ID: 1019843777

View in Genome Browser
Species Human (GRCh38)
Location 7:3476279-3476301
Sequence CAGCAAACAGCTGTGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019843777_1019843780 21 Left 1019843777 7:3476279-3476301 CCATCACCCACAGCTGTTTGCTG 0: 1
1: 0
2: 2
3: 68
4: 389
Right 1019843780 7:3476323-3476345 TCAGTTGCCGTTACCGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019843777 Original CRISPR CAGCAAACAGCTGTGGGTGA TGG (reversed) Intronic
900678680 1:3904157-3904179 CAGCACAGAGCTGGGGGTGTCGG + Intergenic
901819420 1:11817424-11817446 GAGCCAGCAGCTGTGAGTGAAGG + Intronic
901989443 1:13100839-13100861 TGGGAAACACCTGTGGGTGAGGG - Intergenic
901992370 1:13125925-13125947 TGGGAAACACCTGTGGGTGAGGG + Intergenic
902464938 1:16611324-16611346 CAGAAAACAGCTGAGTGTGGTGG + Intronic
903155864 1:21442366-21442388 CAGAAAACAGCTGAGTGTGGTGG - Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
905625723 1:39489838-39489860 CAGCAATCAGATGTGGGGGTGGG - Intergenic
907195680 1:52684791-52684813 CAGTAAAAAGCAGTGGGTGGGGG - Exonic
907240516 1:53078533-53078555 CAGCAACCAGCTGCGGGAGCAGG + Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907832974 1:58082796-58082818 CAGCAGACAGGTGGGGGGGAGGG + Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
909644657 1:77903770-77903792 CAGAAATTAGCTGTGTGTGATGG + Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912957466 1:114165623-114165645 CAGAAGTCAGCTGTGGCTGATGG + Intergenic
915086462 1:153392329-153392351 CAGAAAACAAGTGTTGGTGAGGG + Intergenic
915368661 1:155330003-155330025 CACCAAACAGGTTTTGGTGATGG + Intronic
915559003 1:156675779-156675801 CAGGAGACAGTTGTGGGAGATGG - Intronic
915892112 1:159782095-159782117 CAGGAAACAGTTGTGGGTGGGGG + Intronic
915936471 1:160092829-160092851 CTGCAAACAGCTGACGGAGAGGG + Intronic
917223753 1:172759836-172759858 CAAAACACAGCTGGGGGTGAAGG - Intergenic
918218841 1:182417093-182417115 CAGCAAAAAGCTTTGGGATATGG - Intergenic
918354510 1:183694123-183694145 CAGAAAACAGCTCTGAGTGAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923658703 1:235940350-235940372 CAGCAAAGAGCTGTGGGTCAGGG + Intergenic
1062805512 10:416811-416833 AAGCCCACAGCTCTGGGTGATGG - Intronic
1063215667 10:3923332-3923354 CAACAACCAGCTGTGGGACATGG - Intergenic
1066018978 10:31277631-31277653 AAGCAAGCAGGAGTGGGTGATGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069729410 10:70601198-70601220 CAGGACACAACTGTGGGTGGTGG + Intronic
1070372940 10:75802402-75802424 TAGCATAAAGCTTTGGGTGAAGG + Intronic
1070472856 10:76801208-76801230 GAGCAAAGAGCTGTGGCTGCTGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072336408 10:94402532-94402554 CAGAGAACAGCTCTGGGTGCTGG - Exonic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073375697 10:103032296-103032318 CAAAAAACAGCTGGGCGTGATGG + Intronic
1074155589 10:110796044-110796066 CAGCAAAAACCTGTGGTTTAGGG - Intronic
1075470905 10:122688354-122688376 TGGCAATCATCTGTGGGTGAGGG + Intergenic
1075576608 10:123582329-123582351 CAGGCAACATCTGTGGTTGATGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077482854 11:2824687-2824709 CAGGAAGCAGCTGGGGGTGGCGG + Intronic
1077620633 11:3719421-3719443 CAAAAACCACCTGTGGGTGAAGG - Exonic
