ID: 1019842032

View in Genome Browser
Species Human (GRCh38)
Location 7:3456877-3456899
Sequence TTCTGGCCTGCTTTTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019842024_1019842032 4 Left 1019842024 7:3456850-3456872 CCCCCTTAGTTAGGTTTAGCACT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 187
1019842022_1019842032 24 Left 1019842022 7:3456830-3456852 CCTGTTATTTTAGCTGACAGCCC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 187
1019842025_1019842032 3 Left 1019842025 7:3456851-3456873 CCCCTTAGTTAGGTTTAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 187
1019842027_1019842032 1 Left 1019842027 7:3456853-3456875 CCTTAGTTAGGTTTAGCACTCAG 0: 1
1: 0
2: 2
3: 7
4: 65
Right 1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 187
1019842026_1019842032 2 Left 1019842026 7:3456852-3456874 CCCTTAGTTAGGTTTAGCACTCA 0: 1
1: 0
2: 1
3: 8
4: 56
Right 1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019842032 Original CRISPR TTCTGGCCTGCTTTTGTGGG TGG Intronic
900153452 1:1192072-1192094 TTATGGCCAGATTTTGGGGGGGG + Intronic
901332919 1:8424189-8424211 TTCCGGCCCGCGATTGTGGGCGG + Intronic
901811475 1:11769097-11769119 TTCCAGCCTGCTTCTCTGGGCGG - Intronic
902579899 1:17401779-17401801 TGCTGGCCTGCTTGTGTGGGGGG + Intergenic
903182849 1:21613768-21613790 TTCTGGCCTTACTTTGTGGGGGG - Intronic
903886250 1:26542695-26542717 TTCTGGGCTGCCATTGTGGGTGG + Intronic
905210812 1:36372941-36372963 TCCTGGACTGCCTTTGTGGATGG - Intronic
906121499 1:43395275-43395297 TACTTGCTTGCTTTTTTGGGAGG + Intronic
906416391 1:45623586-45623608 TACTGGCCTGCTGGTCTGGGAGG + Exonic
906656376 1:47551479-47551501 TTCTGGCCTGGAATTGAGGGTGG + Intergenic
906774192 1:48513725-48513747 TTATGGCCAGATTTTGGGGGGGG + Intergenic
907282828 1:53362194-53362216 TTCTGCCCTTTCTTTGTGGGAGG - Intergenic
907362990 1:53935604-53935626 TTCTGGCCTTTTTTTGGGGGTGG - Intronic
908108794 1:60874488-60874510 TCCTGGCAGACTTTTGTGGGTGG + Intronic
908151274 1:61305350-61305372 TTCTGGCCTGATGCTTTGGGGGG - Intronic
910287110 1:85567881-85567903 GTCTAGTCTGCTATTGTGGGTGG - Intronic
911658368 1:100471277-100471299 TTCTGTCATGCTTTTTTGGGGGG - Intronic
914237886 1:145828863-145828885 TTCTGGCCTGCTTCAGGGTGAGG - Intronic
916178106 1:162059773-162059795 TTGAGGTCTGCTTTTGTGGAGGG - Intergenic
917652741 1:177095417-177095439 CTCTGGGCTGCTATTGTGAGGGG - Intronic
917799175 1:178554524-178554546 TTATGGCCAGATTTTGGGGGGGG + Intergenic
920396345 1:205648788-205648810 TTCTGGCCTGCATTTGAGGCTGG - Intergenic
920428159 1:205895660-205895682 TTATGGCCAGATTTTGGGGGGGG - Intergenic
