ID: 1019842936

View in Genome Browser
Species Human (GRCh38)
Location 7:3466533-3466555
Sequence AGCCTTGCACTGCTTCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019842931_1019842936 29 Left 1019842931 7:3466481-3466503 CCAGCTAAGTTGTGTGTTGTCAG 0: 1
1: 1
2: 6
3: 443
4: 10373
Right 1019842936 7:3466533-3466555 AGCCTTGCACTGCTTCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019842936 Original CRISPR AGCCTTGCACTGCTTCTGGC AGG Intronic
900351013 1:2234579-2234601 AGGCCTTCACTGCTGCTGGCAGG + Intronic
900422158 1:2560337-2560359 AGCCCTGGCCTGCATCTGGCCGG + Intronic
900580300 1:3405429-3405451 CGCCTTGGCCTGGTTCTGGCTGG - Intronic
900823318 1:4906953-4906975 AGTCTTGCTCTGCTGCAGGCTGG - Intergenic
901883724 1:12208571-12208593 AGCCTTGCCCGGATTCTGGGAGG + Exonic
902825067 1:18967502-18967524 AGCCTTGAACTGGGTCTTGCAGG + Intergenic
903101476 1:21034847-21034869 AGCCTGGCACTCCTGGTGGCTGG + Intronic
903192742 1:21666034-21666056 AGCCTGGCCCTGCCTCTTGCTGG - Intronic
903236283 1:21952746-21952768 GGAATGGCACTGCTTCTGGCTGG - Intergenic
903551732 1:24161834-24161856 AGCCTTGCACTGACCCTGGGAGG + Intronic
903852779 1:26318234-26318256 AGCCTTCCAGCTCTTCTGGCTGG + Exonic
905233376 1:36529459-36529481 AGCCTTGCACATGTTCTGGAAGG - Intergenic
907272393 1:53298640-53298662 AGCCTGGCAATGACTCTGGCTGG - Intronic
907659831 1:56381761-56381783 ACATATGCACTGCTTCTGGCAGG + Intergenic
909297537 1:73969864-73969886 GGCCATGGACTGGTTCTGGCCGG - Intergenic
909838914 1:80293238-80293260 AGCTTTGCACTGCTAGTGGCTGG - Intergenic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
913045094 1:115067649-115067671 AGCCTGGCTCTGATTGTGGCTGG - Intronic
916148524 1:161763220-161763242 GGCCATGGACTGGTTCTGGCTGG - Intergenic
917447936 1:175122575-175122597 AACTTTACACTGCTTCTGGGTGG - Intronic
918302540 1:183217069-183217091 AGTCTAGCAATGCTTATGGCTGG - Intronic
918356483 1:183709964-183709986 AGCCATGTACTCCTTCTTGCTGG - Intronic
919710565 1:200723145-200723167 GGCCATGCACTGCTGCTGGGTGG + Intergenic
920301203 1:204990117-204990139 AGCCTTTCTCTGCTTCTGCCTGG - Intronic
922911907 1:229225409-229225431 AGCCATGAGCTGCTGCTGGCCGG - Intergenic
1065034755 10:21626314-21626336 TGCCTTGCACTGGTTCTCACGGG - Intronic
1067165985 10:43867034-43867056 CCCCCTGCACTGCATCTGGCCGG + Intergenic
1067431099 10:46246668-46246690 AGGCATGCACTGGTTCTGTCAGG + Intergenic
1067442308 10:46315559-46315581 AGGCATGCACTGGTTCTGTCAGG - Intronic
1067552464 10:47245375-47245397 AGCTCTGCAGTGCTGCTGGCTGG - Intergenic
1067941400 10:50659971-50659993 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1068887350 10:62111177-62111199 AGCCTTGCCCCTCTCCTGGCAGG + Intergenic