1078011161 11:7574165-7574187 CAGCAGCCAGCTGTGGGAAAAGG - Intronic
1078526560 11:12105901-12105923 GAGCAAAGAGCTGTGGCTGCAGG - Intronic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079698566 11:23515202-23515224 CAGCAAACTCCTGTGAGTGCAGG + Intergenic
1080569582 11:33543631-33543653 CAGAAAACATCTGTGGTTGCTGG - Exonic
1080836528 11:35945013-35945035 CAGCTGACAGCTGTGGGCGGCGG - Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082099726 11:48162435-48162457 CAGAAACCAGCTGTGAGAGATGG - Intronic
1084364409 11:68688162-68688184 CAGGGGACAGCTGTGGGTGTCGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1086610376 11:88748411-88748433 CAGCCAACAGCAGTGGGTTGAGG + Intronic
1087364733 11:97203877-97203899 CAGCCAACATCTGTGGCTGGGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089188413 11:116636699-116636721 GAGCAGGCAGCAGTGGGTGAAGG - Intergenic
1089590279 11:119535757-119535779 CAGAAAACACCTGTTGGAGAGGG + Intergenic
1090401508 11:126452483-126452505 CTGCTCACAGCTGTGGGTGCCGG + Intronic
1090745613 11:129702570-129702592 CAACAGATAGCTGTGGGTGCAGG - Intergenic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091887945 12:4030568-4030590 CAGGAAAAAGCTGGGGGAGAGGG + Intergenic
1091919889 12:4295622-4295644 CAAAAATCAGCTGGGGGTGATGG + Intronic
1092158620 12:6302324-6302346 TAGCAATCAGCTGTGTGTGGTGG + Intergenic
1092257566 12:6935909-6935931 CAGGATAGAGCTGTGGGTGAGGG - Exonic
1093165918 12:15804225-15804247 CAAAAAATAGCTGTGGGTTAAGG + Intronic
1093646358 12:21589948-21589970 TAGCACTCAGCTGTGGGTGGGGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097272220 12:57783052-57783074 CAGCAAACTCCAGAGGGTGAAGG - Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099403417 12:82228562-82228584 CAGCAAACACCTGAGTGAGAAGG + Intronic
1102127951 12:110501262-110501284 CACCAAACTACTGGGGGTGAAGG + Intronic
1102349951 12:112184769-112184791 CAGCAAGCGGCTGTGGGCGGTGG + Exonic
1102785148 12:115598872-115598894 CAACAAACAGCAGGGGGTGGGGG - Intergenic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103612686 12:122133659-122133681 CAGCAAACTTCTGTGGCTGATGG - Exonic
1103619364 12:122177063-122177085 CAGTAAACACCTGTGGATGAAGG - Intronic
1104109391 12:125690545-125690567 CACCACACAGCTCTGGGTGAGGG + Intergenic
1104115336 12:125744406-125744428 CAACAAACAGGGGTGGGAGAGGG + Intergenic
1104543434 12:129688070-129688092 CAGCAATCAACTGAGGGAGAGGG + Intronic
1104577759 12:129983460-129983482 CAGCCATCAGCTGAGGGTGAAGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104924690 12:132308106-132308128 GAGGAAACAGCTGCGTGTGACGG + Intronic
1105439150 13:20401543-20401565 AAGCAATCAGCTGTGGCTTATGG - Intergenic
1106719547 13:32424444-32424466 CAGCCCACTGCTGTGGGTAAGGG - Intronic
1107147601 13:37075385-37075407 CTGGATACAGCTGTGGGAGATGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1109651531 13:65333624-65333646 AAGTAAACAGATTTGGGTGAAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110667200 13:78131594-78131616 AAGGAAACACCTGTGGGTCAAGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111065367 13:83084498-83084520 CAGGAATCATCTCTGGGTGAAGG + Intergenic
1111583768 13:90258470-90258492 AAGCAAAAAGCTGTTGGTCATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113291821 13:108915491-108915513 AAACAAACAGCTGCTGGTGAGGG - Intronic
