ID: 1019852613

View in Genome Browser
Species Human (GRCh38)
Location 7:3574556-3574578
Sequence CCAGAGCCAAGGGCATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019852613 Original CRISPR CCAGAGCCAAGGGCATAGTG GGG (reversed) Intronic
900393050 1:2442125-2442147 CCAGAGCCTGGGGCATGGTCAGG - Intronic
900477443 1:2882549-2882571 CCAGGGCCAGGGGCATTGTAGGG - Intergenic
900584366 1:3425404-3425426 GCAGAGCCAAAGGCATCCTGGGG - Intronic
900750291 1:4391396-4391418 CCAGTGCAAAGGTCATGGTGGGG - Intergenic
902384400 1:16068167-16068189 TCAGAGCCAAGGGCAGAGCCCGG - Intronic
903287112 1:22284273-22284295 CCAGAGCCAGGCCCATAGTAGGG - Intergenic
903919375 1:26788363-26788385 TCAGAGCCAAAGGCCTCGTGGGG - Exonic
904381139 1:30111934-30111956 CCAGGGCCAAGGGCTTCCTGAGG + Intergenic
907141233 1:52187001-52187023 CCAAAGCCAAGGGCATCCTCAGG + Intronic
912804106 1:112742388-112742410 CCAGAGCCTAGGCCATAGTGGGG + Intergenic
915259896 1:154669888-154669910 CCAGAGTCAAGCACCTAGTGGGG - Intergenic
915585742 1:156842976-156842998 GGAGAGCCAAGGGCATTGTCAGG - Intronic
916056962 1:161074556-161074578 CCTGGGCCAAGGGCTTGGTGGGG - Intronic
916170625 1:161999043-161999065 GCAGAGGCAAGGTCACAGTGAGG + Intronic
918187273 1:182139337-182139359 CCAGAGCATAGGGCATAGGTAGG + Intergenic
919905409 1:202075211-202075233 CCAGAGCACAGGGCAGAGAGGGG - Intergenic
920315134 1:205071466-205071488 GCAGAGGCAAGGGCAGAGTTTGG - Intronic
920873091 1:209810199-209810221 CCAGGGCCAAGAGAAAAGTGAGG - Intergenic
920928325 1:210363659-210363681 CCAGGGCCCAGGTCATGGTGGGG + Intronic
922685246 1:227633840-227633862 CCAGAGCCAGTGGACTAGTGGGG + Intronic
922824990 1:228511748-228511770 CCAGGGGCAAGGCCATGGTGAGG - Intergenic
1063964616 10:11337516-11337538 CCAAAGCCAAGGGCCTGGAGAGG + Intergenic
1064529976 10:16298019-16298041 CCAGAGCCATGGGAATTCTGGGG - Intergenic
1064663863 10:17630713-17630735 CTGGAGCCAAAGGCATAGTCAGG - Intergenic
1064994674 10:21286079-21286101 AAAGAGCCAAGGTCATAGTGAGG - Intergenic
1068667082 10:59688167-59688189 CCACAGCCAAGTGCATGGTTTGG - Intronic
1070403685 10:76075872-76075894 CCATAGCCAATGGGAGAGTGGGG - Intronic
1070678514 10:78432795-78432817 CCAGAGCCCAGGGCACACAGTGG + Intergenic
1074061775 10:109972913-109972935 CCAGGGCAGAGGGCACAGTGGGG + Intergenic
1074256876 10:111811860-111811882 CCAGAGCCACAGTCAGAGTGTGG + Intergenic
1075274872 10:121084452-121084474 TCAGAGCCAAGGACATGGGGAGG + Intergenic
1075647298 10:124104920-124104942 CCAGAGGCATGGGGATAGTGAGG - Intergenic
1076036028 10:127198839-127198861 CCAGAGCCAAAGGTAAGGTGAGG - Intronic