1069989997 10:72309342-72309364 AGGCTTGCACTGTGTCTGCCAGG + Intergenic
1070862638 10:79684933-79684955 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1076008049 10:126963886-126963908 ATCCTTCCACTGCTTTTGTCTGG - Intronic
1076040505 10:127243674-127243696 TGCCTGGCACTGCTCCTGGAGGG - Intronic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076638317 10:131897793-131897815 GACCTTGGACTGGTTCTGGCCGG + Intergenic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1081650554 11:44820936-44820958 AGCATGGCACAGCATCTGGCTGG - Intronic
1082179278 11:49099056-49099078 AACATGTCACTGCTTCTGGCAGG + Intergenic
1083491185 11:63016018-63016040 AGCCTAGCAGGGCTGCTGGCTGG + Intergenic
1084603823 11:70161547-70161569 AGCCTGGTCCAGCTTCTGGCTGG - Intronic
1085404354 11:76253056-76253078 AGCAGAGCACTGCTTCTGCCAGG + Intergenic
1085452991 11:76648116-76648138 TACCTTGCACTGTTTCTGGTTGG + Intergenic
1089332670 11:117700799-117700821 GGTCCTGCTCTGCTTCTGGCTGG - Intronic
1090337644 11:125983973-125983995 AACATGTCACTGCTTCTGGCAGG + Exonic
1090654465 11:128832448-128832470 ACCCTTGCACTGCTTCTTTTGGG - Intergenic
1091802439 12:3333208-3333230 AGCCATTCACAGCTTCAGGCAGG + Intergenic
1093286726 12:17272898-17272920 ATCCTTTCACTGCCTCTTGCTGG + Intergenic
1094647827 12:32344174-32344196 AGCCTTGCATTTCTTCTGGAAGG - Intronic
1096047109 12:48571969-48571991 ACCCTTGCAGTGCCTCTGGGTGG - Intergenic
1101944954 12:109129709-109129731 AGCCTAGAACTGCTTTTGGGGGG - Intronic
1104273655 12:127305275-127305297 AGCCAGGCACTACCTCTGGCAGG + Intergenic
1104759696 12:131289507-131289529 AGTCCAGCGCTGCTTCTGGCAGG - Intergenic
1104821017 12:131677706-131677728 AGTCCAGCGCTGCTTCTGGCTGG + Intergenic
1105501980 13:20980766-20980788 AGACTTGAACTGAGTCTGGCTGG + Intronic
1106453847 13:29909745-29909767 AGCCCTGAAATGCTCCTGGCTGG - Intergenic
1107653434 13:42568041-42568063 AACCATGGACTACTTCTGGCTGG + Intronic
1109647324 13:65275475-65275497 AACCATGGACTACTTCTGGCTGG - Intergenic
1111058354 13:82979784-82979806 AGGAATGCACTGATTCTGGCTGG - Intergenic
1111763645 13:92498529-92498551 TGCCTTTCCCTGGTTCTGGCTGG + Intronic
1116631435 14:47340095-47340117 AGCATTGCAGTGCTGTTGGCTGG + Intronic
1117769420 14:59118090-59118112 AGCCATGGACTGGCTCTGGCAGG + Intergenic
1120001195 14:79304991-79305013 AGCACTGCTGTGCTTCTGGCAGG - Intronic
1120732206 14:88016428-88016450 AACCATGGACTGGTTCTGGCTGG + Intergenic
1121562570 14:94885992-94886014 AGACCTGCACTGTTTCCGGCTGG - Intergenic
1121779959 14:96615981-96616003 ATCCTTGCAAGGCTTCTGGGAGG + Intergenic
1121908558 14:97768866-97768888 TGCCTTTCCCTGCTTCTGGTTGG - Intergenic
1123676492 15:22714806-22714828 AGCCCGGCCCTGCTTCTGTCGGG + Intergenic