1113631604 13:111891614-111891636 CAACAAAAAGCTGTGGGACAAGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114393727 14:22337936-22337958 CACCCAGCAGCTGAGGGTGAAGG - Intergenic
1115491526 14:33963112-33963134 ATGCAAACAGCTGTGCGTGGTGG + Intronic
1115959805 14:38822715-38822737 CAGAAAACAGGTATTGGTGAGGG - Intergenic
1116046055 14:39743739-39743761 CAGCAAACAGCTTTTGGGGCTGG - Intergenic
1118224760 14:63888352-63888374 CAGCCAGCAGCTGTGTGTGCTGG + Intronic
1118260075 14:64238274-64238296 CCCCAAACCGCTGTGGCTGATGG - Intronic
1118592945 14:67414455-67414477 CAGTAAACAGCTGGGGGAGGGGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119169532 14:72523751-72523773 CAGCAAACAGCTGAGGACTATGG - Intronic
1119895416 14:78215681-78215703 CAGGAAACAGCTGTGGACAAGGG - Intergenic
1119901546 14:78264579-78264601 GAGCAGACATCTGGGGGTGAGGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120747759 14:88167228-88167250 CACCCACCAGCGGTGGGTGATGG - Intergenic
1120769822 14:88366860-88366882 CACAAAATAGCTGTGGGTGGTGG - Intergenic
1121668059 14:95687269-95687291 CAGGAAACGGCTGTAGATGAGGG + Intronic
1124722506 15:32122163-32122185 CAGCACATCGCAGTGGGTGAGGG + Intronic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1125882687 15:43207986-43208008 CACCTTAGAGCTGTGGGTGAGGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1128263550 15:66250050-66250072 CACCAAACAGCTGTGGATGCTGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130047854 15:80460135-80460157 CAGCAAACTACGGTGGGTGCTGG - Intronic
1130097377 15:80866080-80866102 CACCAATCAGCTGTAGGGGAGGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131846459 15:96494729-96494751 CAGCAAACTTTTGTGGGTCACGG - Intergenic
1132054840 15:98642840-98642862 AAACAAACAGCTGGGTGTGATGG + Intergenic
1133332423 16:4982723-4982745 GAGCAAACTGCTGTGGGTGCTGG - Intronic
1133774060 16:8884310-8884332 CGGCATACAGCTGTGGGAGTGGG - Intergenic
1134117668 16:11561346-11561368 CAACACACAGGTGTGGGGGATGG + Intronic
1135682364 16:24468820-24468842 CAACAATCAGCTGGGCGTGATGG - Intergenic
1136569715 16:31089316-31089338 GAGCAAGCAGCAGTGGGTGCTGG - Intronic
1136938615 16:34499799-34499821 CAGCAAAAAGCTGTAGCTGCGGG + Intergenic
1136961203 16:34848758-34848780 CAGCAAAAAGCTGTAGCTGCGGG - Intergenic
1137251324 16:46743035-46743057 CAGCACCCAGCTGGGGGTGGGGG - Intronic
1138126702 16:54444795-54444817 CAGTAAACAGCTTTGGAAGATGG + Intergenic
1139262429 16:65607600-65607622 CAGCAAACAGCTGTTGATGTTGG + Intergenic
1139357313 16:66374334-66374356 CATCAGTCAGCTGTTGGTGAGGG - Intronic
1139614208 16:68079276-68079298 AAGCAGCCAGCCGTGGGTGAGGG - Exonic
1140141885 16:72266076-72266098 CAGGCAACAGCTGGGGGTGGTGG - Intergenic
1140678714 16:77362065-77362087 CAGCTAACAGGTGTGTGTGAAGG + Intronic
1141172862 16:81702095-81702117 CAGCAAAGAGGTGTGGGTGCTGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141998724 16:87651325-87651347 CAGCATGCAGCTGTGGATCAAGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143513122 17:7406622-7406644 CAGCAAACAGCTCTGGCGGCTGG + Intronic
1143968286 17:10773058-10773080 CATCAAACAGCTTTGGTTGCTGG + Intergenic
1144470036 17:15530893-15530915 CAACAAACAGCTGGGTGTGGTGG - Intronic