1077323587 11:1953614-1953636 CCAGCCCCAGGGGCAGAGTGGGG - Intronic
1077860455 11:6173522-6173544 CCAGACCCAAGGGCTTTGGGTGG + Intergenic
1079279202 11:19072708-19072730 CCAGGGAGGAGGGCATAGTGTGG + Intergenic
1079569985 11:21930926-21930948 ACAGAGACAAGTGCACAGTGTGG - Intergenic
1081495369 11:43604672-43604694 CCAGATCCAAGGGACTTGTGTGG - Intronic
1081807953 11:45900353-45900375 CCAGAGCCAAGGCCAGAGCCAGG + Exonic
1082785273 11:57313226-57313248 CCAGACCCGAGGGCCTCGTGGGG + Exonic
1083544416 11:63538126-63538148 CCAGAGCCAGGGCAGTAGTGAGG + Intronic
1085398438 11:76219702-76219724 CCAGAGCCTAGTGCATAGTAGGG - Intergenic
1085720490 11:78908111-78908133 CCTGAACCAAGATCATAGTGAGG + Intronic
1088526706 11:110763558-110763580 CCAGAGCCAAAGTCACAGTGAGG + Intergenic
1088556114 11:111062954-111062976 CAAGAGTCAGTGGCATAGTGGGG + Intergenic
1089214554 11:116827757-116827779 CCAGAGGCAAAGGCACAGTGGGG - Intergenic
1089680409 11:120116102-120116124 CCAGAGACTAGGGCCTAGAGAGG + Intronic
1090265210 11:125349261-125349283 AGAGAGCCAAGAGCAGAGTGAGG - Intronic
1090422209 11:126583219-126583241 TCTGAGCCAAGGGTATTGTGTGG + Intronic
1090567764 11:128014446-128014468 CCAAAGAAAAGGCCATAGTGTGG + Intergenic
1202806574 11_KI270721v1_random:8809-8831 CCAGCCCCAGGGGCAGAGTGGGG - Intergenic
1091823471 12:3492665-3492687 CCAGAGCCTACGGAATAGTCCGG - Intronic
1091833958 12:3571160-3571182 CCAGAGCCAGGGGCAGAAAGGGG - Intronic
1092209848 12:6639117-6639139 GCAGAGCCAGGGGCAGGGTGTGG + Intronic
1092402504 12:8188692-8188714 CCAGGGTCAAGGGGATGGTGTGG + Intergenic
1096197265 12:49656775-49656797 CCAGAGCCCTGGACAGAGTGGGG + Intronic
1096539153 12:52294533-52294555 CCAGAGCCAAGACCATAGAGTGG - Intronic
1096706534 12:53425499-53425521 CCAGAGCCAAGGCCAGACTCAGG + Exonic
1102033601 12:109758732-109758754 CCACCTCCAAGGGCAGAGTGTGG + Intronic
1104745291 12:131206812-131206834 CCAAAGCCAAGGGCAGAGGGTGG - Intergenic
1104789046 12:131470294-131470316 CCAAAGCCAAGGGCAGAGGGTGG + Intergenic
1104834792 12:131781972-131781994 ACAGGGCCAAGGGCATAGCTGGG + Intronic
1106322880 13:28658971-28658993 CCAGGGCCAAGGGCGCAGTAAGG - Intergenic
1113653395 13:112053855-112053877 CCAGAGCCAAGTGCAGAGCGTGG - Intergenic
1121010405 14:90517042-90517064 CCAGAGCCTGGGGAATAGCGAGG - Intergenic
1121172595 14:91867590-91867612 CCACAGCCAACAGCAAAGTGAGG + Intergenic
1121441387 14:93951927-93951949 CCAGAGCCAAGGGCACGTTTGGG - Intronic
1121782706 14:96632110-96632132 CCAGTGCCTGGTGCATAGTGAGG - Intergenic
1122338621 14:101009790-101009812 ACAGGGCCAAGGGGATAGAGTGG - Intergenic