1124328710 15:28789066-28789088 AGCCCGGCCCTGCTTCTGTCGGG + Intergenic
1124829628 15:33135486-33135508 TCCCTGGCACTGCTTCTCGCTGG + Intronic
1124982216 15:34576802-34576824 AGCCTCTAACTGATTCTGGCTGG - Intronic
1125484353 15:40102129-40102151 TGCCTTGCCCTGCTTTTTGCTGG - Intronic
1129470951 15:75753363-75753385 TGACCTGCACTGCTGCTGGCTGG + Intergenic
1129707717 15:77804258-77804280 AGCCTTGCCCTGTTCCTGCCTGG - Intronic
1129841809 15:78748101-78748123 AGCCTCGCTCTGGCTCTGGCTGG + Intergenic
1130375152 15:83322403-83322425 AGCCTTGCTCTGCCTCTTCCCGG - Intergenic
1131461627 15:92621894-92621916 GGCCTTCCACTGCATCTTGCTGG + Intronic
1132723373 16:1327725-1327747 GGCCTTGCACTGATTCGGACTGG + Intergenic
1133031420 16:3012997-3013019 AGCCTGGCAGTGCGTCTGGAGGG + Exonic
1133032059 16:3015824-3015846 CACCTTGCACTGCATCTGGCCGG + Exonic
1133251651 16:4486072-4486094 AGCCTTGCTCTGATTCTGAAAGG + Intronic
1134024209 16:10942113-10942135 AGCCCGGCCCTGCTTCTGTCGGG - Exonic
1138439113 16:57023821-57023843 CTTCTTGCACTGCTTCCGGCGGG - Exonic
1140353365 16:74283572-74283594 AACTGTGCACTGTTTCTGGCTGG + Intergenic
1140708227 16:77651237-77651259 AGCCTGGCACTGAGTATGGCTGG - Intergenic
1141986098 16:87581087-87581109 AGCCTTCCCCATCTTCTGGCTGG - Intergenic
1141992709 16:87619813-87619835 AGCCCTGCACAGCTTCCTGCGGG + Intronic
1142698487 17:1646085-1646107 AGCCTGCCTCTGCTCCTGGCAGG + Intergenic
1145250314 17:21293676-21293698 AGCCCTGCCCTGCCTCTGCCCGG - Intronic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1148195582 17:45710399-45710421 ATCCCTGCTCTGCCTCTGGCCGG - Intergenic
1151370023 17:73642070-73642092 AGACTTTCTCTGCTTCTGACAGG + Intronic
1151402373 17:73864258-73864280 GGCCTTGGCCTGCTGCTGGCCGG - Intergenic
1151791690 17:76309521-76309543 AGCCTTGCTGTGCTTCTGTTAGG - Exonic
1154172367 18:12061118-12061140 AGCGTTGCACTGCCTGTGGTGGG + Intergenic
1155936665 18:31761711-31761733 AGCCTTCCACTGTTCCTGGAAGG - Intergenic
1156519604 18:37711092-37711114 TGACTTGGACTGCTTCGGGCTGG + Intergenic
1156539646 18:37897102-37897124 AGCCTTGGCCTGATTCTGCCAGG - Intergenic
1159105383 18:63998082-63998104 AGCCTTGCTCAGGGTCTGGCGGG - Intronic
1159316984 18:66788192-66788214 AGCCTTGTTCTTCTTCAGGCAGG - Intergenic
1160018257 18:75160465-75160487 AGCCTCGCACATCTGCTGGCTGG - Intergenic
1163074491 19:14877234-14877256 AGCATTGCCCTGCTCCTGGGAGG + Intergenic
1163338605 19:16689693-16689715 AGCCTTGTGCTGCTGCTGGGCGG + Exonic
1164853271 19:31501869-31501891 AGCCTTGCAGTACTTGAGGCTGG - Intergenic
1165321534 19:35088429-35088451 AGCCTTGCTCTGCTTCTCCAAGG - Intergenic
1165531345 19:36404481-36404503 AGCCTTGGACTGGTTTTGACTGG + Intronic
1166293634 19:41878556-41878578 ACGCCTGCACTGCTTCTGGAAGG + Intronic
