ID: 1019841659

View in Genome Browser
Species Human (GRCh38)
Location 7:3452328-3452350
Sequence AATCACCTGCTTCCAAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019841659_1019841660 -4 Left 1019841659 7:3452328-3452350 CCACTCTTTGGAAGCAGGTGATT 0: 1
1: 0
2: 4
3: 24
4: 163
Right 1019841660 7:3452347-3452369 GATTGATACTAGAAACTGACAGG 0: 1
1: 0
2: 1
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019841659 Original CRISPR AATCACCTGCTTCCAAAGAG TGG (reversed) Intronic
901755488 1:11439089-11439111 AAGCAGCTGCTACCAAAGAGGGG - Intergenic
902661698 1:17908825-17908847 AATCATCTGCTTCCAAAACCTGG + Intergenic
902876983 1:19346540-19346562 GTTCTCCTGGTTCCAAAGAGAGG - Intronic
904790731 1:33018652-33018674 AACCACCTACTTCCAAATGGAGG + Intronic
913465126 1:119132602-119132624 ATTCTCCTGCTTCCCAAAAGGGG + Intronic
915140008 1:153761696-153761718 CATCACCTGTGTCAAAAGAGGGG + Intronic
916701400 1:167299728-167299750 CCTCACCTAGTTCCAAAGAGTGG + Intronic
920166871 1:204042232-204042254 AAGGACCTGCTGCCTAAGAGAGG - Intergenic
922561374 1:226572179-226572201 CATCACCTTCCTCCACAGAGGGG + Intronic
924155057 1:241167207-241167229 ACTCACCTGCTCCCAAAAGGAGG - Intronic
924451500 1:244182798-244182820 AATCACCTGTCTCCAAAAACAGG - Intergenic
924824962 1:247529847-247529869 ACTGACCTGCTTCCAAAAAGAGG + Intronic
1063169465 10:3494608-3494630 ACACAGCTGCTTCTAAAGAGAGG - Intergenic
1063333663 10:5187824-5187846 AATAACCTGCTTCCAAGGTCAGG - Intergenic
1063890428 10:10622770-10622792 TATCACCTGCTTCCAAAGCCAGG - Intergenic
1067718274 10:48706105-48706127 AATGAACTTGTTCCAAAGAGGGG + Intronic
1068558634 10:58486628-58486650 AAGAACCTGCTTCCAAAGTCGGG + Intergenic
1069673968 10:70233787-70233809 AGTCACCTGCTTCCCCAGACAGG + Intronic
1070027132 10:72642431-72642453 AGTCACCCGCTTCCAATGTGTGG - Intergenic
1070346240 10:75545068-75545090 AATCAAATGTCTCCAAAGAGTGG - Intronic
1071774137 10:88765882-88765904 AAACCCCTGTTTCCAAAGATGGG + Intronic
1072345424 10:94500462-94500484 AATAACCTGCTTCATAACAGGGG - Intronic
1073799440 10:107025412-107025434 AGTCACCTGATTCAAAAGAGAGG - Intronic
1074543401 10:114384694-114384716 AAACACCTACTTCCAGAGAGAGG + Intronic
1078405408 11:11066533-11066555 ATTGACCTGCATCCAAAAAGAGG - Intergenic
1080909267 11:36579276-36579298 AACCACCTGCATCCAAATAATGG - Exonic
1082594759 11:55063785-55063807 AATCTACTGATTCCAAAGAAAGG - Intergenic
1085262945 11:75218751-75218773 CATCATCTGCCTCCAAAAAGTGG + Intergenic
1085328025 11:75623490-75623512 GATCACCTCCTTGCAAAGGGAGG - Intronic
1092069803 12:5623352-5623374 TTTCACCTGCTTCCAAACTGTGG + Intronic
1093257026 12:16881255-16881277 AATGAGCTGCTTCCAACGTGTGG + Intergenic
1099478387 12:83136824-83136846 AATTGTCTGCTTCCAAAGAGTGG + Intergenic