1122422033 14:101583790-101583812 CCAGAGCTCAGGGCGGAGTGGGG + Intergenic
1122509967 14:102258549-102258571 CCAGAGGCAGGGACATGGTGGGG - Intronic
1122833939 14:104421791-104421813 CCAGACTCTAGGGCATTGTGGGG + Intergenic
1122847281 14:104506790-104506812 CCAGATCCAAGCGCCCAGTGTGG - Intronic
1125045724 15:35240613-35240635 CTGGAGCCAAAGGCATAGTCAGG + Intronic
1126329830 15:47520335-47520357 CCTGGGCCAGGGGCAGAGTGAGG + Intronic
1127166444 15:56248852-56248874 CCAGAGCCAATCCCACAGTGAGG + Intronic
1128548088 15:68580530-68580552 CCAGGGCCAATGGCAAAGTTTGG - Intronic
1128737967 15:70064222-70064244 CCAGAGCCAGTGGCAGGGTGAGG - Intronic
1129060481 15:72856863-72856885 CCAGCGGGAAGGGCAGAGTGGGG - Intergenic
1129265678 15:74392003-74392025 CCAGAGCCGAGGGCAGAGGCTGG - Intergenic
1130025296 15:80265911-80265933 CCAGAGGCTAGGGCTTAGGGAGG - Intergenic
1130373836 15:83310341-83310363 CCAGAGTCTAGGGCATGGAGGGG + Intergenic
1131597310 15:93811582-93811604 CCTGAGCCAAAGGCAAAATGGGG + Intergenic
1133072719 16:3257055-3257077 CCAGAGCCAATGGCACAGGACGG + Intergenic
1134803118 16:17103808-17103830 CCAGAGCCAAAGACAACGTGAGG + Exonic
1135118143 16:19741079-19741101 CCAGACCCCAGGGCACACTGAGG + Intronic
1135630703 16:24033948-24033970 CCAGAGACAAGTGCAGAGAGTGG + Intronic
1136511206 16:30739172-30739194 CCAGGGCCAAGGGGAGAGTGAGG + Exonic
1136591759 16:31221837-31221859 GCAGAGAGAAGGGCATTGTGGGG + Intronic
1137556302 16:49472608-49472630 CCAGCGCCCAGTGCCTAGTGTGG - Intergenic
1137705603 16:50533710-50533732 CCAGAGGCAAGGGCTTCATGGGG + Intergenic
1137968831 16:52963471-52963493 CCAGAGCCAGGGGAATGGGGTGG - Intergenic
1138276181 16:55736620-55736642 GCAGAGCCCAGGGCATACAGAGG - Intergenic
1138341386 16:56291589-56291611 GCAGAGGCAAGGGCAGAATGAGG - Intronic
1138684322 16:58711393-58711415 CCAGAGCCATGGGAATGGAGTGG - Intronic
1140158210 16:72455819-72455841 CCAGAGCCAGCGGACTAGTGGGG - Intergenic
1142251494 16:88993915-88993937 CCAGAACCAGGGGCCCAGTGAGG + Intergenic
1147176210 17:38657749-38657771 CCAGAGCCAGGCTCAGAGTGAGG + Intergenic
1147644594 17:42026337-42026359 GCAGAGCCAAGGAGGTAGTGGGG - Intronic
1147925021 17:43940856-43940878 CCAGAGCCAAGGGTGCAGAGGGG + Exonic
1147950422 17:44104646-44104668 CCTGAGCCAAGAGCACAGAGTGG - Intronic
1148180611 17:45602124-45602146 CCAGAGCCAAGGCCAGAGCCAGG - Intergenic
1148268291 17:46243791-46243813 CCAGAGCCAAGGCCAGAGCCAGG + Intergenic
1148689205 17:49517058-49517080 TCAGAGCCAGGGGCATGGGGTGG + Intergenic
1148996343 17:51713587-51713609 CTAGAGCAAAGGGTAGAGTGTGG + Intronic