1166950944 19:46427820-46427842 AGCCTTGCTCTCCTTCTCGGAGG + Intergenic
1167436997 19:49485055-49485077 AGTCTTGCTCTGTTTCAGGCTGG - Intronic
1167857248 19:52252644-52252666 AACCATGGACTGCTTCTGGTGGG - Intergenic
925291051 2:2748940-2748962 GGCCATGCACTGCCTCTGCCTGG - Intergenic
926098372 2:10097507-10097529 AGCTTTTCACTGCTTCTGCCTGG + Intergenic
927049714 2:19314959-19314981 GGCCTTGCACTGCTAATGTCTGG - Intergenic
927126702 2:20018919-20018941 AGCCTGGCACTGCTTTTTCCAGG + Intergenic
932056813 2:68453967-68453989 AACCATGGACTGGTTCTGGCCGG + Intergenic
932442173 2:71744322-71744344 GGCCATGCACTCCTTCAGGCAGG + Intergenic
932465602 2:71922219-71922241 AGCCTTCCAGTGCCTCTGCCAGG + Intergenic
933452857 2:82478854-82478876 AGCCTTGCAATTCTGCTGCCAGG + Intergenic
935619203 2:105113890-105113912 GGCCATGGACTGGTTCTGGCTGG + Intergenic
935676766 2:105601073-105601095 GGCCATGGACTGGTTCTGGCTGG - Intergenic
939044564 2:137234654-137234676 AGTCTAGCACAGCATCTGGCAGG + Intronic
941153654 2:161947684-161947706 AGTCTTGAACTGCTTCAGGGTGG - Exonic
944898706 2:204192371-204192393 AGACTTGGACTGTCTCTGGCAGG + Intergenic
946276447 2:218635366-218635388 AGTCTTGCTCTGCTGCAGGCTGG + Intronic
947385605 2:229587396-229587418 AGCCTTGAACTCACTCTGGCAGG - Intronic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948950701 2:241249415-241249437 AGCAGTGCAGTGCTTCTGCCAGG + Intronic
1169356378 20:4910074-4910096 AGCCTTCCACTACTTTTGGCCGG + Intronic
1169799901 20:9504117-9504139 AGCCATGGACTGATTCTGGCCGG + Intergenic
1170842580 20:19935962-19935984 AGCCTCACACTGCTCCAGGCAGG - Intronic
1173760817 20:45558862-45558884 ATCCATGCACTTCTTCTGACAGG + Exonic
1174063889 20:47851132-47851154 AGCGATGCTCTGCTTGTGGCAGG - Intergenic
1175172323 20:57089589-57089611 CGCCTGGCTCTGCTTCAGGCAGG - Intergenic
1175180246 20:57141562-57141584 TGCTTTGCCCTGTTTCTGGCAGG - Intergenic
1181256591 22:21566884-21566906 AGCCTGGCTCTGCTCCTAGCTGG + Intronic
1182374708 22:29838137-29838159 TCCCTTGCCCTGCATCTGGCAGG + Intronic
1184423457 22:44395317-44395339 CGCCTTGCAATTCCTCTGGCAGG - Intergenic
1184973276 22:48043085-48043107 TGCCTTGCCCAGCTGCTGGCAGG + Intergenic
1185239675 22:49735804-49735826 AGTCCTGCACTGCCCCTGGCCGG - Intergenic
949552193 3:5120763-5120785 ATCCATGCATTGGTTCTGGCTGG + Intergenic
952513241 3:34077858-34077880 AGCCTTGCATTGCTAACGGCAGG - Intergenic
954605836 3:51908516-51908538 AGCATTTCACTGCATATGGCGGG - Intergenic
954627493 3:52030545-52030567 AGCCTTGGAATTCATCTGGCAGG + Intergenic
954811048 3:53248243-53248265 ATCCTAGCTCTGCTGCTGGCAGG - Intronic
957505631 3:81116666-81116688 AGCCTGGGAAAGCTTCTGGCAGG + Intergenic
959071862 3:101709345-101709367 AACCATGGACTGATTCTGGCAGG + Intergenic