1104843480 12:131835377-131835399 AACCACCTGCTTCCAAACATTGG + Intronic
1105161476 13:17440292-17440314 AAACTGCTGCATCCAAAGAGAGG - Intergenic
1105162279 13:17453021-17453043 AAACTGCTGCATCCAAAGAGAGG - Intergenic
1105163147 13:17466949-17466971 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105164003 13:17480363-17480385 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105167496 13:17535452-17535474 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105176971 13:17683154-17683176 AAACTGCTGCATCCAAAGAGAGG - Intergenic
1105181299 13:17750467-17750489 AAACTGCTGCATCCAAAGAGAGG - Intergenic
1105188652 13:17865178-17865200 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105194860 13:17961221-17961243 AAACTGCTGCATCCAAAGAGAGG - Intergenic
1105235014 13:18542666-18542688 TATCACCTACTGCCAATGAGAGG + Intergenic
1107742390 13:43465138-43465160 TATGACTGGCTTCCAAAGAGGGG - Intronic
1109460403 13:62649179-62649201 AATCTTCTGTTTTCAAAGAGAGG - Intergenic
1109860712 13:68194379-68194401 AATGACTTGTTTCTAAAGAGTGG - Intergenic
1111175782 13:84594714-84594736 TATCACCTGCTTCTAAAGTTGGG + Intergenic
1113645150 13:111989678-111989700 AATCACCTCCTTCCCACGTGGGG - Intergenic
1116081537 14:40180116-40180138 ATTACCCTGATTCCAAAGAGAGG - Intergenic
1117542474 14:56761759-56761781 CATCGCCTGCTTCTAAAGATTGG + Intergenic
1117967944 14:61224798-61224820 AGAAACTTGCTTCCAAAGAGTGG - Intronic
1118850485 14:69579359-69579381 ACTCACCTGCTTCTTATGAGTGG + Intergenic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1126994252 15:54421640-54421662 AATCACCTGCTTCCACACAGCGG - Intronic
1130632071 15:85579540-85579562 AAGCACATTCTTCCAAACAGTGG - Exonic
1132080090 15:98856217-98856239 AAGGACCTGCCTCCAAGGAGGGG - Intronic
1132175342 15:99709669-99709691 TCTCACTTGGTTCCAAAGAGAGG - Intronic
1132283498 15:100641718-100641740 AGACTCCAGCTTCCAAAGAGGGG + Intronic
1133407139 16:5533846-5533868 GATTACCTTCTCCCAAAGAGAGG + Intergenic
1134055435 16:11167014-11167036 CATCACATCCTACCAAAGAGTGG - Intronic
1134674858 16:16083038-16083060 AAACCCCTGCTTCCAAAGAGTGG - Intronic
1135691184 16:24539368-24539390 AACCATCTGCTTCAAAAGGGAGG - Intronic
1137083032 16:36089148-36089170 AATCAGCTGTATCAAAAGAGAGG - Intergenic
1137510923 16:49100050-49100072 AATCCCCTGCTTCCCCACAGAGG + Intergenic
1138881515 16:61021223-61021245 AACCACCTGCATCAAAAGAATGG + Intergenic
1141411125 16:83833839-83833861 AGTGACTTCCTTCCAAAGAGGGG + Intergenic
1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG + Intronic
1148586459 17:48784703-48784725 GATAACCTGCCTCCCAAGAGGGG + Intronic
1150022628 17:61634160-61634182 AAGCACCTGCATCAAAAGAGTGG - Intergenic
1150124004 17:62625131-62625153 CTTCATCTGCTTCCAAAGAAGGG - Intergenic
1150290238 17:63977010-63977032 AATCAGGTGCTTCCAGAAAGGGG - Intergenic