1149660920 17:58333483-58333505 CCAGAGCCAAGCCCATGGAGAGG - Intergenic
1149690036 17:58567840-58567862 CCAGAGCCCAGGACAAAGTCTGG + Intronic
1152791583 17:82283103-82283125 CCAGAGCCAGGGGAGGAGTGAGG + Intergenic
1157300018 18:46472525-46472547 ACAGGCCCCAGGGCATAGTGTGG - Intergenic
1158083793 18:53626156-53626178 CCAGAGCCACAGCCAGAGTGGGG + Intergenic
1160382884 18:78474289-78474311 CCATGGCCATGTGCATAGTGTGG - Intergenic
1160382945 18:78474648-78474670 CCACAGCCGTGTGCATAGTGTGG - Intergenic
1161045166 19:2130706-2130728 CCTGAGTCAGGGGCACAGTGAGG - Intronic
1163166969 19:15505264-15505286 CCACAGCCCAGGGCTCAGTGGGG - Intergenic
1163468784 19:17485045-17485067 CCAGAGCCAGGGGCGCAGGGTGG + Intronic
1163698687 19:18776503-18776525 TCAGAGCCCAGGCCACAGTGGGG - Intronic
1164219591 19:23181475-23181497 TCAGAGCCATTGGCATCGTGAGG + Intergenic
925123766 2:1439220-1439242 CCAGTGCCAATGTCATTGTGTGG - Intronic
925166202 2:1717174-1717196 CCTCAGCCAAGAGGATAGTGAGG - Intronic
925766406 2:7240207-7240229 CCAGAGCCAGGTGCATAGTCAGG - Intergenic
926083483 2:10006838-10006860 ACAGAGCCAAGTGCTTCGTGTGG - Intergenic
926426851 2:12746017-12746039 CCAGACCCAAGGGAATAGAGAGG + Intergenic
926821413 2:16855262-16855284 CCAGATCCAAGAGCACAGCGCGG + Intergenic
928087905 2:28357058-28357080 CCAGAGCCCAGGGCCTGGGGAGG - Intergenic
929573517 2:43038494-43038516 CCAAAGCCTGGGGCAGAGTGGGG - Intergenic
929608268 2:43250384-43250406 CCAGAGGCCAGGGGATAGTGGGG + Intronic
933642970 2:84783994-84784016 CCAGTGCAAAGGCCCTAGTGAGG + Intronic
934495372 2:94791712-94791734 CTAGAGCAAAGGGCAGAGTGCGG + Intergenic
937216354 2:120316039-120316061 CCAGGGCCAAGGCCACTGTGAGG - Intergenic
937556040 2:123157279-123157301 CAACAGCCAAGAGCAAAGTGTGG - Intergenic
939803348 2:146740839-146740861 CAAGAGCCAAGAGCAAAATGTGG + Intergenic
940971275 2:159899614-159899636 TCAGATCCAAGTACATAGTGAGG + Intronic
942388267 2:175464459-175464481 CCAGAGCCCAAGGCTGAGTGGGG - Intergenic
943993025 2:194721517-194721539 CCCGAGCCAAGGGCTGAGTGGGG + Intergenic
944589643 2:201204979-201205001 CCAGAGACAAGGACAGAGTTTGG + Intronic
947359861 2:229335853-229335875 CCAGAGGTAGGGGCATAGAGTGG - Intergenic
947571592 2:231239999-231240021 GCAGAGCCTGGCGCATAGTGTGG + Exonic
1168790387 20:572224-572246 CCAGTGCAAAGGGAATATTGAGG - Intergenic
1169404902 20:5315098-5315120 CCAGTGCCTGGTGCATAGTGGGG + Intergenic
1170477926 20:16734904-16734926 GCAGAGCCAAGGGAGTTGTGAGG + Intronic
1170723848 20:18908256-18908278 CCTCAGGCAAGGTCATAGTGAGG - Intergenic