959169803 3:102830814-102830836 ACCCTGCCACTGCTGCTGGCAGG + Intergenic
959937455 3:112044143-112044165 AGGCTTGCATTTCTTCTTGCTGG + Intronic
961169424 3:124785966-124785988 AACCTTGCACTGCCTTTTGCAGG - Intronic
961325699 3:126108157-126108179 AGTCTTGCACCACTTCTGCCAGG + Intronic
961412717 3:126734357-126734379 AGCCTTGCACTACTTTAGGTGGG + Intronic
961580126 3:127874195-127874217 AGCCCTGGACTGCTTCTGGCAGG - Intergenic
961907246 3:130275791-130275813 AGCCATGGACTGGTTCTTGCTGG - Intergenic
962177018 3:133165965-133165987 AACCATGGACTGATTCTGGCTGG - Intronic
964356978 3:155859891-155859913 GGCCTTCCACTGATTCTGGGAGG - Intergenic
964384211 3:156130018-156130040 ATCCTAGCTCTGTTTCTGGCTGG + Intronic
964749098 3:160038423-160038445 ACCCCTGACCTGCTTCTGGCAGG + Intergenic
967966583 3:194965017-194965039 AGCCTGGCACTGCCTATGCCTGG + Intergenic
968698702 4:2044685-2044707 AGCCCTGCCCTGCCTCGGGCGGG + Intergenic
968875237 4:3263213-3263235 AGCCGTGCACTCCTGCTGCCGGG + Intronic
969888726 4:10240087-10240109 AGCCTTACATTTCTTCTGCCAGG - Intergenic
971336634 4:25729210-25729232 AACCATGCACTGGTTCTGGCTGG + Intergenic
972564377 4:40257013-40257035 AGCCAGGCAGTGCCTCTGGCTGG - Intergenic
973142082 4:46781790-46781812 AGCCTCTCACTGCTTGGGGCCGG - Intronic
977367763 4:96093323-96093345 AGCCTTCCACAGACTCTGGCAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
986204426 5:5610444-5610466 AGCCTTCTCCTGCCTCTGGCAGG - Intergenic
987058562 5:14219499-14219521 AGCCTTAGGCTGTTTCTGGCCGG + Intronic
989172028 5:38481310-38481332 AGCCTTGAAATGCTTCTTGAAGG + Exonic
990741436 5:58916291-58916313 AGCCTACCACTGCTACTGGGGGG - Intergenic
991395260 5:66198323-66198345 AGCCTGGCACTGCTCCTTGTGGG - Intergenic
994022499 5:95043876-95043898 AGCTTTGGAGTGCTTCTGACAGG + Intronic
998736324 5:145145413-145145435 TGCTTTGCTCTGCTACTGGCAGG - Intergenic
1000186962 5:158868415-158868437 TGCATTGCACTTCATCTGGCAGG + Intronic
1001527335 5:172438136-172438158 TGCCTGCCACTGCCTCTGGCGGG + Intronic
1001796455 5:174506328-174506350 AGCCTAGCACTGGGTCTGGCAGG - Intergenic
1002375603 5:178786878-178786900 ATCCTTGCACTTCTAATGGCTGG + Intergenic
1004665958 6:17748892-17748914 AGCCTTGCTCTTGTTCAGGCTGG + Intergenic
1006396292 6:33789433-33789455 ACCCTAGCTCTGCCTCTGGCAGG + Intergenic
1006785514 6:36664201-36664223 ATCCTTGCTCTGTTTCTGTCTGG + Intergenic
1007252313 6:40504134-40504156 AGCCTTGGAATGGTTCTGGGCGG - Intronic
1007339541 6:41181800-41181822 ATCCTGGCATTCCTTCTGGCAGG + Intergenic
1008312256 6:49990376-49990398 AGCCAGGGACTGCTTATGGCAGG + Intergenic
1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG + Intergenic
1010151422 6:72737391-72737413 AAGCTTGCACTGCCTCTGGTGGG + Intronic