1151157185 17:72133461-72133483 AATCACCCTCTTCCCCAGAGTGG - Intergenic
1152256014 17:79239847-79239869 AATCCCATGCTTCAAAACAGGGG - Intronic
1152479377 17:80539879-80539901 AATAACCTGCTTGAACAGAGTGG - Intergenic
1155271406 18:24144724-24144746 ATTCTCCTCCTTCTAAAGAGGGG - Intronic
1157714656 18:49875413-49875435 CATCACCTACTTGCAAAGAGGGG - Intronic
1158091102 18:53714712-53714734 AGTCACCTGCTTGGAAACAGCGG + Intergenic
1158223017 18:55169428-55169450 AAACACCTGTTTCCAAGTAGAGG + Intergenic
1159483376 18:69020796-69020818 AATGACTTGCTACCAAAAAGAGG + Intronic
1159831033 18:73278654-73278676 AAGCACCTGCTTCCAAAAGTTGG - Intergenic
1163309014 19:16501352-16501374 AAGCACCTGCTGGGAAAGAGAGG + Exonic
1164260263 19:23563221-23563243 TATGACCTGCATACAAAGAGAGG + Intronic
1164782221 19:30902113-30902135 AAGCAGGTGCCTCCAAAGAGTGG - Intergenic
1167254147 19:48417264-48417286 AGCCACTTGCTTCCACAGAGTGG - Intronic
1167338046 19:48898595-48898617 GGTCCCCAGCTTCCAAAGAGAGG - Exonic
925231587 2:2237718-2237740 AATGTCCTGCCTCCAAAGAGGGG + Intronic
926374087 2:12209539-12209561 AATCAATTGAATCCAAAGAGGGG + Intergenic
926978453 2:18538767-18538789 AATAATCTGCTTACAGAGAGTGG - Intergenic
928325423 2:30315756-30315778 ACTGACCTGCTTTCAAAGATGGG - Intronic
931957918 2:67449471-67449493 TATGACCTGCTTCAAAAGAGAGG - Intergenic
932107577 2:68960056-68960078 AATGACCTGATTCGAAGGAGAGG + Intergenic
932429025 2:71662395-71662417 ACACAACTGCATCCAAAGAGGGG - Intronic
932709006 2:74048224-74048246 AACCACCTGCTTCCATTCAGAGG + Exonic
935947422 2:108299027-108299049 GATCACCTACTGCCAAAGAGAGG - Intronic
938048552 2:128145937-128145959 CACCACCTTCTTCCAAAGAGCGG + Exonic
938965451 2:136384369-136384391 AATCATCTTCTTCCAATGGGAGG - Intergenic
939868061 2:147497162-147497184 CATCACATGGTTGCAAAGAGAGG - Intergenic
948960535 2:241332333-241332355 AATGACCCACTTACAAAGAGGGG + Intronic
1168782584 20:506273-506295 AATCAGCTGCTGCCAAAGTGTGG - Intronic
1170934677 20:20799337-20799359 AATCACCTGCTTTCAGGCAGAGG - Intergenic
1170960286 20:21019802-21019824 AAACACCTGCTTCCAAACAGTGG + Intergenic
1171258155 20:23707225-23707247 AATCACAGGCTTCCAATGTGAGG - Intergenic
1171265637 20:23769839-23769861 AATCACAGGCTTCCAATGTGAGG - Intergenic
1171275372 20:23852260-23852282 AATCACAGGCTTCCAATGTGAGG - Intergenic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1172996891 20:39077381-39077403 ACTCATTTACTTCCAAAGAGTGG - Intergenic
1176779005 21:13170945-13170967 TATCACCTACTGCCAATGAGAGG + Intergenic
1179001290 21:37461744-37461766 AAACACCTGTTTCCATATAGGGG - Intronic
1183616903 22:38951042-38951064 TATCACTTACTTCCAATGAGTGG + Intergenic
1183619444 22:38964206-38964228 CATCACTTGCTTCCAACAAGTGG - Intronic
951750871 3:26035076-26035098 ACTCTCCTGCTTCAAAAGAGTGG + Intergenic
955309521 3:57871635-57871657 GAGCACTTGCTTTCAAAGAGTGG + Exonic
956888545 3:73586185-73586207 ATTCCCCTGCTTCTAAAGAAAGG + Intronic
957236100 3:77593921-77593943 AATCAACCCCTTCCAAAGATAGG + Intronic
958626773 3:96635918-96635940 AAGCACCTGCTGCCAAAGATGGG - Intergenic
960983140 3:123250541-123250563 AATCCACTGCTTCCTAAGAGTGG - Intronic
962391735 3:134978061-134978083 AGTCACCTGCTTCCTCAGAGGGG - Intronic
962940427 3:140120242-140120264 AATTAACGGCATCCAAAGAGGGG - Intronic
965994670 3:174865878-174865900 AATCCTCTGTTTCCAAAGAGGGG - Intronic
966996501 3:185285757-185285779 AATCAGGACCTTCCAAAGAGAGG + Intronic
969885668 4:10213169-10213191 AAACACCTCCTTCCAGAGATGGG - Intergenic
970781937 4:19748032-19748054 AATCAGTTGATTCCAAAGAAAGG + Intergenic
973197331 4:47461393-47461415 AAGCAACTGCTTCCAAATGGTGG + Intronic
973749991 4:54006140-54006162 AATCACCTTCTTTCAAAAACAGG + Intronic
973903982 4:55507885-55507907 AATTACCAGTTTCCTAAGAGTGG - Intronic
978419501 4:108515063-108515085 AAGCACCAGCTTCCACAGAATGG - Intergenic
979190630 4:117852795-117852817 AAACACCTACATCCAAAGAATGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
983587929 4:169375759-169375781 AATAACCTGCTTCCTTGGAGAGG + Intergenic
986041366 5:3997054-3997076 AATCACGTGCGTCCCAAGGGAGG + Intergenic
986233180 5:5885462-5885484 AATCACCTGCCTCAGAGGAGAGG + Intergenic
986276142 5:6276743-6276765 ATCCATCTGATTCCAAAGAGTGG - Intergenic
989997917 5:50857562-50857584 AATCACCAGCATCCCAAGACTGG - Intergenic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
995021002 5:107367333-107367355 AGTCATCAGCTTCCAGAGAGAGG + Intergenic
995405124 5:111786079-111786101 GATCATTTGCTTCCAAAGACAGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998798157 5:145840606-145840628 AATTAACTGAATCCAAAGAGAGG + Intergenic
999014897 5:148091915-148091937 AATCACCTACTTTCAATGAGAGG + Intronic
1000145941 5:158453439-158453461 AATCATGTGCTTTCAAAGAAAGG + Intergenic
1003108906 6:3237225-3237247 AAACTACTGCTTACAAAGAGAGG + Intronic
1003392349 6:5724748-5724770 AATTCCCTGATTACAAAGAGTGG - Intronic
1003972710 6:11314379-11314401 AATAACTTCCTTCCAAAGAAAGG + Intronic
1004289335 6:14352013-14352035 AATGTCCTGCTTCCCAGGAGAGG + Intergenic
1004686841 6:17954382-17954404 AATCACCTACTCCCTAAAAGGGG - Intronic
1006012252 6:31053017-31053039 AATCAGCTGCCTTCTAAGAGAGG + Intergenic
1008384082 6:50867861-50867883 AATTTCCTGCTGCTAAAGAGAGG + Intergenic
1011236293 6:85221489-85221511 AAGCACCTACATCCAAAAAGTGG + Intergenic
1011327225 6:86162226-86162248 AAGCACCTATTTCCAAAGAGAGG + Intergenic
1013347520 6:109276592-109276614 AATCACCTGCTGCAAAAAACAGG + Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1016458404 6:144256439-144256461 ATTAACCTGATTCCAAAGACTGG - Intergenic