1170820754 20:19755011-19755033 CTGGAGCCAAAGGCATAGTCAGG - Intergenic
1171231658 20:23491700-23491722 CCAGGGCCAGGGGAATGGTGAGG - Exonic
1173021076 20:39268731-39268753 CCAAAACCAAGGGCATCCTGAGG - Intergenic
1173643594 20:44620012-44620034 CCAAAGCCAAGGGCAGGGAGAGG - Intronic
1175606826 20:60318018-60318040 TCAGCGCCATGGGCTTAGTGGGG + Intergenic
1175868043 20:62191856-62191878 CAGGTGCCAAGGGCACAGTGAGG - Intronic
1176182059 20:63754255-63754277 GGAGAGCCAGGGGCACAGTGTGG - Intronic
1176244212 20:64089710-64089732 TCAGAGGCCAGGGCAGAGTGTGG - Intronic
1177925766 21:27212698-27212720 TCAGAGCCAATGGCATAGATAGG - Intergenic
1178422142 21:32451464-32451486 TCAGAGCCCAGGGCTGAGTGTGG + Intronic
1178474196 21:32922163-32922185 CCAAAGCCAAGGCCATTGAGAGG + Intergenic
1178519554 21:33277174-33277196 CCAGAGCGAAGGACAGAGGGAGG + Intronic
1179643858 21:42763552-42763574 CCAGAACCAAGATCAAAGTGTGG - Intronic
1180049687 21:45325487-45325509 CCTGAGCCGTGGGCAGAGTGGGG + Intergenic
1180122598 21:45763848-45763870 CCACGGCCAAGGGCAAAGGGAGG - Intronic
1181423475 22:22817968-22817990 CCAGAGCAAAGGGCAGGGAGGGG - Intronic
1181959426 22:26612207-26612229 CCCATGCCAAGGGCAGAGTGAGG + Intronic
1183376283 22:37467396-37467418 CCAGAGGCAGGGGCTGAGTGTGG - Intergenic
1184120290 22:42445656-42445678 CCAGTGAAAAGGGCACAGTGAGG - Intergenic
1184445266 22:44543459-44543481 TCAGAGGCAGGGGCAGAGTGTGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950458237 3:13105311-13105333 CCACAGCCAGGGGCAGAGCGAGG + Intergenic
952138042 3:30445856-30445878 CCAAAGCCAAGGGAAGAGTCAGG + Intergenic
954003115 3:47573234-47573256 CCAGAGCCCAGGGCAGGGAGAGG - Intronic
954155732 3:48684107-48684129 ACAGAGCCAAAGCCAGAGTGTGG + Intronic
954268556 3:49489515-49489537 CCAGAGCTAAGGGCAAAATGTGG - Intronic
954453263 3:50583101-50583123 CCAGAGCCCAGAGCATAGACAGG + Exonic
954677112 3:52322150-52322172 CCAGAGTTAAGGGCTGAGTGAGG - Intronic
954998774 3:54906941-54906963 CCAGTGACAAGGGCATGTTGAGG + Intronic
955405401 3:58622731-58622753 CCAGAGACCAGGGCCCAGTGGGG + Intronic
956564759 3:70624086-70624108 CCAGAACCAAAGGAATAGTCTGG - Intergenic
959917896 3:111838325-111838347 CCAGAGGCAAGAGCGTACTGAGG - Intronic
960852966 3:122074976-122074998 TCAGAGCCAAGGGTGGAGTGGGG - Intronic
961276592 3:125732085-125732107 CCAAAGGGAAGGGCACAGTGAGG - Intergenic
961478704 3:127165297-127165319 CCAGAGCCAAGGCCATGGCCTGG + Intergenic
961680630 3:128597747-128597769 CCAGTGCCCAGGGCATGGAGGGG - Intergenic
961877848 3:130037648-130037670 CCAAAGGGAAGGGCACAGTGAGG + Intergenic