1144926306 17:18812758-18812780 CAACAAACAGCTGGGTGTGGGGG + Intergenic
1146375836 17:32293804-32293826 AAGCAAACAGAAGTGGGTGAGGG + Intronic
1148104752 17:45113248-45113270 CAGTCAGCACCTGTGGGTGAGGG + Exonic
1148320107 17:46743522-46743544 AATCACACAGCTGTGAGTGATGG + Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150205566 17:63403282-63403304 CAGCAAACCTCTGTATGTGAGGG - Intronic
1152227868 17:79101063-79101085 CATCGAACAGCTCTGGGGGATGG + Intronic
1152819571 17:82429915-82429937 CAGCAGGCAGCTGGGGATGAGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153448559 18:5199886-5199908 CAGAAAACAGCTGAGGATGGAGG - Intergenic
1155718734 18:28982522-28982544 GAGGAAACATCTGGGGGTGATGG + Intergenic
1156362939 18:36400406-36400428 CAGGAAAGAGCTGTGGGGGTAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158066028 18:53409281-53409303 CTGCGAAGACCTGTGGGTGAAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158783093 18:60675839-60675861 CAGCAAACTGCTTTGTGTAAAGG + Intergenic
1158927200 18:62279764-62279786 GACCAATCAGCTGTTGGTGAAGG + Intronic
1159037428 18:63291054-63291076 TGGAAAACAGCTGTGGGTGCCGG - Intronic
1159869398 18:73743590-73743612 CAGAAAACAGCTGCAAGTGATGG - Intergenic
1160342670 18:78102673-78102695 GTGCAAACAGCGGTGGGAGATGG + Intergenic
1161580641 19:5078847-5078869 CAGCAACCAGCTGGCGGTGTTGG - Intronic
1162761037 19:12888221-12888243 CAACAAAAAGCTGTGAGTGGTGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1166302620 19:41921106-41921128 TACCAAACAGCTCTGGGGGAGGG + Intronic
1166977022 19:46610623-46610645 CAGCCAAGAGCTGAGGGTAAGGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168695267 19:58400674-58400696 CAGTAAACACTTGTGGATGAAGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
928216376 2:29364707-29364729 CAGGGAACAGGCGTGGGTGACGG + Intronic
928275843 2:29899349-29899371 CTGCAAGCAGCTGTGTGTGAAGG + Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928990496 2:37228340-37228362 CAGCAAACAGCAGTGCCTTATGG - Exonic
929176658 2:38984970-38984992 CAGTAAACTTCTGTGGGAGAAGG + Exonic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930190999 2:48459835-48459857 CAGCACCAAGCTGTGGTTGACGG + Exonic
930362356 2:50397668-50397690 CAGAAAACAACTGTGAATGAAGG - Intronic
930680811 2:54255359-54255381 TGGCAGACAGCTGTGGGTGGTGG + Exonic
930924258 2:56797400-56797422 CAGGAAACTACTGTGAGTGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931110446 2:59105060-59105082 CAGCAAACAGCATTTGGTGCAGG + Intergenic
931774052 2:65524713-65524735 TAGGAAACAACTGTGGGAGAGGG + Intergenic
932358817 2:71088501-71088523 CAGCAAACTCCTGGGGGAGAAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933512225 2:83255433-83255455 CAGCAAACAGCTGCTTGAGAAGG + Intergenic
934544805 2:95206045-95206067 CAGCAAGGGGCTGTGGGTGCTGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936068014 2:109346902-109346924 CAGCAGAAAGCTGTGTGTCATGG + Intronic
936480599 2:112881373-112881395 CAGAGACCAGCTGTGGGTGGTGG - Intergenic
936613485 2:114025173-114025195 AAGGAAACAGCTGTGGGTTTCGG - Intergenic
937351011 2:121161904-121161926 AAGCCAACATCTGCGGGTGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
937914154 2:127090677-127090699 CAGGGCACAGCTGTGGGTGGGGG + Intronic