920735905 1:208532928-208532950 TTCTGGCTCTTTTTTGTGGGAGG + Intergenic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1063302938 10:4868402-4868424 CTTTGGTCTGTTTTTGTGGGTGG + Intergenic
1065205397 10:23352797-23352819 TTCTTTCCTGCTTTTGTGCTTGG - Intergenic
1065360865 10:24887771-24887793 TTCTGGCCTACAGTTGTGGTGGG - Intronic
1066348106 10:34609288-34609310 TTTTGGCCTGCTTTTGACAGAGG - Intronic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1071773985 10:88764030-88764052 CTCTGGCCTTCTTATCTGGGTGG + Intronic
1073214945 10:101830945-101830967 TCCAGGCCTGCATGTGTGGGGGG - Intronic
1073617159 10:105007658-105007680 TTGTGGCCAGATTTTTTGGGGGG - Intronic
1074471755 10:113733611-113733633 TTCTTGCATGCTTTTTTTGGTGG + Intergenic
1074827268 10:117223589-117223611 TCCTGGCCTTCTGTGGTGGGTGG + Intergenic
1075378391 10:121997934-121997956 TTCGTGCCTGCCTTTGGGGGTGG - Intronic
1075614605 10:123882360-123882382 CTGTGTCCTGCTTCTGTGGGCGG + Intronic
1076588576 10:131568015-131568037 TTCTGGGTTTCTGTTGTGGGAGG - Intergenic
1081263489 11:40989657-40989679 ATCTGGGTTGATTTTGTGGGTGG + Intronic
1081674677 11:44961890-44961912 TTCTGGCCTGCACCCGTGGGTGG + Intergenic
1089538257 11:119173788-119173810 TTCTGGACTGGTGTTATGGGCGG + Exonic
1090140551 11:124255021-124255043 TTATGGCCAGCTTTTCTTGGTGG + Intergenic
1091184863 11:133638032-133638054 TCCTGGCCAGCTTTTGTGTCTGG + Intergenic
1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG + Intronic
1094696228 12:32821534-32821556 TTCTGGATTCCTTTTGTGTGTGG - Intronic
1095131273 12:38545809-38545831 ATCTGTTCTGCTTTTGTTGGAGG + Intergenic
1096125088 12:49113228-49113250 TTATGGCCAGATTTTGGGGGGGG + Intergenic
1097052420 12:56231300-56231322 TGCTGGCCGGCTTCTGTGTGTGG + Exonic
1098012273 12:66066278-66066300 TGCTGGCCTGCTTTGGTGCAAGG + Intergenic
1098356561 12:69617890-69617912 TTCTGGACTGCTCTTCTGGAAGG - Intergenic
1105352730 13:19630729-19630751 TTATGGCCAGATTTTGGGGGGGG - Intergenic
1105794741 13:23840008-23840030 TTCTTCCCAGCTCTTGTGGGTGG - Intronic
1106167287 13:27259514-27259536 ATGTGGCCTCCTTTTGTTGGGGG + Intergenic
1108780531 13:53825674-53825696 ATCTGGACTGCTTTTGTCTGTGG + Intergenic
1111979574 13:95002586-95002608 ATCAGGCCCACTTTTGTGGGAGG + Intergenic
1112761572 13:102698537-102698559 TTCAGACCTGCTGATGTGGGTGG - Intergenic
1117056048 14:51912826-51912848 TACTGGCTTGGTTTTGGGGGTGG + Intronic
1117459697 14:55933113-55933135 TTCTGGCTTTTTTTTTTGGGTGG + Intergenic
1117809577 14:59532578-59532600 TTCTGGCCTTCCCTTGTGGGTGG + Intronic
1120888407 14:89470010-89470032 TTCTGGTGTGCTTGGGTGGGAGG - Intronic
1122067498 14:99183941-99183963 TTCTGGCATGCTTTGGTGGTTGG - Intronic
1127027835 15:54827681-54827703 TTTTGGTCCCCTTTTGTGGGAGG + Intergenic
1127820799 15:62654378-62654400 TTCTGGTTTTCTTTTTTGGGGGG + Intronic
1128158153 15:65404792-65404814 TTCTGGCCGGGCTTTTTGGGAGG + Intronic
1129235125 15:74219157-74219179 TTCTCACCAGTTTTTGTGGGAGG + Intergenic
1130332663 15:82934127-82934149 TTCTGTTCTGCATATGTGGGGGG - Intronic
1130452298 15:84067946-84067968 TTCTGGCTTGTTTTTTTTGGTGG - Intergenic
1130989378 15:88866791-88866813 GTCTGGTCTGCTCTTATGGGAGG + Intronic
1131048120 15:89328974-89328996 TTCTGGCCTTGCTTTGTGGGGGG + Exonic
1133596827 16:7302054-7302076 TTCTGTACTGCTTTTATTGGGGG - Intronic
1136085211 16:27880117-27880139 TTCTGCTCTGCTCCTGTGGGAGG - Intronic
1136943470 16:34615121-34615143 TTCTGTCTTGTTTTTATGGGAGG + Intergenic
1139547668 16:67657266-67657288 TTTTGGCCTGCGTTTGAGGACGG - Exonic
1140107126 16:71971105-71971127 TACTGGCCTGAATTTGAGGGGGG - Intronic
1147559642 17:41500951-41500973 TTCTGGCCTGGTTTCTTAGGTGG - Intergenic
1148322294 17:46764780-46764802 TTTGGGCCTGCTGTTGAGGGAGG + Intronic
1150316048 17:64170145-64170167 TTTATGTCTGCTTTTGTGGGTGG - Intronic
1151773651 17:76182383-76182405 TTCTGGCCTGCATTTGGGCATGG - Intronic
1153200541 18:2643211-2643233 ATCTGGCCTCCTTCAGTGGGAGG + Intergenic
1153856107 18:9148954-9148976 TTGTGGTCTGCTTTTGTGTGTGG + Intronic
1159497138 18:69221329-69221351 TTCTGGCCTGGCTCTGTGGGTGG + Intergenic
1159832818 18:73298543-73298565 ATCTGGTTTGCTTTTTTGGGGGG - Intergenic
1159853964 18:73562310-73562332 TTCTGGATTGCTTTTGTGTCTGG + Intergenic
1160891323 19:1380179-1380201 TTCTGTTTTGCTTTTGTTGGTGG + Intergenic
1163111838 19:15166051-15166073 TGCTGGCTTCCTTCTGTGGGGGG - Exonic
1163241296 19:16065500-16065522 TTCTGGTCTGCTTTTGTCACAGG + Intergenic
1164261669 19:23573050-23573072 TTATGGCCAGATTTTGGGGGGGG + Intronic
1164618236 19:29679130-29679152 TTCTGGCCTGCCCCTGTGGGTGG - Intergenic
1164767191 19:30781137-30781159 TTCTTGTCTGCTTTTGTGCTGGG + Intergenic
1166658875 19:44631965-44631987 TTATGGCCAGGTTTTGCGGGGGG + Intronic
1168345193 19:55647345-55647367 TTCCGACCTGTTTTTTTGGGAGG + Intronic
925175670 2:1782045-1782067 TTTTGGCTTGCTTTTGGGGAGGG - Intergenic
925984519 2:9205890-9205912 TACTGGCCCGGTTTTGTGTGAGG + Intergenic
929993150 2:46806411-46806433 TTCTGGCCTACTTTTATTGAGGG - Intergenic
931542751 2:63347665-63347687 TGTTGGGCTGTTTTTGTGGGGGG + Intronic
931562756 2:63580515-63580537 TTCAGGCTTGCATTTTTGGGAGG - Intronic
933107493 2:78350402-78350424 TTCTTGCTTGCTTTTTTGGTTGG + Intergenic
937336749 2:121066931-121066953 TCCTGGCGTGGCTTTGTGGGTGG + Intergenic
937778941 2:125814346-125814368 TTCTGGCCTGGTTTGGTAAGAGG - Intergenic
938662764 2:133504573-133504595 TTTTGGCATGCTTATGTAGGTGG + Intronic
940137402 2:150454019-150454041 TTCTGATGTTCTTTTGTGGGGGG + Intergenic
941066234 2:160906063-160906085 TCCTTGCCTGCTTTTATGGGAGG - Intergenic
941268324 2:163392102-163392124 TTCTGGCCCACTTTGGTGGCAGG + Intergenic
941764538 2:169282509-169282531 TTGTCGCCTACTTTTGTGGTAGG + Intronic
941880769 2:170477942-170477964 TTTTGGCCGGCTTTAGTGTGTGG + Intronic
943271369 2:185809992-185810014 TGATGGCATGCATTTGTGGGAGG + Intronic
946373518 2:219294811-219294833 CTCAGGCCTGCTTTTAGGGGTGG + Intronic
947188179 2:227472823-227472845 TTCTGGGCAGCCTTCGTGGGTGG + Intronic
948673835 2:239585344-239585366 TCCTTGCCTGCTTCTGTGGGGGG - Exonic
1169403989 20:5308197-5308219 TTATGGCCAGGTTTTGAGGGGGG - Intronic
1170085668 20:12529041-12529063 TCCTGGCCTGGCTTTGTGGTGGG - Intergenic
1170731370 20:18978752-18978774 TTCTTGTCTACTTTTGTGGTGGG + Intergenic
1171358955 20:24573089-24573111 TTCTGTTCTGCTTTTGAGAGTGG + Intronic
1171795268 20:29561463-29561485 TTTTATCCTGCTTTTCTGGGAGG + Intergenic
1171853186 20:30322802-30322824 TTTTATCCTGCTTTTCTGGGAGG - Intergenic
1172431277 20:34894137-34894159 TTCTGAGCTGCTTTTGAGGATGG + Intronic
1176370881 21:6060781-6060803 TTCTGTCCTGCTGGTGGGGGAGG + Intergenic
1177419548 21:20838752-20838774 TTATGGCCAGATTTTGGGGGGGG - Intergenic
1178617438 21:34146152-34146174 TTATGGCCAGATTTTGGGGGGGG + Intergenic
1179453436 21:41481033-41481055 TTGTGGCCTCCCTTTGTGTGCGG - Intronic
1179752638 21:43477760-43477782 TTCTGTCCTGCTGGTGGGGGAGG - Intergenic
1183466792 22:37984090-37984112 TTTTAGCCTCCTTTTTTGGGTGG + Intronic
1184258476 22:43300976-43300998 TTCTATTCTGCTTTTGTGGGAGG - Intronic
952263520 3:31763663-31763685 TTCTTGCCTGCTACTTTGGGTGG - Intronic
952466502 3:33593163-33593185 TTGTGGCCTAGTTTTGTGGAGGG - Intronic
952905560 3:38137375-38137397 TTCCGGTCTGCATTTCTGGGCGG - Intergenic
953764819 3:45730656-45730678 ATCTTGCCTGGTTATGTGGGTGG + Intronic
954461915 3:50631889-50631911 TTCTGGCCTGCCTTTGCCTGAGG + Intronic
959159356 3:102705038-102705060 TACAGGTCTGCTTTTATGGGTGG + Intergenic
960461898 3:117946116-117946138 TTCTTTCCCACTTTTGTGGGGGG - Intergenic
962420101 3:135220345-135220367 TACTTGAATGCTTTTGTGGGAGG - Intronic
962459117 3:135592230-135592252 TTGTGGCCTGTACTTGTGGGTGG - Intergenic
966008965 3:175052364-175052386 TTATGGCCAGATTTTGTGGGGGG + Intronic
966978781 3:185110549-185110571 TTATGGCCAGATTTTGAGGGGGG - Intronic
967543576 3:190697158-190697180 TTCTGGCATGCTTTAGTTTGAGG - Intergenic
968571447 4:1344034-1344056 TTCTGGCTTTTTTTTTTGGGTGG + Intergenic
968727203 4:2253264-2253286 TGCTGGCCTGCTTGTCTGCGGGG + Intronic
968967075 4:3774104-3774126 GTCTGCTCTGCTCTTGTGGGGGG + Intergenic
969055200 4:4397348-4397370 TGCTGTCCTGATTTTGTAGGTGG + Intronic
970383696 4:15535229-15535251 TTCTGTACTGCTTCTGTGGGAGG - Intronic
970696108 4:18679075-18679097 TTGATGCCTGCTTTTGTGAGTGG - Intergenic
972080636 4:35144710-35144732 TTATGGCCAGATTTTGGGGGGGG - Intergenic
972144887 4:36010812-36010834 TCCTGGCCGGCTTTTGTGGGCGG + Intronic
973009003 4:45048523-45048545 TTATGGCCAGATTTTGTGTGTGG - Intergenic
973553674 4:52060300-52060322 CTCTGGTATGCTTTTGTGGCAGG - Intronic
973960192 4:56102083-56102105 TTAGGGCATGCATTTGTGGGTGG + Intergenic
978588750 4:110301424-110301446 ATGTGGCTTCCTTTTGTGGGGGG - Intergenic
979753401 4:124307805-124307827 TTCTTTCCTGCTATAGTGGGTGG + Intergenic
985395953 4:189544562-189544584 TTCTGGGCTGCTTTTCCAGGTGG + Intergenic
988249983 5:28744740-28744762 TTCTGGTCTGCTGTTTTTGGCGG + Intergenic
992103838 5:73433849-73433871 TTGTGGCTGGCTTTTGTGGGTGG + Intergenic
995494124 5:112723545-112723567 TTCAGGTTTTCTTTTGTGGGAGG + Intronic
995582470 5:113616374-113616396 TTCTGAGCTGATTTTGTGTGTGG + Intergenic
997719383 5:136065674-136065696 ATCTGACCTTCTTTGGTGGGAGG - Intergenic
998188082 5:139998273-139998295 TTCTGACCTGCTCTTCTGTGGGG - Intronic
998754389 5:145360120-145360142 TTCTGGCCTGCTTTTGGAGGAGG - Intergenic
1003192008 6:3882448-3882470 TTATGGCCAGATTTTGCGGGGGG + Intergenic
1004075485 6:12340548-12340570 TTGTGGCTTGCATTTCTGGGAGG - Intergenic
1005254054 6:23981148-23981170 TTCTGAGCTCCTTGTGTGGGAGG + Intergenic
1006942679 6:37763336-37763358 TTTTGGCCTGCTTTGGAGTGTGG + Intergenic
1007035255 6:38667365-38667387 TTATGGCCAGATTTTGGGGGGGG - Intergenic
1008227631 6:48940766-48940788 TTCTGGGCTGCTTCTGTGCTTGG + Intergenic
1012433696 6:99192602-99192624 TGCTGCCCTGCTTTGCTGGGAGG - Intergenic
1012893077 6:104919191-104919213 TTCTGCCCTCATTTTGAGGGGGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1016040836 6:139430509-139430531 TTCTGAACTGTTTTTGTGGGTGG - Intergenic
1017717542 6:157223105-157223127 TTCCTGCCTGCCTTTTTGGGAGG + Intergenic
1018343574 6:162878597-162878619 TTTTGGTCTCCTTTTGTTGGGGG - Intronic
1019076509 6:169392792-169392814 CTCTGTCCTCCCTTTGTGGGTGG - Intergenic
1019770146 7:2878510-2878532 ATCTGGCCTTTTTTTGTGGTGGG + Intergenic
1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG + Intronic
1022383318 7:29880931-29880953 TTCTGGCCTACCTTTCTTGGTGG + Intronic
1024911121 7:54448850-54448872 TTATGGCCAGATTTTGGGGGGGG - Intergenic
1025142131 7:56475190-56475212 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1025708278 7:63886618-63886640 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1026178737 7:68020384-68020406 TACAGGCCTGCTTTCCTGGGTGG - Intergenic
1030894952 7:115047672-115047694 TTCTGTCCTGTGTATGTGGGAGG + Intergenic
1033069280 7:138187296-138187318 TCCTCCCCTTCTTTTGTGGGCGG + Intergenic
1033530433 7:142257458-142257480 TGCTTGTGTGCTTTTGTGGGAGG - Intronic
1034221424 7:149449400-149449422 TTCTGGCCCCATTCTGTGGGAGG + Intronic
1035259929 7:157654519-157654541 TTCGGCCCTGCAGTTGTGGGCGG + Intronic
1035751213 8:1997706-1997728 TGCTGGCCTGCTTTTGCCTGTGG + Intronic
1039398281 8:37246238-37246260 TTCTGGAGGGTTTTTGTGGGTGG + Intergenic
1040566714 8:48573912-48573934 GTCTTGCCTCCTTTTGTGGGAGG + Intergenic
1040580503 8:48695037-48695059 CTCTGGCCTGCATATTTGGGAGG + Intergenic
1042178020 8:66056607-66056629 TTCTAGCCTACTTTTGTGAGTGG - Intronic
1045178020 8:99747238-99747260 TTCTGGCCTGCTTTTCTCTTTGG - Intronic
1045242763 8:100416878-100416900 TTCCAGCCTGCTTGAGTGGGTGG + Intergenic
1045567267 8:103333160-103333182 TTCTAGCCTTCTGTTTTGGGAGG - Intergenic
1047095279 8:121618398-121618420 TTCTGCCCGGCTTTTGGGAGTGG - Intronic
1048686289 8:136908384-136908406 TTATGGCCAGATTTTGCGGGGGG + Intergenic
1050156903 9:2677070-2677092 TTGTGCCCTGCTTTTGTGTTTGG + Intergenic
1051944415 9:22549785-22549807 TTGTGGTCTGCTTTTGGGAGTGG + Intergenic
1053061701 9:35036829-35036851 TTCTGTCCTGCTACTGTGGCTGG - Intergenic
1053790983 9:41686101-41686123 TTTTATCCTGCTTTTCTGGGAGG - Intergenic
1054154168 9:61628671-61628693 TTTTATCCTGCTTTTCTGGGAGG + Intergenic
1054179329 9:61897795-61897817 TTTTATCCTGCTTTTCTGGGAGG - Intergenic
1054473955 9:65559791-65559813 TTTTATCCTGCTTTTCTGGGAGG + Intergenic
1054658209 9:67683026-67683048 TTTTATCCTGCTTTTCTGGGAGG + Intergenic
1055839848 9:80490533-80490555 TTCTGGCCTGGTTCTGTGATGGG + Intergenic
1057579936 9:96278795-96278817 TGCTGGCTGGGTTTTGTGGGAGG - Intronic
1057849512 9:98554137-98554159 TTCTGGGCTGCTTCTCAGGGAGG + Intronic
1059128782 9:111722085-111722107 TTTTGACCTCCTTTTTTGGGAGG + Intronic
1059390187 9:113994349-113994371 TTCTGGCAGGCTCTTGTGTGAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1193048958 X:77081426-77081448 TTATGGCCAGATTTTGGGGGGGG - Intergenic
1194809446 X:98372755-98372777 TTGTGGACTAGTTTTGTGGGAGG + Intergenic
1198089098 X:133310177-133310199 TTCTGGCTTGGTTTTTTGGGGGG - Intronic
1198392959 X:136194831-136194853 TTCTGTCTTGGTTTTGTGGAAGG + Intronic
1200696246 Y:6363563-6363585 TTCTTGCCTTCTTCTGTGTGGGG - Intergenic
1200761674 Y:7044630-7044652 TTCTTTCCTTTTTTTGTGGGGGG + Intronic
1201037868 Y:9801137-9801159 TTCTTGCCTTCTTCTGTGTGGGG + Intergenic