965602506 3:170469071-170469093 CCAGTGCCTAGGCCATAGTGTGG - Intronic
967624701 3:191670352-191670374 CTGGAGCCAAAGGCATAGTCAGG - Intergenic
967731055 3:192907324-192907346 CCTGAGCCAAGGGTATATAGGGG - Intronic
968132273 3:196198618-196198640 ACAGAGCCAAGGACGTAGGGAGG + Intronic
969866425 4:10079530-10079552 CCAGAGGCAAAGGCCCAGTGCGG - Intronic
971180503 4:24325054-24325076 CTGGAGCCAAAGGCATAGTCAGG + Intergenic
972209756 4:36823190-36823212 CCAGAACCAAGGGGTGAGTGGGG + Intergenic
974863839 4:67555735-67555757 CCAGAGCAAAGGGTATTTTGAGG + Intergenic
975174809 4:71276036-71276058 CCAGATCCAAGTGCAGATTGAGG + Intronic
978861738 4:113458248-113458270 CCAGAGGCTGGAGCATAGTGAGG - Intronic
980790017 4:137608320-137608342 CCAGAGCCCATGGCAGGGTGAGG - Intergenic
982658183 4:158174764-158174786 CCAGAGCCAGGCTCAAAGTGGGG - Intergenic
984700616 4:182816363-182816385 CTGGAGCCAAAGGCATAGTCAGG + Intergenic
986205342 5:5619940-5619962 CCAGAGCTACGGGCATAATCAGG + Intergenic
989110441 5:37902076-37902098 CCAGAAAGAAGGGCATAGGGTGG - Intergenic
993181337 5:84557049-84557071 CCAGAGGCAAGGGCATTGCCAGG - Intergenic
993805110 5:92397520-92397542 ACAGAGTCAAGGACATAGTGGGG + Intergenic
994653772 5:102563115-102563137 CAAAAGTCAAGGGCATAGAGAGG + Intergenic
996691544 5:126345749-126345771 CAAGAGCCAAGAGATTAGTGTGG - Intergenic
997037105 5:130205930-130205952 CCAGAAGCAAGGCCATACTGTGG - Intergenic
997211250 5:132078299-132078321 CCACAGCCAGGGGCCCAGTGAGG + Intergenic
999445799 5:151638251-151638273 GCAGAGCCAAGGTCAAAGGGTGG - Intergenic
1000887682 5:166766152-166766174 CCACAGCCAAGGGGAAAGAGGGG - Intergenic
1001218201 5:169875398-169875420 ACTCAGCCAAGGGCATCGTGAGG - Intronic
1001475142 5:172045016-172045038 CCAGAGCCTAGGGAAGAGAGAGG + Exonic
1002074547 5:176700404-176700426 CCACAGCCCAGGGCTGAGTGTGG + Intergenic
1003430221 6:6031651-6031673 CTGGAGCCAAAGGCATAGTCAGG - Intergenic
1003926831 6:10884162-10884184 CCCGCGCCAAAGGCACAGTGAGG + Intronic
1004071294 6:12300325-12300347 CCAGAGCCAAGGGGATACACTGG + Intergenic
1005379450 6:25218315-25218337 CCAGGGGCAGGGGCATGGTGGGG + Intergenic
1007322160 6:41035122-41035144 CCAAAGCCAAAGGCCTGGTGGGG + Exonic
1008448172 6:51617992-51618014 CCAGAGCCAAGGACACAGTCAGG + Exonic
1010730081 6:79381718-79381740 CCAAAGCCAAGGCCCTAATGAGG - Intergenic
1010894594 6:81348999-81349021 CTGGAGCCAAAGGCATAGTCAGG - Intergenic
1012058983 6:94452998-94453020 CTAAAGCCTAGGGCCTAGTGAGG + Intergenic
1015034041 6:128630895-128630917 ACAGAGTCAAGGGCAAAGTAAGG - Intergenic
1018125652 6:160679584-160679606 CCTGAGGCATGGGCAAAGTGTGG + Intergenic
1018179577 6:161209503-161209525 CCACAGCCTTGGGCATAATGAGG + Intronic
1018596305 6:165484853-165484875 ACTGAGACAAGTGCATAGTGTGG - Intronic
1018799758 6:167212731-167212753 CCACAGCTAATGACATAGTGGGG + Intergenic
1018813211 6:167312761-167312783 CCACAGCTAAGGACATAGTGGGG - Intronic
1019852613 7:3574556-3574578 CCAGAGCCAAGGGCATAGTGGGG - Intronic
1020260550 7:6528565-6528587 CCAGGGCCAAGGGCAAGATGAGG + Intronic
1022484961 7:30771210-30771232 CCAGGGCCAGGGTCAGAGTGAGG + Intronic
1023560209 7:41466171-41466193 CCAAAACCAAAGGCACAGTGCGG - Intergenic
1023803758 7:43856644-43856666 TCAGAGTCAGGGGCATGGTGAGG + Intergenic
1023817386 7:43961467-43961489 ACAGAGCCAAGGGCAGAGGTGGG - Intergenic
1023836648 7:44072558-44072580 CCAGAGCCAGGGGCTATGTGTGG + Exonic
1026882905 7:73919005-73919027 CCAGAGCCTAGGCCATGGGGAGG + Intergenic
1027194506 7:76020386-76020408 CCAGTGCCAATGGCAAAGGGTGG + Intronic
1028116272 7:87001491-87001513 CCAGAGGAAGTGGCATAGTGAGG + Intronic
1029742011 7:102496341-102496363 ACAGAGCCAAGGGCAGAGGTGGG - Intronic
1029760000 7:102595506-102595528 ACAGAGCCAAGGGCAGAGGTGGG - Intronic
1031064594 7:117091251-117091273 CCAGGGCCAAGGGCAAGGAGAGG + Intronic
1033544667 7:142389190-142389212 CCAGGGCCCATGGCACAGTGGGG - Intergenic
1033552810 7:142463105-142463127 CCAGGGCCCATGGCACAGTGGGG - Intergenic
1033555135 7:142482543-142482565 CCAGGGCCCATGGCACAGTGGGG - Intergenic
1033973323 7:147069437-147069459 CCAGAGGCAAGGACATATAGGGG + Intronic
1034447802 7:151122371-151122393 CAGGAGCCAAGGGCACAGCGAGG - Intronic
1035024164 7:155815436-155815458 CCCGAGCCGAAGGCAGAGTGAGG - Intergenic
1035073118 7:156159271-156159293 CCCCAGCCAAGGGCAGGGTGAGG - Intergenic
1035462291 7:159049502-159049524 CCAGAGCCAGGGCCATAGCGAGG + Intronic
1035793652 8:2332590-2332612 GCAGAGGCAATGGAATAGTGTGG + Intergenic
1035799151 8:2389115-2389137 GCAGAGGCAATGGAATAGTGTGG - Intergenic
1036345757 8:7961453-7961475 CCAGGGTCAAGGGGATGGTGCGG + Intergenic
1036841092 8:12122207-12122229 CCAGGGTCAAGGGGATGGTGCGG + Intergenic
1036862892 8:12368459-12368481 CCAGGGTCAAGGGGATGGTGCGG + Intergenic
1037947845 8:23000211-23000233 CCAGAGCCCAGGGACTAGCGGGG - Intronic
1038375906 8:27040119-27040141 CCATTGCCAAAGCCATAGTGTGG + Intergenic
1040101250 8:43508597-43508619 CTAGAGCAAAGGGCAGAGTGTGG - Intergenic
1041882442 8:62767173-62767195 CCAGAGCCTGGAGGATAGTGGGG - Intronic
1041984558 8:63906700-63906722 CCGCAGCCAAGGCCACAGTGTGG - Intergenic