938633665 2:133197661-133197683 GAGCAAACAGCTGGGCATGATGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940405117 2:153292558-153292580 CAGCAAAGAGCTGAGGTTGCAGG + Intergenic
941502578 2:166298171-166298193 AAGAAAACAGCTGTAGATGAAGG + Intronic
942489096 2:176472101-176472123 CAGCACACAGCTGTGCCTGCAGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943347101 2:186751993-186752015 GAGCAAACAGATGAGAGTGAAGG - Intronic
943968188 2:194366541-194366563 CAGCAAACTGCTGTCCATGATGG - Intergenic
944174600 2:196816125-196816147 AAGCAAAGAGCTGTGGGTCAAGG + Intergenic
945616744 2:212080038-212080060 CAGAAATCAGCTGGGTGTGATGG + Intronic
945653778 2:212597771-212597793 GAGAAAACAGCCGGGGGTGATGG - Intergenic
945864359 2:215160417-215160439 CAGGAAAAAGTTGTTGGTGAAGG - Intergenic
945981811 2:216318319-216318341 CAGCCAACTGCTGTAGGGGACGG + Intronic
947457423 2:230268005-230268027 AAGCAAACAGCTGGTGGTCAAGG - Intronic
947782332 2:232779638-232779660 CAGCAGACAGCTGAGCATGAGGG + Intronic
948193816 2:236080183-236080205 CAGGAAACAGCCTTGGATGATGG - Intronic
948683527 2:239655275-239655297 CAGTAAACAGATGTGTGTGTGGG - Intergenic
1168797770 20:622916-622938 CAGCAAACCACTGTGAGTGTTGG - Intergenic
1169531772 20:6492654-6492676 GAGCAAACAGCTCAGGATGAAGG + Intergenic
1170428300 20:16257043-16257065 AACCAAACAGATGTGGGAGAGGG - Intergenic
1170467689 20:16637877-16637899 CAGCAGACAGCTGTGGGATGTGG + Intergenic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1170850857 20:20003322-20003344 CAGGAAACAGACTTGGGTGAAGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173660743 20:44731806-44731828 CCGCTACCAGCTGTGGCTGAAGG + Intergenic
1174078982 20:47957704-47957726 CTGAAAACAGCCCTGGGTGATGG - Intergenic
1174289836 20:49500242-49500264 AAGCAAACAGCAGGAGGTGATGG - Intergenic
1175657449 20:60783766-60783788 CAGGAAACAGCTGTGAAGGAAGG - Intergenic
1176334609 21:5584268-5584290 CAAGGAACAGTTGTGGGTGAAGG + Intergenic
1176393148 21:6236680-6236702 CAAGGAACAGTTGTGGGTGAAGG - Intergenic
1176468271 21:7079494-7079516 CAAGGAACAGTTGTGGGTGAAGG + Intronic
1176491832 21:7461272-7461294 CAAGGAACAGTTGTGGGTGAAGG + Intergenic
1176508810 21:7677111-7677133 CAAGGAACAGTTGTGGGTGAAGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178200210 21:30394580-30394602 CTGCAAACAGCTGTGGATCCAGG - Intronic
1178762708 21:35419129-35419151 CTGGAAACAGCTGGGAGTGATGG + Intronic
1183337305 22:37257268-37257290 CAGCAAACCCCTGTTGGGGAAGG - Intergenic
1183649739 22:39147004-39147026 CAGCAAACAAGTGTGGCAGAGGG - Intronic
1183740550 22:39666469-39666491 CAGAGAGCAGCGGTGGGTGAGGG - Intronic
1184849713 22:47113201-47113223 CAGCATACAGTTGTGTGTGCTGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950634628 3:14306224-14306246 CAGCAAACACCTCTGTTTGAGGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951088522 3:18543529-18543551 CCTCAAACAGCTTTGGCTGATGG + Intergenic
951212943 3:19995387-19995409 AATTATACAGCTGTGGGTGAGGG + Intronic
953098495 3:39802765-39802787 CAGCAACCGGCTGGGTGTGAGGG + Intergenic
955398281 3:58573065-58573087 CAGCAGTGAGCTGTGGATGATGG + Intronic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
956471612 3:69572954-69572976 GATCAAACTGCTGTGGGGGATGG + Intergenic
