ID: 1019860225 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:3651904-3651926 |
| Sequence | CTAAGCCAACGATCCCAAGT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019860221_1019860225 | 15 | Left | 1019860221 | 7:3651866-3651888 | CCAAGGGATGGAACTGCTGCCAT | 0: 1 1: 0 2: 0 3: 19 4: 190 |
||
| Right | 1019860225 | 7:3651904-3651926 | CTAAGCCAACGATCCCAAGTCGG | No data | ||||
| 1019860223_1019860225 | -4 | Left | 1019860223 | 7:3651885-3651907 | CCATGGAGTTCCGTGTCAGCTAA | 0: 1 1: 0 2: 0 3: 5 4: 57 |
||
| Right | 1019860225 | 7:3651904-3651926 | CTAAGCCAACGATCCCAAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019860225 | Original CRISPR | CTAAGCCAACGATCCCAAGT CGG | Intronic | ||
| No off target data available for this crispr | |||||