1046041865 8:108915322-108915344 CCAGAGCCCAGGGCAGCCTGTGG + Intergenic
1046895942 8:119473478-119473500 CATGAGCCTAGAGCATAGTGTGG + Intergenic
1047223606 8:122938493-122938515 GAAGAGCCAAGGGCATGGCGAGG + Intronic
1047779231 8:128098130-128098152 CCAGCCCCAAGGACATGGTGGGG - Intergenic
1048426368 8:134327745-134327767 CAAGGGCCAGGGGCATGGTGGGG - Intergenic
1048508408 8:135041381-135041403 CCAGAGACATGGGCTGAGTGGGG - Intergenic
1048628080 8:136208639-136208661 CCAGTGCCAGGGACAAAGTGAGG + Intergenic
1049782355 8:144434805-144434827 CCAGAGCCTGGGGCAAGGTGAGG - Exonic
1050757634 9:9027039-9027061 CCAGAGCCAAGGATAGAGAGGGG - Intronic
1052989109 9:34508330-34508352 CCAGAGCCTGGGGCAGAGGGTGG + Intronic
1053122744 9:35558724-35558746 ACAGAGTCATGGGCACAGTGGGG - Intronic
1053661754 9:40288647-40288669 CTAGAGCAAAGGGTAGAGTGCGG - Intronic
1053912127 9:42917991-42918013 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054373879 9:64434883-64434905 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054522855 9:66087637-66087659 CTAGAGCAAAGGGTAGAGTGCGG + Intergenic
1055665355 9:78547409-78547431 CAAGATCCAAGGGCAAAGAGAGG - Intergenic
1056587045 9:87934618-87934640 CTAGAGCAAAGGGCAGAGTGCGG + Intergenic
1057162521 9:92899010-92899032 CTAGAGCAAAGGGCAGAGTGAGG + Intergenic
1059365185 9:113781349-113781371 CCAGAGGAAAGAGCATAATGTGG - Intergenic
1060189144 9:121581237-121581259 CCAGAGCCAAGGGGGTAGTGGGG + Intronic
1060481380 9:124018445-124018467 CCAGAGGCAAGGGCAGGGGGCGG - Intronic
1060787894 9:126464881-126464903 CCAGTGCCAGGGCCATTGTGAGG + Intronic
1060867719 9:127013253-127013275 ACAGAACCAAGGCCATAGTGGGG - Intronic
1060875560 9:127081322-127081344 GCAGAGGCAAGGGCAGAGGGTGG - Intronic
1061872682 9:133529106-133529128 CCAGGGCCAAGGGCATGCAGAGG - Intergenic
1061878456 9:133556621-133556643 CCAGAGCCAAGGCCACAGCTGGG + Intronic
1188318823 X:28710130-28710152 CCAGTGCCCAGCCCATAGTGAGG - Intronic
1192309039 X:69994189-69994211 CCAGAGCCAAAAGCAGAGTTAGG - Intronic
1192737154 X:73860746-73860768 CCAAATGCAGGGGCATAGTGTGG + Intergenic
1194484680 X:94472498-94472520 GCAGAGCAAAGGGGGTAGTGGGG - Intergenic
1194710596 X:97232162-97232184 CCAGAGGCAAGGGCTATGTGAGG - Intronic
1196091023 X:111742719-111742741 CCAGGGCCAAGGCCAAGGTGTGG - Intronic
1197510005 X:127359486-127359508 CCAGAGTCATGCTCATAGTGAGG - Intergenic
1197578762 X:128255934-128255956 CATGAGCCAATGCCATAGTGGGG + Intergenic
1197674007 X:129310339-129310361 CCAGAGTCTAGGGAATTGTGAGG + Intergenic
1199591970 X:149475925-149475947 CCAGAACCAAGGTGCTAGTGAGG - Intergenic