956749099 3:72332106-72332128 CAGGTTACTGCTGTGGGTGACGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957694707 3:83619843-83619865 CAGCTTACAGTTGTGGTTGACGG + Intergenic
958774163 3:98461414-98461436 CAGACCACAGCTGTTGGTGATGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961755941 3:129127527-129127549 CTGGAAACAGCTGGGGGTGGGGG - Intronic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
965125629 3:164625949-164625971 AAGCAAACTGCTGTGTATGAGGG - Intergenic
968889710 4:3362026-3362048 CCGCAGCCTGCTGTGGGTGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
971214382 4:24649902-24649924 AAGGAAACAGCTGTGGATAATGG - Intergenic
971727074 4:30327795-30327817 CAGCAAAGAGCAGTGGGTCGTGG + Intergenic
972095204 4:35340242-35340264 AAGCAAACAGGTGTTGGGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974280512 4:59785622-59785644 CAGCTCACAGATGTGGTTGATGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974650097 4:64743900-64743922 CAACAGACACCTGAGGGTGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976476662 4:85491868-85491890 CAGGTGACAGCTGTGAGTGAGGG + Intronic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
979526246 4:121720283-121720305 CAGCAAAAAGATGTTGGGGAAGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982406593 4:155027305-155027327 CAGCAAAAGGCAGTGGGTGGCGG - Intergenic
982433135 4:155346893-155346915 CAGCAGACAGCTGTATGGGAAGG - Exonic
982731953 4:158965338-158965360 CATCAACCAGCTCTGGGTAAAGG - Intronic
983537688 4:168875938-168875960 CAGCAAATTGCTGTGTGTGGTGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984138610 4:175974078-175974100 CAGAAAACAGCTGGGCGTGGTGG + Intronic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985770435 5:1806652-1806674 CAGAAAACAAGCGTGGGTGACGG + Intronic
985817725 5:2138989-2139011 GAGCAGACTGCTGTGGGTGCTGG - Intergenic
986249834 5:6045650-6045672 CAGAACACAGATCTGGGTGATGG - Intergenic
986837679 5:11658695-11658717 CAGCAATCAGCTGTCGTTTATGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990174248 5:53089578-53089600 AAGCAAACAGCTTTGGGGAAGGG - Intronic
990400156 5:55429727-55429749 CAGCACCCAGCTGTGGGTGGGGG - Intronic
991274864 5:64833703-64833725 CAGCACAAAGTTCTGGGTGAAGG - Intronic
991508679 5:67352809-67352831 CACCCAACTGTTGTGGGTGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993618746 5:90143682-90143704 CAGAAAACAGCTTTGAGTAAAGG - Intergenic
993852670 5:93030812-93030834 CAGCAAACAGATGAAGGAGATGG - Intergenic
993954787 5:94218860-94218882 CAACAAAAATCTGTGGGTTAAGG - Intronic
994962095 5:106618756-106618778 CAGCAATCAGCTGGGTGTGGTGG - Intergenic
995833528 5:116378522-116378544 CAACAAACAGCTGTGTGTGCAGG + Intronic
997237357 5:132280549-132280571 CAGAAATCAGCTGTTGGAGATGG - Intronic
997336676 5:133113561-133113583 TCACAAACAGCTGCGGGTGATGG + Intergenic
999677904 5:154023963-154023985 AAGCAAAGAGCTCTGAGTGAGGG - Intronic
1000127076 5:158256130-158256152 CTGCACACAGCTGTGTGAGAAGG - Intergenic
1000539752 5:162525508-162525530 CAGCAGAATGCTCTGGGTGAGGG + Intergenic
1000566523 5:162854869-162854891 TAACATATAGCTGTGGGTGAGGG - Intergenic
1002917158 6:1538587-1538609 CAGCAGGTGGCTGTGGGTGAGGG - Intergenic
