTGG + Intronic
1017925948 6:158911939-158911961 AGGCGTTTGCTCTGGGGAAGAGG + Intergenic
1018186958 6:161273799-161273821 AGGGGTAGGCTCCGGGGGCGGGG - Intronic
1018754466 6:166837412-166837434 AAGGCCCTGCTTCGGGGAAGAGG - Intronic
1018998432 6:168727568-168727590 GAGGGGCTGCTCCTGGGAAGTGG + Intergenic
1019333004 7:470197-470219 AGGGGTGTGCTGCGGGGCACAGG - Intergenic
1019333018 7:470237-470259 AGGGGTGTGCTGCGGGGCACAGG - Intergenic
1019333033 7:470280-470302 AGGGGTGTGCTGCGGGGCACAGG - Intergenic
1019333090 7:470443-470465 AGGGGTGTGCTGCGGGGCACAGG - Intergenic
1019774178 7:2902517-2902539 AGGGGGCTGCTTTGGGGAGGGGG - Intergenic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1026955200 7:74372531-74372553 AAGGATCTGCTCCTGGGGAGGGG - Intronic
1029424356 7:100486943-100486965 CGGGGTGTGCTCCTGGGAGGCGG - Exonic
1030710106 7:112739768-112739790 GTGTGTCTGCTCTGGGGAAGGGG + Intergenic
1031059787 7:117037945-117037967 AGGGGACTGCTTAGGAGAAGGGG + Intronic
1034836741 7:154359337-154359359 AGTGATCTCCTCCGGGGCAGGGG - Intronic
1035090786 7:156308311-156308333 AAGGGTCTGCTCCCCGGAAGAGG - Intergenic
1035389679 7:158496584-158496606 AGGGGGATGCTGCAGGGAAGGGG - Intronic
1035389813 7:158496900-158496922 AGGGGGATGCTTCAGGGAAGGGG - Intronic
1035751661 8:2001272-2001294 GGGTGTCTGCGCCGGGGACGCGG - Exonic
1037784223 8:21893042-21893064 AAGGGTCTTCTCCAGGGAAGGGG - Intergenic
1037804763 8:22053119-22053141 GGAGGTGTGCTCCAGGGAAGGGG + Intronic
1038447307 8:27612915-27612937 AAGGGGCTGCTCAGGGGAAGAGG + Intronic
1039704141 8:39989881-39989903 TGGGCTCTGCTTAGGGGAAGAGG + Intronic
1046285539 8:112088525-112088547 AGTGGTTTCCTCCGGGGAGGAGG + Intergenic
1048871541 8:138803269-138803291 AATGGTGTGCTCCTGGGAAGTGG - Intronic
1049318227 8:141981033-141981055 AGGTGCCTCCTCCGAGGAAGGGG + Intergenic
1050119149 9:2290451-2290473 AGGGGGCTGCTCTGGTGTAGAGG - Intergenic
1056707024 9:88959964-88959986 AGGGGGCTGCTCCTGTGAAACGG + Intergenic
1057879365 9:98781640-98781662 AGGGGCCTGCAGCAGGGAAGGGG + Intronic
1058761014 9:108132307-108132329 AGGCTGCTGCTCCTGGGAAGTGG - Intergenic
1060151667 9:121292814-121292836 AGGGGGCAGGTGCGGGGAAGAGG - Intronic
1061595082 9:131623748-131623770 ATGGGGCTGCTCCGGGCAAGAGG + Intronic
1062254686 9:135615335-135615357 AGGGGTGTGGGCCGGGGCAGAGG - Intergenic
1062607534 9:137354889-137354911 GGGGGTGGGCTCCGGGGCAGAGG - Intronic
1185456437 X:313092-313114 AGGGCTCTGCTCGGCGGAACGGG + Intronic
1186195678 X:7108511-7108533 AGGGGTCTTCTGCAGGGAAGAGG - Intronic
1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG + Exonic
1190691602 X:52917411-52917433 AGGGCTCAGGTCCTGGGAAGTGG + Intergenic
1190694381 X:52938381-52938403 AGGGCTCAGGTCCTGGGAAGTGG - Intronic
1193087321 X:77458416-77458438 CAGGGGCTGCTCTGGGGAAGAGG - Intergenic
1194679289 X:96832193-96832215 AGTGGTCTGCTCTGGGAAATGGG + Intronic
1196464714 X:115960273-115960295 CGGGGTGTGCTCAGGAGAAGGGG - Intergenic
1198069940 X:133138422-133138444 AGGGGACTGAACTGGGGAAGGGG - Intergenic
1200075208 X:153547316-153547338 AGCCGTCTGCTCCAGGGGAGAGG + Intronic
1200122199 X:153796420-153796442 AGGCCTCGGCTGCGGGGAAGAGG - Exonic