ID: 1019860225

View in Genome Browser
Species Human (GRCh38)
Location 7:3651904-3651926
Sequence CTAAGCCAACGATCCCAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019860221_1019860225 15 Left 1019860221 7:3651866-3651888 CCAAGGGATGGAACTGCTGCCAT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1019860225 7:3651904-3651926 CTAAGCCAACGATCCCAAGTCGG No data
1019860223_1019860225 -4 Left 1019860223 7:3651885-3651907 CCATGGAGTTCCGTGTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1019860225 7:3651904-3651926 CTAAGCCAACGATCCCAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019860225 Original CRISPR CTAAGCCAACGATCCCAAGT CGG Intronic
No off target data available for this crispr