1002959957 6:1905299-1905321 CAGCACATAGCTGTGGGTGCTGG + Intronic
1002959970 6:1905368-1905390 CAGCACATAGCTGTGGGTGCTGG + Intronic
1002959983 6:1905437-1905459 CAGCACATAGCTATGGGTGCTGG + Intronic
1002959997 6:1905506-1905528 CAGCACATAGCTGTGGGTGCTGG + Intronic
1002960009 6:1905575-1905597 CAGCACATAGCTGTGGGTGTTGG + Intronic
1002960022 6:1905644-1905666 CAGCACATAGCTGTGGGTGCTGG + Intronic
1002960036 6:1905713-1905735 CAGCACATAGCTATGGGTGCTGG + Intronic
1002960049 6:1905782-1905804 CAGCACATAGCTGTGGGTGCTGG + Intronic
1002960062 6:1905851-1905873 CAGCACATAGCTGTGGGTGCTGG + Intronic
1003378764 6:5603575-5603597 CAGCAAACCACTGGAGGTGAAGG - Intronic
1004208897 6:13617503-13617525 CAGCAAAATGCTGTGGGCAATGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004639093 6:17496611-17496633 GAGCAAACAGCTGGGAGTGGCGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1006011672 6:31047483-31047505 CAGCTAACAGCTGGGTGTGGTGG + Intergenic
1007833684 6:44657810-44657832 CTGCAGACAGCTGAGGTTGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1010316644 6:74459177-74459199 CAGCAAAGAGATGTGGGTTGTGG - Intergenic
1010699738 6:79029216-79029238 CAGCAAACTTCTGTGGGTCATGG - Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011193935 6:84763635-84763657 CAGCAAACAGCCGCGGCCGAAGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014308747 6:119772242-119772264 CAGCAATGTGCTTTGGGTGAGGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017246909 6:152236891-152236913 CAGCAGACAGCTGGAGGTGGTGG - Exonic
1017634689 6:156432118-156432140 CTGCAAGCTGCAGTGGGTGAGGG - Intergenic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023039641 7:36160983-36161005 CAGGACACAGCTGTGGCTGAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024238299 7:47414629-47414651 CAGCATGTAGCTGAGGGTGAGGG - Intronic
1024504496 7:50150218-50150240 AAGCAAACCTCTGTGGGTGGTGG - Intronic
1024540488 7:50471720-50471742 CAGCAGACAACTGTGTGTGCAGG - Intronic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028666411 7:93348738-93348760 CAGCATCCAGATGTGGCTGAAGG - Exonic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029677653 7:102081539-102081561 CAGGAAACAGTTGTGGCGGAAGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1032530282 7:132614631-132614653 CTGCACACAGCTGTGGTTGCTGG - Intronic
1033226353 7:139566237-139566259 CAGGAGACAGCTGTGGCTAATGG + Exonic
1033241161 7:139681121-139681143 CATCAGAGAGCTGTGGTTGACGG - Intronic
1033646440 7:143308413-143308435 TAGGAAACAGCTGTGGGAGCTGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034324176 7:150215208-150215230 CAGCAAACTCCTGTGGGTAGAGG + Intergenic
1034393415 7:150802469-150802491 GAGCAAACAGCTGAGGGCGGTGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034769018 7:153754028-153754050 CAGCAAACTCCTGTGGGTAGAGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036633194 8:10529760-10529782 CAGCCACCAGGTGTGGGTGAGGG - Intronic
1037915463 8:22770252-22770274 CAGTCAACAGCTGTGGGAGGTGG + Intronic
1037974730 8:23201142-23201164 CAGCAGACAGGTGGGGGCGAGGG - Intronic
1037976085 8:23213729-23213751 GAGCAAACAGCTGGGCGTGGTGG - Intronic
1038259850 8:25983531-25983553 CAGTAGACAGCTGGGGATGAGGG - Intronic