1017673139 6:156786569-156786591 TAACACCAGCTTCCACAGAGAGG + Intronic
1019638722 7:2090848-2090870 CGTGACCTCCTTCCAAAGAGTGG - Intronic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020474422 7:8579225-8579247 AAATACCTGCTTTAAAAGAGAGG + Intronic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1023036025 7:36132056-36132078 AATCGCCACCTTCCAAAGACAGG + Intergenic
1023766001 7:43511349-43511371 AGTCAGCAGCATCCAAAGAGTGG - Intronic
1024561893 7:50651842-50651864 GATTACCTTCTTCAAAAGAGTGG - Intronic
1028377726 7:90164226-90164248 GATCACCTGCCTTCAAAGAAAGG + Intronic
1029237979 7:99138809-99138831 AATCACATTCTGCCAAATAGAGG - Intronic
1031151855 7:118063002-118063024 AAGCAGCAGCTTTCAAAGAGTGG + Intergenic
1032551533 7:132788869-132788891 ACTCACTTGCTACCAAAGGGTGG + Intronic
1034611103 7:152369685-152369707 AAGCACATGTTTGCAAAGAGAGG - Intronic
1034964703 7:155383977-155383999 AACCCCCTGCTTCCCAGGAGGGG + Intronic
1035407143 7:158606642-158606664 AATGACCTTCCTCCAAAGACAGG + Intergenic
1036979823 8:13457725-13457747 AACCACCTGACTCCAAAGAAGGG - Intronic
1041619232 8:59946205-59946227 AGTCATTTGCTTGCAAAGAGAGG + Intergenic
1042284260 8:67090370-67090392 AATCACCTGAACCCAAAAAGCGG - Intronic
1042323143 8:67499365-67499387 AAGCACCTGGTTCCAAAGAATGG + Intronic
1043226043 8:77731692-77731714 TATCACCTCCTTCCAGAAAGTGG + Intergenic
1047605878 8:126473825-126473847 AATCACTTGCTTTTAAACAGAGG + Intergenic
1047657162 8:126990695-126990717 CATGACCAGATTCCAAAGAGGGG + Intergenic
1048061992 8:130929257-130929279 AAACACCTGCATCAAAAAAGAGG - Intronic
1049069668 8:140346831-140346853 TATCTCCTGCTTCCTAAAAGTGG + Intronic
1050363667 9:4854596-4854618 TCTCACATGCTTCAAAAGAGGGG + Intronic
1055012960 9:71587060-71587082 ATTCACCTACTCACAAAGAGAGG + Intergenic
1055251795 9:74316532-74316554 AATCATCTGCTATAAAAGAGGGG + Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1056561078 9:87730123-87730145 AATTACAAGCTTACAAAGAGGGG + Intronic
1058383485 9:104406095-104406117 AATCAGGCTCTTCCAAAGAGTGG + Intergenic
1061359076 9:130129627-130129649 AAACACCTCCTTCTAAACAGTGG + Intronic
1186782173 X:12924109-12924131 AATGACCTGCATCAAAAGAATGG - Intergenic
1189181299 X:39007157-39007179 ATTCACCTGCTTCCCAAGTTCGG + Intergenic
1189602391 X:42640961-42640983 GGTCACCTGCTTCTGAAGAGTGG - Intergenic
1192564440 X:72151866-72151888 AATCACCAGGTTCCAAAGGCTGG + Intergenic
1194126339 X:90021675-90021697 AATTACCTGCTGCATAAGAGGGG + Intergenic
1194936981 X:99961913-99961935 GGTTACCTTCTTCCAAAGAGAGG - Intergenic
1195252509 X:103063148-103063170 ATTCACCAGCATCCAAAGGGAGG + Exonic
1196235791 X:113278359-113278381 AATCACAATCTTCCAAAGAGAGG - Intergenic
1196805708 X:119583876-119583898 AGTCAGCAGCTTGCAAAGAGAGG - Exonic