1013417767 6:109940008-109940030 AGGCTTCCACTGCCTCTGGCTGG + Intergenic
1014515536 6:122374103-122374125 CTCTTTGCACTGCTTCTGCCTGG + Intergenic
1017016153 6:150101067-150101089 AGCCTTGCAATGATTATGGGAGG + Intergenic
1017500996 6:155022726-155022748 AGCATTGCATTGCTTCTGCAAGG - Intronic
1019225785 6:170506907-170506929 GACCGTGGACTGCTTCTGGCCGG - Intergenic
1019526704 7:1483641-1483663 ATCCTTGCCTTGCTTCTGGGCGG - Intronic
1019842936 7:3466533-3466555 AGCCTTGCACTGCTTCTGGCAGG + Intronic
1020017202 7:4838090-4838112 AGCCTCGCACTGCGGCTGGGCGG - Intronic
1023727904 7:43163460-43163482 AGGCAGGCTCTGCTTCTGGCTGG + Intronic
1023829146 7:44029032-44029054 ATCCTAGCAGTGGTTCTGGCTGG + Intergenic
1026858447 7:73769855-73769877 CACCTTGCACTGCATCTGGCCGG + Exonic
1026867243 7:73831377-73831399 CACCTTGCACTGCATCTGGCCGG - Exonic
1029739447 7:102483289-102483311 ATCCTAGCAGTGGTTCTGGCTGG + Exonic
1029757448 7:102582468-102582490 ATCCTAGCAGTGGTTCTGGCTGG + Exonic
1029775388 7:102681529-102681551 ATCCTAGCAGTGGTTCTGGCTGG + Intergenic
1037787027 8:21909362-21909384 AGGATTTCTCTGCTTCTGGCTGG - Exonic
1037911726 8:22747728-22747750 AGCCTGACTCTGCTCCTGGCCGG + Intronic
1038735933 8:30169567-30169589 ACCCTGGCGCTCCTTCTGGCGGG - Intronic
1040545465 8:48395402-48395424 TCCCCTGCACTGCTGCTGGCTGG + Intergenic
1045111401 8:98941429-98941451 AGCCTTCCACTGCCTCTGCGGGG - Intronic
1046655613 8:116890965-116890987 AGCCTTTCTCTGCTGCTTGCAGG - Intergenic
1049376791 8:142293184-142293206 AGCCTTGCACTGCTGCCAGCTGG - Intronic
1049673279 8:143878966-143878988 GGCCTGGCACTGCTCCAGGCAGG - Intergenic
1055476559 9:76668760-76668782 CTCCTGGCACTGCCTCTGGCTGG + Intronic
1056758299 9:89396554-89396576 AGTCTTGCACAGCTGCTGTCAGG - Intronic
1057080803 9:92173135-92173157 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1057443374 9:95097551-95097573 AGGCTGGGACTGCTGCTGGCCGG + Intergenic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1059539807 9:115118756-115118778 AGCCTTGCCCAGCTGCTGGGAGG + Intergenic
1060276636 9:122187515-122187537 AGCCCTGCACTGGTTTTGGTGGG - Intronic
1060968389 9:127724258-127724280 TGCCGTGCACTGCTACAGGCAGG + Exonic
1190410232 X:50129813-50129835 AGCCATAGACTGGTTCTGGCTGG - Intergenic
1195232731 X:102867458-102867480 CACCTTGCAGTGCCTCTGGCAGG + Intergenic
1195975792 X:110525041-110525063 AGTCTTTCACTGCTTGTGGGTGG + Intergenic
1198485329 X:137081542-137081564 AGGATGGCACTGCTTCAGGCAGG + Intergenic
1199875659 X:151925912-151925934 AGCTTTGAGCTGCATCTGGCTGG + Intergenic
1199893738 X:152113278-152113300 AGCTTTGAGCTGCATCTGGCTGG - Intergenic
1200518541 Y:4179984-4180006 ACCCATGCACTTCTTTTGGCAGG - Intergenic