1038665958 8:29538325-29538347 AAGCAAACAGGTGGGGGAGAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041740203 8:61149956-61149978 AAGCACATAGCTGCGGGTGAGGG + Intronic
1042006185 8:64182726-64182748 CAGCCAAGAGATGTGGGTGGTGG - Intergenic
1042145233 8:65721430-65721452 CAGTTAACAGCTGTTGGTGTTGG - Intronic
1042172279 8:66003588-66003610 GAGCAAACAGATGTGAGTTAAGG - Intergenic
1043013561 8:74910299-74910321 AAGCACACAGGTGTAGGTGAAGG - Intergenic
1044784275 8:95778257-95778279 CAGCTGACATCTGTGGCTGATGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047989840 8:130274451-130274473 AATCAAACAGCTGTGGTTTATGG + Intronic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048264877 8:132976857-132976879 CATCAAACAGAAGTGGGTGGTGG + Intronic
1048493941 8:134920001-134920023 CAGCCAGCGGATGTGGGTGATGG - Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049348539 8:142151966-142151988 CAGCTCACAGCCGTGGGCGAGGG - Intergenic
1049580671 8:143409146-143409168 CAGCCAACAGCTGGGGCTGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051894031 9:21970127-21970149 CAGCAGACAGCTGTGGGAGTAGG + Intronic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052824324 9:33164104-33164126 CAGCTGACAGGTGTGGGTTATGG - Intronic
1053069216 9:35091264-35091286 CAGCAAGCAGATGTAGGAGAAGG + Exonic
1053558188 9:39160165-39160187 CAGAAGAGAGGTGTGGGTGAGGG - Intronic
1053822305 9:41980401-41980423 CAGAAGAGAGGTGTGGGTGAGGG - Intronic
1054138927 9:61458761-61458783 CAGAAGAGAGGTGTGGGTGAGGG + Intergenic
1054608269 9:67206977-67206999 CAGAAGAGAGGTGTGGGTGAGGG + Intergenic
1054784776 9:69200268-69200290 CAGCATGGAGCTGTGGGAGAGGG + Intronic
1054898600 9:70342489-70342511 CAAAAAACAGCTGGGGGTGGGGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057117150 9:92536196-92536218 TAGAAAACAGCAGTGGGTGTGGG + Intronic
1060874186 9:127068351-127068373 GAGCAAATAGCTGTGGATGCAGG + Intronic
1061311054 9:129762838-129762860 CAGCAAACGGCTGGGCGTGGTGG + Intergenic
1061470400 9:130820524-130820546 CTGCAAAGAGGTGTGTGTGAGGG - Intronic
1062314090 9:135957051-135957073 CAGCAAGCAGTTGTGTGTGCTGG - Intronic
1062400599 9:136371017-136371039 CATCAAGGAGCTGCGGGTGAAGG - Exonic
1203427022 Un_GL000195v1:50653-50675 CAAGGAACAGTTGTGGGTGAAGG - Intergenic
1187186849 X:16995145-16995167 CAGCACACATCTGTGAGAGAGGG - Intronic
1187463998 X:19512935-19512957 CATCAAAAAGCAGTGAGTGATGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188304583 X:28546862-28546884 CAGGAAACAGATGATGGTGATGG - Intergenic
1188527272 X:31099922-31099944 GAGGAAACAGCTGTCGGGGAAGG - Intronic
1189280235 X:39816046-39816068 CTGGAAAGAGCTGTAGGTGAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191225656 X:58040402-58040424 CAGCAAAGTGATGTTGGTGATGG - Intergenic
1192801014 X:74465043-74465065 CAGCAAACAGCTGTTGTTTCAGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195136468 X:101911853-101911875 GAGCAAGGAGCTGTGGCTGAAGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198435143 X:136609795-136609817 CAACAACAAGCTGTGGGTGTTGG + Intergenic
1199255777 X:145716838-145716860 AAGGAAACTTCTGTGGGTGATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200941260 Y:8784135-8784157 CAACAACCAGCCGTGGTTGATGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic