ID: 1019861101

View in Genome Browser
Species Human (GRCh38)
Location 7:3658906-3658928
Sequence TAGTGGTGATGGGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019861101_1019861110 26 Left 1019861101 7:3658906-3658928 CCATGCCTGGCCCATCACCACTA 0: 1
1: 0
2: 3
3: 71
4: 609
Right 1019861110 7:3658955-3658977 GAAGAAAACCCTGTACCCCTTGG 0: 1
1: 0
2: 3
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019861101 Original CRISPR TAGTGGTGATGGGCCAGGCA TGG (reversed) Intronic
900074132 1:798723-798745 AAGTGGAAATAGGCCAGGCATGG + Intergenic
901832918 1:11904696-11904718 CAGGGGAAATGGGCCAGGCATGG + Intergenic
902286901 1:15412920-15412942 GAGGGCTGATGGGGCAGGCAGGG + Intronic
902534198 1:17109779-17109801 TAGTGGCTCTGGGTCAGGCATGG - Intronic
902567009 1:17318227-17318249 TAGTCGTGATGTGGCAGGAATGG + Intronic
902587449 1:17449131-17449153 TAGATGAGGTGGGCCAGGCATGG - Intergenic
902603837 1:17557820-17557842 TAGGGATGATTGGCCAGGCTGGG + Intronic
902932302 1:19740242-19740264 TAGAGGGGATGGGCAGGGCAGGG - Intronic
903428471 1:23272894-23272916 TGCTGGAAATGGGCCAGGCACGG + Intergenic
903662717 1:24988313-24988335 CAGTGCTGATTGGCCAGGCCTGG + Intergenic
903935485 1:26892257-26892279 AAGTGGATCTGGGCCAGGCACGG - Intronic
904182652 1:28677485-28677507 TACAGATTATGGGCCAGGCACGG - Intronic
904270072 1:29344090-29344112 GAGGGGTTCTGGGCCAGGCAGGG - Intergenic
904543963 1:31253806-31253828 TAGTTGTCCTTGGCCAGGCATGG - Intergenic
904547903 1:31290996-31291018 TAACAGTGATTGGCCAGGCACGG + Intronic
904675030 1:32193845-32193867 GAATGGTAAGGGGCCAGGCATGG - Intronic
905072723 1:35241694-35241716 TAGTGAAAATGGGCCAGGCGTGG + Intergenic
905127861 1:35728370-35728392 TTGTGGTTTTGGGCCAGGCATGG - Intronic
905562586 1:38939369-38939391 TAGCTGAGATGGGCCAGGCATGG + Intronic
906074447 1:43041796-43041818 TAGTGGTGCTGGGCTTGGTATGG + Intergenic
906261191 1:44392067-44392089 AAGAGGAAATGGGCCAGGCATGG + Intergenic
906273199 1:44497557-44497579 TGGTGGTGATGGGACAAGAAGGG - Intronic
906468118 1:46103286-46103308 TGGTTATGATGGGCCAGGCACGG + Intronic
906531502 1:46526489-46526511 CAGTGGTGGGGGGACAGGCAGGG - Intergenic
907050898 1:51329618-51329640 TGGTGGTGAGGCTCCAGGCAGGG + Intronic
907215022 1:52855478-52855500 AATTGATTATGGGCCAGGCACGG - Intronic
907673639 1:56498920-56498942 AAGTAGTGATGGGCCAGGCACGG - Intronic
907806786 1:57828233-57828255 TGGGGATGATCGGCCAGGCATGG - Intronic
909002930 1:70241060-70241082 AAGTGGTGAATGGCCGGGCATGG - Intronic
909555821 1:76952797-76952819 TTATGGTGATGGGGCAGGCGAGG - Intronic
910166187 1:84329782-84329804 TATTTGTGATGGGCTAGGCAGGG - Intronic
910475740 1:87604388-87604410 TAGTGGTGGTGGGGCAGGAAGGG - Intergenic
910881632 1:91926977-91926999 TATTGTTTGTGGGCCAGGCACGG + Intergenic
910934812 1:92479154-92479176 AAGTGTTGAAGGGCCAGGCACGG - Intronic
911491816 1:98578657-98578679 TACTTGTGCTTGGCCAGGCACGG - Intergenic
913256003 1:116954146-116954168 TACTCATGAAGGGCCAGGCACGG - Intronic
913541445 1:119825084-119825106 TGGTTAAGATGGGCCAGGCACGG + Intergenic
914464036 1:147910148-147910170 TAGATTTCATGGGCCAGGCACGG - Intergenic
914782468 1:150798060-150798082 TAATGGTGATCAGCCAGGAAAGG + Intronic
914805709 1:150990016-150990038 TAGTAGTCAGGGGCCAAGCATGG + Intronic
914832506 1:151180724-151180746 TAGAGGGGTTGGGCCAGGCGTGG - Intronic
915293997 1:154907252-154907274 AAGTGAGGATGGGCCGGGCATGG + Intergenic
915470650 1:156123870-156123892 TAGAAGTGCTGGGCCTGGCAGGG - Intronic
915514665 1:156405888-156405910 GAGTGGAGCTGGGCCATGCAGGG - Intronic
915938973 1:160106479-160106501 CAGAGGAGATGGCCCAGGCAGGG - Intergenic
916069357 1:161160906-161160928 TGGGGGTGGTGAGCCAGGCAGGG - Exonic
916528801 1:165636443-165636465 TTGCGTTTATGGGCCAGGCACGG + Intronic
916818470 1:168375480-168375502 TAGTGGTGATCAGAAAGGCAGGG + Intergenic
917112191 1:171559809-171559831 TAATAGGTATGGGCCAGGCATGG - Intronic
917326902 1:173842591-173842613 AAGTAATGAGGGGCCAGGCATGG - Intronic
917765757 1:178214846-178214868 TAGTCCAGGTGGGCCAGGCATGG - Intronic
917990873 1:180377655-180377677 TAATGGGCATAGGCCAGGCATGG + Intronic
918101585 1:181380902-181380924 AAGTGCTGCTGGGACAGGCATGG - Intergenic
918147006 1:181765848-181765870 TAGAGGTGAGGGTCAAGGCAAGG - Intronic
918840393 1:189529073-189529095 TTGTGTTTAAGGGCCAGGCACGG + Intergenic
919394834 1:197032736-197032758 AATTAGTGAGGGGCCAGGCACGG - Intergenic
920160399 1:203993455-203993477 TAGTTATGATCAGCCAGGCATGG - Intergenic
921374482 1:214459755-214459777 GAGTGGGGATCGGCCAGGCGTGG - Intronic
921668320 1:217898931-217898953 AAGTGATTAGGGGCCAGGCATGG - Intergenic
922050080 1:221980357-221980379 TGGTTAAGATGGGCCAGGCATGG - Intergenic
922581351 1:226700667-226700689 TATTAGTGATTGGCCAGGCTAGG + Intronic
922854274 1:228760779-228760801 TAGAGGGCATGGGCCTGGCACGG + Intergenic
923489334 1:234469974-234469996 GAGTGATTATTGGCCAGGCACGG + Intronic
924468365 1:244317782-244317804 TACTTGAGAGGGGCCAGGCACGG + Intergenic
924508961 1:244712472-244712494 TACTAGTGATGGGCCGGGCGCGG - Intergenic
1063617133 10:7610146-7610168 CTGTGGTGTTGGGTCAGGCAGGG - Intronic
1064782500 10:18857800-18857822 AAGGGGTGATGGGCCAGCAAAGG + Intergenic
1064971236 10:21069177-21069199 TAGTTATGATGGGCCAGGTGTGG - Intronic
1065175369 10:23070206-23070228 GAGTGCTGATGGGCCAGGTGCGG + Intergenic
1065344295 10:24734187-24734209 TCGAGTTGAGGGGCCAGGCATGG - Intergenic
1065619150 10:27561116-27561138 TATCAGTGATTGGCCAGGCATGG - Intergenic
1065959715 10:30724771-30724793 TAATGATGCAGGGCCAGGCATGG + Intergenic
1068780385 10:60913431-60913453 TTCTGATGATCGGCCAGGCATGG + Intronic
1068950750 10:62774747-62774769 AAGTGAGGATGGGCCAGGCAGGG + Intergenic
1069305375 10:66962699-66962721 TAGAGGAGGTGGGCCAGGCACGG - Intronic
1069662699 10:70134054-70134076 TTGTGGATAAGGGCCAGGCACGG + Intergenic
1069665807 10:70157112-70157134 TACTGTTCATGGGCCAGGCGCGG + Intronic
1070009058 10:72454490-72454512 CTGTAGTCATGGGCCAGGCACGG + Intronic
1070063272 10:73006959-73006981 AAGTTATTATGGGCCAGGCATGG - Intergenic
1070223091 10:74471362-74471384 TAGTACTGATAGGCCAGGCATGG - Intronic
1070254215 10:74800257-74800279 AAATGGTTAAGGGCCAGGCATGG + Intergenic
1070585016 10:77757940-77757962 TAGTAGAGTTAGGCCAGGCACGG + Intergenic
1071543705 10:86511117-86511139 TAAGAATGATGGGCCAGGCATGG - Intronic
1071958839 10:90788095-90788117 TAGTGGAGAAAGGCCTGGCAAGG + Intronic
1072186991 10:93049349-93049371 TAATGCTGCTGGGCCGGGCACGG - Intronic
1073008367 10:100341490-100341512 AAGGGGTGAAGGGCCAGGAATGG + Intergenic
1073113525 10:101077264-101077286 TACCAGAGATGGGCCAGGCACGG + Intergenic
1073587731 10:104726778-104726800 GAATGGAGATGGGGCAGGCAAGG - Intronic
1074051447 10:109884453-109884475 TAGTGGTGACCTGCCAGGCCTGG + Intronic
1074873275 10:117594698-117594720 TAGTGGGAGTGGGCCAGGGAGGG + Intergenic
1075105044 10:119533962-119533984 TACTTCAGATGGGCCAGGCATGG + Intronic
1075379770 10:122009635-122009657 TGGTTGTTATTGGCCAGGCACGG + Intronic
1075694990 10:124427467-124427489 AAGTGGAGAGAGGCCAGGCATGG - Intergenic
1075724123 10:124603047-124603069 TACTGGGGCTGGGCCAGGCCAGG + Intronic
1075856149 10:125631849-125631871 GAGTGGTCAGGGGCCATGCAGGG + Intronic
1076699768 10:132265357-132265379 TCGCTGTGATGGGCCAGGCCTGG - Intronic
1077421929 11:2455385-2455407 TGCTGCTGATTGGCCAGGCACGG - Intronic
1077489753 11:2855338-2855360 GAGTGTTGATGGGCCTGGCCTGG + Intergenic
1077616760 11:3681014-3681036 CATTTGTGATTGGCCAGGCATGG - Intronic
1078231623 11:9449190-9449212 TATAGATGCTGGGCCAGGCACGG + Intergenic
1079063167 11:17267312-17267334 AAGTGGGGCGGGGCCAGGCACGG - Intronic
1079911268 11:26313394-26313416 TACAGGTGATAGGCCAGGCATGG + Intronic
1081750663 11:45508547-45508569 GAGAGGTGATGTGCCAGGGAGGG + Intergenic
1082631398 11:55546234-55546256 TTGTAAAGATGGGCCAGGCATGG - Intergenic
1082801263 11:57416497-57416519 TGGAGGTGAGGGGCCAGGAAAGG + Intronic
1083188525 11:61032852-61032874 TGGTTACGATGGGCCAGGCATGG + Intergenic
1083319092 11:61834455-61834477 TAATGGGCATGCGCCAGGCAGGG - Intronic
1083400588 11:62420642-62420664 TAGGGATATTGGGCCAGGCACGG + Intronic
1083630422 11:64092361-64092383 AAGAGGTGCTGGGCCTGGCAGGG + Intronic
1083781265 11:64919048-64919070 AAGTGCTTATGGGCCAGGCACGG + Intronic
1084063336 11:66689592-66689614 CACTGGTCCTGGGCCAGGCATGG - Intronic
1084598228 11:70129909-70129931 AAGTGGTGTAGGGCCAGGCACGG - Intronic
1084753610 11:71220908-71220930 TCGTGAAGATGGGCCAGGCACGG + Intronic
1084855714 11:71984568-71984590 TAGTAGTTACTGGCCAGGCACGG - Intronic
1084984349 11:72854845-72854867 TACTAGAAATGGGCCAGGCACGG + Intronic
1085457754 11:76674738-76674760 TTGGGGGGATGGACCAGGCAGGG + Intergenic
1085580641 11:77647076-77647098 AAATAGTTATGGGCCAGGCATGG - Intergenic
1086451320 11:86919853-86919875 TAGGGTAGGTGGGCCAGGCAGGG - Intronic
1086578643 11:88370393-88370415 TAATGCGAATGGGCCAGGCATGG + Intergenic
1086583310 11:88424022-88424044 TTGTGGAGATGGGCAGGGCATGG + Intergenic
1086947736 11:92859908-92859930 TAATGGTAATGGGCCAGGTGTGG + Intronic
1087228007 11:95625866-95625888 CAGTGGTGAAGGCCAAGGCAGGG + Intergenic
1087241369 11:95784875-95784897 TACTGTCGATTGGCCAGGCATGG - Intronic
1087787038 11:102366657-102366679 TAGTGGTGGAGGGCCGGGCATGG - Intronic
1088222263 11:107581529-107581551 TAGTGATCATGGGCCAGGGCTGG - Intergenic
1088555375 11:111055440-111055462 TATTGGTGATGGCCTAGACACGG - Intergenic
1088844703 11:113655037-113655059 TGTTGTTTATGGGCCAGGCATGG - Intergenic
1089488178 11:118863323-118863345 AATTAGTGATGGGCCAGGCACGG - Intergenic
1089644864 11:119872309-119872331 TAGTTTTTATGGGCCAGCCAAGG + Intergenic
1089822584 11:121241630-121241652 GAGTGGAGAGAGGCCAGGCAGGG + Intergenic
1091276494 11:134356220-134356242 CACTGGTGATGGGCGTGGCAGGG + Intronic
1091816820 12:3444978-3445000 TAGGGGTGATGGGGAAGGGAGGG + Intronic
1092142671 12:6194644-6194666 AAGTGGAAACGGGCCAGGCACGG + Intergenic
1092236969 12:6816399-6816421 GAGAGGTGAGGGGCCAGGCCAGG + Exonic
1093059653 12:14589384-14589406 GAGTGGAGAGAGGCCAGGCAGGG + Intergenic
1093463250 12:19425398-19425420 TAGTGGAATTAGGCCAGGCACGG + Intronic
1094029880 12:25999455-25999477 TAGCACTGATGGGCCAGGCATGG + Intronic
1094108249 12:26835225-26835247 GAGTAGTGGTTGGCCAGGCACGG + Intergenic
1095908913 12:47405841-47405863 TTGGGGTGATGGGCCAGGCGCGG - Intergenic
1096038295 12:48492269-48492291 TGGAGGTGATGGGCCAGGTTTGG - Intronic
1096322878 12:50630959-50630981 AAGTGGTGGATGGCCAGGCACGG - Intronic
1096615308 12:52829552-52829574 TGCTTTTGATGGGCCAGGCACGG - Intronic
1098543674 12:71687286-71687308 TATTAGTAATGGGCCAGGCGCGG + Intronic
1098721485 12:73904276-73904298 AAGCTGTCATGGGCCAGGCATGG - Intergenic
1099598753 12:84703398-84703420 TAGTAATGATGGGCCAGGCATGG - Intergenic
1101149096 12:101868287-101868309 GAGAGGGGATTGGCCAGGCATGG + Intergenic
1101915020 12:108889398-108889420 TAATGATAATGGGCCAGGCGAGG - Intronic
1102448630 12:113023634-113023656 TAGGGGTTTTAGGCCAGGCACGG - Intergenic
1102641368 12:114369962-114369984 AAATGCAGATGGGCCAGGCACGG + Intronic
1102973036 12:117186165-117186187 TTTTGGTAATAGGCCAGGCACGG - Intronic
1103349706 12:120275621-120275643 TATTGGAGCTGGGCCAGGCGCGG - Intergenic
1103785725 12:123431531-123431553 TAGTTAAGATGGGCCGGGCACGG + Intronic
1105534196 13:21248644-21248666 TTGTGTACATGGGCCAGGCAGGG - Intergenic
1107080560 13:36370174-36370196 TACTGGTGCTGAGCCTGGCATGG + Intronic
1107502221 13:40991565-40991587 AGGTGGTAACGGGCCAGGCATGG - Intronic
1107591661 13:41913949-41913971 TTGTGGTCCTCGGCCAGGCATGG + Intronic
1107601665 13:42020467-42020489 AAGTGAGCATGGGCCAGGCACGG + Intergenic
1108203461 13:48064263-48064285 AAATGTTGATGGGCCAAGCATGG - Intronic
1108396325 13:49995391-49995413 TAGTGTTTTTAGGCCAGGCACGG - Intergenic
1109020911 13:57091887-57091909 TAATAGTTATGGACCAGGCATGG + Intergenic
1109110600 13:58314232-58314254 TGAAGATGATGGGCCAGGCATGG - Intergenic
1111016088 13:82384110-82384132 TAATGGTGTAGGGCCAGGCACGG + Intergenic
1111104966 13:83632930-83632952 TGGTGGGGATGGGGAAGGCAAGG - Intergenic
1112569804 13:100583683-100583705 TAGTGGTGGGGAGCCAGGTACGG - Intronic
1112587047 13:100728046-100728068 AAGTCAGGATGGGCCAGGCATGG - Intergenic
1113482949 13:110634959-110634981 TAGTGGGCTTGGGACAGGCAGGG + Intronic
1114206514 14:20576796-20576818 TAGCAGTTATTGGCCAGGCACGG + Intergenic
1115237504 14:31221962-31221984 TAGTTGGTGTGGGCCAGGCACGG + Intergenic
1115319247 14:32061272-32061294 TAGTCATGCTTGGCCAGGCAAGG + Intergenic
1115976682 14:39004464-39004486 TAGTGGAGAGGAGCCAGTCAGGG + Intergenic
1116019381 14:39442023-39442045 CAGTGGGGCTGGGCCAGCCACGG + Intergenic
1117163037 14:53007690-53007712 TAATGGTGATTGGCTGGGCATGG + Intergenic
1118023074 14:61739039-61739061 AAGGGGTAATGGGCCAGGCATGG - Intronic
1118294544 14:64557120-64557142 AAGTTATAATGGGCCAGGCATGG - Intronic
1118359826 14:65046264-65046286 TAGAAATGTTGGGCCAGGCACGG - Intronic
1118806960 14:69246203-69246225 TAGTGGGGATGGGGTAGGCTGGG + Intergenic
1118834998 14:69471399-69471421 AAGTGGGGATGAGCCAGGCGTGG - Intergenic
1118885743 14:69864531-69864553 TGGTGGAGATGGGCAAGGCCAGG + Intronic
1120177938 14:81314998-81315020 TGGAGGTGTTAGGCCAGGCATGG - Intronic
1121588950 14:95084772-95084794 TTCTGGAGATGGGCCAGGCGCGG + Intergenic
1122368653 14:101214713-101214735 ATGTGGAGATGGGCCGGGCACGG + Intergenic
1122661692 14:103300226-103300248 TTGTGGTTTTTGGCCAGGCACGG + Intergenic
1122684472 14:103494259-103494281 TAGCATTGATTGGCCAGGCATGG + Intronic
1122869440 14:104629611-104629633 TAGTGGTGGGGTGCTAGGCATGG + Intergenic
1123669904 15:22645658-22645680 TAATGGGGAGGGGCCGGGCACGG + Intergenic
1124052241 15:26208140-26208162 AAGTGAGGAGGGGCCAGGCATGG + Intergenic
1124203318 15:27696994-27697016 AAGTGCTGCTGGTCCAGGCATGG - Intergenic
1125103466 15:35942997-35943019 TAGTGGCGTTGGGGCAGGGAAGG + Intergenic
1125486538 15:40115167-40115189 TAGGGCTGACGGGCCGGGCATGG + Intergenic
1125830220 15:42710350-42710372 AAGTGCTCAAGGGCCAGGCACGG - Intronic
1126041324 15:44594058-44594080 TAGATATTATGGGCCAGGCACGG - Intronic
1126221899 15:46223716-46223738 CACTGGTTTTGGGCCAGGCAAGG + Intergenic
1126621083 15:50640574-50640596 AAGTAATAATGGGCCAGGCATGG - Intronic
1126623443 15:50663414-50663436 AAGTGTTTATGGGCCGGGCACGG - Intronic
1127294485 15:57597512-57597534 GGGTGGTGATGGGGCAGGGAGGG + Intronic
1127567964 15:60212105-60212127 TATTGATGATGGGCCAAGCATGG + Intergenic
1128003954 15:64220383-64220405 TAGAAGTTCTGGGCCAGGCATGG - Intronic
1128047196 15:64628913-64628935 TAGTGAGCAGGGGCCAGGCATGG - Intronic
1128475960 15:67997073-67997095 AAGTGGTTCTGGGCCGGGCACGG - Intergenic
1129008143 15:72391717-72391739 TAGTGGGGCTGGGCTGGGCACGG - Intergenic
1129473891 15:75770276-75770298 AAGTGGGAATGGGCCTGGCATGG - Intergenic
1129770475 15:78200520-78200542 CAGTGGTGATGGGCAAAGAATGG - Intronic
1129822750 15:78616030-78616052 TACAGGTGTTTGGCCAGGCATGG - Intronic
1129980671 15:79866658-79866680 TGCTAGTGATTGGCCAGGCACGG + Intronic
1130065513 15:80600447-80600469 GTGTGGGGTTGGGCCAGGCATGG + Intergenic
1130811608 15:87384790-87384812 TATTACTGATGGGCCGGGCACGG - Intergenic
1131240244 15:90734576-90734598 AAGTATTGATTGGCCAGGCATGG - Intronic
1131288855 15:91087197-91087219 GAGTGAAGGTGGGCCAGGCATGG - Intergenic
1131314030 15:91316862-91316884 TAATGGTAATAGGCCAGGCACGG + Intergenic
1131377467 15:91937427-91937449 AAGTGGGAGTGGGCCAGGCATGG + Intronic
1131453974 15:92569002-92569024 AAATAATGATGGGCCAGGCATGG + Intergenic
1133057230 16:3151531-3151553 TAGTGGTGATGAGCCGGGCGCGG + Intergenic
1133119931 16:3599874-3599896 ATTTGGTGATTGGCCAGGCACGG - Intronic
1133602114 16:7349854-7349876 AATAGGTTATGGGCCAGGCACGG + Intronic
1134131566 16:11653974-11653996 TTGCAGTAATGGGCCAGGCACGG - Intergenic
1134160212 16:11881939-11881961 TTATGGAGATGAGCCAGGCATGG - Intronic
1134534874 16:15018108-15018130 TCGTAGTTGTGGGCCAGGCATGG + Intronic
1135092655 16:19531675-19531697 TACTGAAGATGGGCCAGGCGCGG + Intronic
1135425610 16:22333128-22333150 AAGTGAGGGTGGGCCAGGCATGG - Intronic
1135514534 16:23119386-23119408 TAGTGGTAATTGGCCGGGCACGG - Intronic
1135640563 16:24116264-24116286 TAGCGCTTAGGGGCCAGGCACGG + Intronic
1136101280 16:27998145-27998167 AAGTGGGGAGGGGCCAGGCGTGG - Intronic
1136236317 16:28915824-28915846 AAGTTGTCCTGGGCCAGGCACGG - Intronic
1136509434 16:30727127-30727149 AAGTGATGATGTGCCAGGCATGG - Intronic
1136516531 16:30771981-30772003 CAGGGGTGAGGGGCCAGGCCAGG + Intronic
1138244152 16:55454085-55454107 TTGTGGCTATGGTCCAGGCAGGG - Intronic
1138349169 16:56337377-56337399 TGGGGCTGATGGGCCAGGAAGGG + Intronic
1138912770 16:61422214-61422236 TAGTGGTGCCAGGCCAGGCATGG - Intergenic
1139564584 16:67766055-67766077 TAGTGGTGGTGGCCTAGGCTGGG - Intronic
1139633709 16:68245542-68245564 CAGTGGTGCTGGGTGAGGCACGG + Exonic
1140139212 16:72238883-72238905 TAGTGGGTAGGGGCCAGGGATGG + Intergenic
1140483623 16:75277003-75277025 AAGTGGGGTTTGGCCAGGCACGG - Intergenic
1140504273 16:75460643-75460665 TGGTGGTGAGGGGCCTGGGAAGG - Intronic
1140574382 16:76148668-76148690 TAACAGTCATGGGCCAGGCATGG + Intergenic
1140680769 16:77382498-77382520 TGGTTGTTAGGGGCCAGGCACGG - Intronic
1141667633 16:85474167-85474189 GAGAGGTGCTGGGCCAGGCCAGG + Intergenic
1141846694 16:86614386-86614408 TAAAAGTGATGGTCCAGGCAGGG + Intergenic
1142402523 16:89867873-89867895 TAGTGGTGGTGGGCCAGATGTGG - Intronic
1143033483 17:3981285-3981307 CAGTGGAGATGGGGCAGGAATGG + Intergenic
1143556198 17:7662297-7662319 TACTGGATTTGGGCCAGGCATGG - Intronic
1143650174 17:8258548-8258570 AAGACGTGGTGGGCCAGGCAGGG + Intronic
1143823980 17:9589403-9589425 AAGTGGTAATGAGCCAGGGAAGG - Intronic
1144135594 17:12291938-12291960 TCGAGGTGATTGGCCTGGCATGG - Intergenic
1144248415 17:13391352-13391374 AATGGGTGATAGGCCAGGCACGG - Intergenic
1144524409 17:15978305-15978327 AAGTGCAGATGGGCCGGGCATGG + Intronic
1144552665 17:16254890-16254912 TAGTGTATATGGGCCAGGCATGG - Intronic
1145931970 17:28692335-28692357 AAGTGGGGAGGGGCCAGGCCGGG + Intronic
1145991424 17:29081441-29081463 TTCTGGTGAGGGGCCAGGCTTGG + Intronic
1146618674 17:34378210-34378232 TAGCAGATATGGGCCAGGCACGG - Intergenic
1147263394 17:39221780-39221802 TGAGGGTGATGGCCCAGGCAGGG - Intronic
1147425898 17:40345723-40345745 TAGCAGGGATGGGCCAGGCCCGG + Intronic
1147670244 17:42172882-42172904 TAGTGGAGTGGGGACAGGCAAGG + Intronic
1147732308 17:42611563-42611585 TAGAGTTAATGGGCCAGGCGTGG + Intronic
1147769496 17:42857614-42857636 TAGTGGGGAGGGGCCTGGCCTGG + Exonic
1147959910 17:44160910-44160932 TAGGGCTGGTGGGCCGGGCATGG + Intronic
1148185534 17:45640789-45640811 TAGTGGATATTGGCCAGACATGG + Intergenic
1149432576 17:56606017-56606039 TTGGGGTGATGGGGCAAGCAAGG - Intergenic
1149852672 17:60049418-60049440 ATATGGTCATGGGCCAGGCATGG - Intronic
1150012184 17:61515070-61515092 AAGTCTTCATGGGCCAGGCACGG + Intergenic
1150252816 17:63717901-63717923 TAGTGATCCTAGGCCAGGCATGG - Intronic
1150566710 17:66348230-66348252 TATTGATTCTGGGCCAGGCATGG - Intronic
1151140098 17:71983271-71983293 TAGAAATGATGGGCCGGGCACGG - Intergenic
1151373184 17:73663381-73663403 GAGAGGTGAAAGGCCAGGCATGG - Intergenic
1151529471 17:74695331-74695353 TAGTGGGGATGGACCATTCAGGG + Intronic
1151958605 17:77393137-77393159 GTGTGGGAATGGGCCAGGCAGGG + Intronic
1152310225 17:79545461-79545483 AAGTGGGGAGAGGCCAGGCAGGG - Intergenic
1152510417 17:80783129-80783151 CAGTGGAGAAGGGACAGGCAAGG + Intronic
1152567976 17:81108616-81108638 CAGGGGTGAAGGGCCAGGCTGGG - Intronic
1152597905 17:81246842-81246864 GAGTGGGGTGGGGCCAGGCAGGG - Intronic
1152623792 17:81379321-81379343 GAGTGGTGATCCACCAGGCAAGG + Intergenic
1153118822 18:1695017-1695039 TAGTGGAGAGGGGCTAGACAGGG - Intergenic
1153644264 18:7180533-7180555 TACCTGTGATGGGCCGGGCACGG + Intergenic
1154242589 18:12665983-12666005 TAATTGTGTTGGGCCGGGCACGG - Intronic
1154275753 18:12958374-12958396 TAGTTAAAATGGGCCAGGCATGG - Intronic
1156081707 18:33343526-33343548 TAATGGAGATGGGTGAGGCAGGG - Intronic
1156473303 18:37390788-37390810 TGGTGGTGATGGGGCGGGGAGGG + Intronic
1157986550 18:52445038-52445060 TAGTGGGGGTGGGACATGCAAGG + Intronic
1158166812 18:54549313-54549335 TAATTGTTATTGGCCAGGCACGG + Intergenic
1158312657 18:56174855-56174877 GAGTGGTGATTGGCCGGGCATGG - Intergenic
1158496339 18:57958454-57958476 AAGTGTTTATGGGCCAGGCACGG + Intergenic
1158726467 18:59977492-59977514 TTGTGATAAGGGGCCAGGCACGG - Intergenic
1158849564 18:61481839-61481861 AAGTAATGTTGGGCCAGGCATGG - Intronic
1158998863 18:62952133-62952155 AAGTGCTGGTGGGCTAGGCACGG + Intronic
1159044483 18:63356105-63356127 TAGTAGTAATCGGCCAGGCGCGG + Intronic
1159106622 18:64008537-64008559 TAAGAGTAATGGGCCAGGCATGG - Intergenic
1159825354 18:73202070-73202092 GAGTTTTGATGGGCCAAGCACGG - Intronic
1160363538 18:78304898-78304920 TAGGGGTGATTGGCCGGGCTTGG - Intergenic
1160769525 19:824047-824069 TGGTGGAGATGGGGCAGGCCTGG + Intergenic
1161442871 19:4302382-4302404 GGGGGGTGATGGGCCAGGAATGG - Exonic
1161457053 19:4374806-4374828 ATGTGGAGCTGGGCCAGGCAGGG - Intronic
1162180426 19:8865249-8865271 TAGTCATGGTGGGCCGGGCATGG + Intronic
1162276777 19:9662050-9662072 TAGAGGTAATAGGCCAGGCATGG - Intronic
1162281186 19:9699215-9699237 TAGAGGTAATGAGCCAGGCGCGG - Intronic
1162291653 19:9785453-9785475 TAGTGGTGAGGGGACAGACTGGG - Intronic
1162360003 19:10213650-10213672 TTGTTGAGATGGGCCGGGCACGG + Intronic
1162404422 19:10465005-10465027 AAGTGGGGAGGGGCCAGGCAGGG - Intronic
1162908000 19:13834718-13834740 TAGTGGAGAAAAGCCAGGCACGG + Intergenic
1163247837 19:16108292-16108314 TAATGGTATAGGGCCAGGCATGG + Intergenic
1163310844 19:16513672-16513694 AAGTGGTCTTGTGCCAGGCAGGG - Intronic
1163362809 19:16858569-16858591 TAAAGGTGAGGGGCCAGGCGTGG + Intronic
1163478705 19:17541972-17541994 CAATAGTGGTGGGCCAGGCATGG - Intronic
1163813117 19:19447129-19447151 AAGTGGTGATGAGGCAGGAAAGG + Intronic
1165250401 19:34528504-34528526 AAGTGGTGACAGGCCAGGCACGG + Intergenic
1165332355 19:35147701-35147723 AAGTAATAATGGGCCAGGCATGG + Intronic
1165478878 19:36049760-36049782 GAGTGGAAACGGGCCAGGCACGG + Intronic
1165765534 19:38348436-38348458 TTGTGGAAATTGGCCAGGCACGG - Intronic
1166086701 19:40480770-40480792 TGGTGGTGTTGGGCCAGGTGTGG + Intronic
1166387579 19:42390724-42390746 GAGGGGAGATGGGCCAGGCATGG + Intergenic
1166675266 19:44737094-44737116 AAGTGTTGCTGGGCCAGGCGCGG - Intergenic
1167030075 19:46952968-46952990 GAGTGATGTAGGGCCAGGCATGG - Intronic
1167088070 19:47324159-47324181 TGGAGGGCATGGGCCAGGCAGGG - Intergenic
1167373580 19:49099438-49099460 AAGTATTGTTGGGCCAGGCACGG + Intronic
1167934330 19:52894093-52894115 TAGTGAAGAGGGGTCAGGCAAGG + Intronic
1168167898 19:54565562-54565584 TAGTAATTATGGGCCAGGCACGG - Intergenic
925367274 2:3319393-3319415 GAGTGCTCATGTGCCAGGCACGG - Intronic
925456652 2:4022006-4022028 TATGGGTGAGGGGCCAGGGATGG + Intergenic
926758427 2:16254305-16254327 TAATGGTGATTAGCCAGGGAGGG - Intergenic
926773185 2:16396474-16396496 GAGTGGGGAAGGGCCAAGCATGG + Intergenic
927908246 2:26877254-26877276 AAGTGGCTATGGGCCAGGCGCGG - Intronic
928605504 2:32942019-32942041 TAGGGGTGGGGGGCCAGGCGCGG - Intergenic
929099839 2:38301258-38301280 AAGTTGAGATGAGCCAGGCACGG - Intronic
929450949 2:42036693-42036715 CAGAGGAGAGGGGCCAGGCACGG + Intergenic
930446672 2:51482191-51482213 TAGAAGAGATAGGCCAGGCATGG - Intergenic
931051371 2:58418628-58418650 TACTGCAGATAGGCCAGGCACGG - Intergenic
931367419 2:61630828-61630850 TCATGGTTATAGGCCAGGCACGG - Intergenic
931389972 2:61833132-61833154 GAAATGTGATGGGCCAGGCATGG + Intronic
931673896 2:64673909-64673931 AACTGGTGATTGGCCAGGCGTGG + Intronic
931717036 2:65037447-65037469 TTGTGGTGATGGGGGAGGGATGG - Intergenic
932010519 2:67973023-67973045 GAGCGATGATAGGCCAGGCATGG - Intergenic
932151034 2:69371909-69371931 GAAGGCTGATGGGCCAGGCACGG + Intronic
932915323 2:75852094-75852116 TAGTGGAAATGAGCCAGGGAGGG + Intergenic
932921465 2:75919807-75919829 TGTTGGTTATGGGCCAGGCCTGG - Intergenic
933152601 2:78933088-78933110 TAATATTAATGGGCCAGGCATGG - Intergenic
933757819 2:85653940-85653962 TATGGGTGATTGGCCGGGCACGG - Intergenic
933759558 2:85664418-85664440 GAGAGGTGATGGGACAGGGACGG - Intronic
934784003 2:96991467-96991489 TGGTATTGTTGGGCCAGGCACGG + Intronic
935957718 2:108394779-108394801 TAAAGGTTATGGGCCAGTCATGG - Intergenic
936598834 2:113875796-113875818 AAGGTGTTATGGGCCAGGCATGG - Intergenic
937185146 2:120033415-120033437 AAGTAATTATGGGCCAGGCATGG + Intronic
937185992 2:120043248-120043270 TAGCGGTTTTGGGCCATGCATGG + Intronic
937338432 2:121076052-121076074 TGGTTGTGATGGGGCAGGGAGGG - Intergenic
938307347 2:130264926-130264948 CAGTGGAGTTGGCCCAGGCAGGG + Intergenic
938333885 2:130471587-130471609 AAGTCATGAGGGGCCAGGCACGG + Intronic
938355933 2:130649080-130649102 AAGTCATGAGGGGCCAGGCACGG - Intronic
940290404 2:152072937-152072959 CAGAGGTAATTGGCCAGGCATGG - Intronic
940374712 2:152945116-152945138 TGGTGGTGATGGAGCTGGCAGGG + Intergenic
940780495 2:157928287-157928309 TGATGGTGATAGTCCAGGCATGG - Intronic
941255100 2:163219509-163219531 AAGAGTAGATGGGCCAGGCATGG + Intergenic
945129416 2:206552956-206552978 TAGTAATAATAGGCCAGGCATGG - Intronic
946061947 2:216950221-216950243 TAGTGGAGATGGGTCAGAGAGGG - Intergenic
946406633 2:219495472-219495494 GAGTGGGGATGGGGAAGGCATGG + Intronic
947828357 2:233121814-233121836 AAGTGTTTTTGGGCCAGGCACGG - Intronic
948070194 2:235114754-235114776 CAGTGGTGACAGGCCGGGCACGG + Intergenic
949010329 2:241674676-241674698 GACCCGTGATGGGCCAGGCATGG + Intergenic
1169078851 20:2782075-2782097 AAGTGGAGATGGGGGAGGCAGGG + Intergenic
1169466639 20:5847017-5847039 TGGTGATGATGGGCCGAGCAGGG - Intronic
1169496377 20:6119342-6119364 TAGTGGTGATGCACCAGACAGGG + Intronic
1171540187 20:25944535-25944557 TACTGGTGATGGGACATGTAGGG - Intergenic
1171966847 20:31536923-31536945 TAGAGGTCATGGGCCAGTGAGGG - Intronic
1172949369 20:38712813-38712835 TAGTCATCATAGGCCAGGCACGG - Intergenic
1173685953 20:44923762-44923784 TTCTGGTCATGGGCCAGCCAGGG + Intronic
1174043879 20:47719511-47719533 TAGAGATGATGTGGCAGGCATGG - Intronic
1174282871 20:49452175-49452197 TAGAGGAGGTGAGCCAGGCAAGG - Intronic
1174411601 20:50340214-50340236 AAGAGGAGATGGGCCAGGCGCGG - Intergenic
1174472576 20:50771547-50771569 GAGTGGTGATGGGGCAGCGATGG + Intergenic
1174476176 20:50797126-50797148 TAATATAGATGGGCCAGGCATGG - Intronic
1174482735 20:50842706-50842728 TGAGGGTGATTGGCCAGGCACGG - Intronic
1174540517 20:51285697-51285719 CAGTGGTGGAGGGCCAGGCTTGG + Intergenic
1175238545 20:57529195-57529217 GTGTGGTGACGGGCCAGCCATGG + Intergenic
1175280597 20:57801636-57801658 GGGTGCAGATGGGCCAGGCATGG - Intergenic
1175560009 20:59916647-59916669 TAGTGGAAAGGGGCCAGGCATGG + Intronic
1175746035 20:61457947-61457969 TAGTGGTGATGGTATAGTCATGG + Intronic
1175859926 20:62144359-62144381 TAGTGGTGAGGGGCCCGGGTCGG + Intronic
1175926016 20:62472034-62472056 AAGGGGTTAGGGGCCAGGCACGG - Intronic
1175947460 20:62565518-62565540 GAGGGGTGCTGGGCCTGGCAGGG + Intronic
1177024763 21:15908234-15908256 TAGTGATGCTGGGCCGGGCAAGG - Intergenic
1177235623 21:18386031-18386053 AAGTGTTTATTGGCCAGGCATGG - Intronic
1179938835 21:44625300-44625322 TACTGATGATGGGCCACGCACGG + Intronic
1180094057 21:45546502-45546524 TTCTGCTGCTGGGCCAGGCAGGG - Intergenic
1180715063 22:17866036-17866058 CAGAGGCGATGAGCCAGGCACGG + Intronic
1181627526 22:24131773-24131795 TGCAGGTGATGGACCAGGCACGG + Intronic
1181917016 22:26289607-26289629 CAGTGATGCTGGGCCAGGAATGG - Intronic
1182162557 22:28137722-28137744 TAGTCACTATGGGCCAGGCACGG + Intronic
1182421439 22:30250585-30250607 GGGTGGTGAGGGGCCAGGAAGGG - Intergenic
1182944087 22:34305769-34305791 TAGGAGTCAGGGGCCAGGCATGG + Intergenic
1183367647 22:37415670-37415692 TAATGATGGTGGGCCAGGCGCGG + Intronic
1183377477 22:37473591-37473613 TAGTGTTGATTGGCCAGGCCTGG - Intronic
1183572587 22:38665132-38665154 TAGTGCTGCTAGGCCAGGCATGG - Intronic
1183597589 22:38821974-38821996 AGGTGGGGCTGGGCCAGGCATGG + Exonic
1183931644 22:41238904-41238926 AAGTGGGGCTGAGCCAGGCAGGG + Intronic
1183970903 22:41476856-41476878 TAGGGAGAATGGGCCAGGCATGG + Intronic
1184103703 22:42355266-42355288 CAGTGGAGATGGGCCAGCCCTGG - Intergenic
1184158707 22:42685594-42685616 GAGTGGGGAGGGGCCAGGCTGGG - Intergenic
1184453301 22:44595421-44595443 TTTTGCTGATAGGCCAGGCAAGG + Intergenic
1184685993 22:46096619-46096641 GAGTGGTGCTGGGTCAGGGACGG - Intronic
1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG + Intronic
1185343539 22:50301820-50301842 CAGCGGTGATGGGCGAGGCGGGG - Intronic
949552719 3:5124394-5124416 TAGTGGTATTAGGCCAGGAACGG - Intronic
950214800 3:11151793-11151815 TTTTAGTGATGGGCCGGGCATGG - Intronic
950388877 3:12680805-12680827 AAATGGTGATGGGCCAGGTGCGG - Intergenic
951859925 3:27240942-27240964 TAGATGTGATAGGCCAGGCATGG - Intronic
951892886 3:27583524-27583546 GAGTACTGAGGGGCCAGGCATGG - Intergenic
953086519 3:39673644-39673666 TAGAGGATGTGGGCCAGGCATGG + Intergenic
953486414 3:43301473-43301495 CAGTGCTGACTGGCCAGGCACGG + Intronic
953946084 3:47148769-47148791 AAGTGGCCATAGGCCAGGCACGG + Intronic
954095136 3:48320257-48320279 TTCTGATGAAGGGCCAGGCATGG + Intronic
954544979 3:51425852-51425874 AAGTGATGATAGGCCAGGCGTGG - Intronic
955067732 3:55547213-55547235 CAGTGGTGGTGGGCCCGGCTGGG - Intronic
955290094 3:57684169-57684191 AAGAGTTTATGGGCCAGGCACGG + Intronic
955643020 3:61106947-61106969 ATGATGTGATGGGCCAGGCATGG - Intronic
955891399 3:63653868-63653890 TAGTGGTTAAAGGCCAGGCAGGG - Intronic
955958019 3:64310276-64310298 GAGTGAAAATGGGCCAGGCATGG - Intronic
956104815 3:65806769-65806791 TAGTGGACAGGGTCCAGGCATGG - Intronic
957483655 3:80830569-80830591 AAGTGTTCCTGGGCCAGGCACGG + Intergenic
960218445 3:115072712-115072734 TAGTGGAGAAGGGCCAGAGAGGG - Intronic
961036782 3:123648018-123648040 CCCTGGTGATGGCCCAGGCAGGG + Intronic
961335395 3:126174318-126174340 TAGTGGGTACTGGCCAGGCACGG - Intronic
961481465 3:127183497-127183519 CAGTGGTGAGGGGACAGCCAGGG - Intergenic
961637353 3:128341900-128341922 AAGGGGTGTGGGGCCAGGCAAGG - Intronic
962179141 3:133187457-133187479 AAGTGGTCTTGGGCCGGGCATGG + Intronic
962879698 3:139564617-139564639 TAGAAGTGATGGGCAAAGCAAGG + Intronic
963403987 3:144839495-144839517 TAGCAGTTTTGGGCCAGGCATGG - Intergenic
964501748 3:157355485-157355507 ACCTGGTGTTGGGCCAGGCAGGG - Intronic
964671800 3:159234511-159234533 TATTGGAGATGGGCCCGGCACGG + Intronic
965590489 3:170357164-170357186 CTGTGGTGATGGGCCAGACGCGG - Intergenic
965633747 3:170759839-170759861 TTGTGGTTGTGTGCCAGGCATGG + Intronic
965944209 3:174220004-174220026 TAGTGGGAAGGGACCAGGCAGGG + Intronic
966404135 3:179578027-179578049 TGGTAGTTCTGGGCCAGGCATGG + Intronic
966531683 3:180988711-180988733 TAGTGGAAATAGGCCAGGCGCGG + Intronic
967146579 3:186611806-186611828 GAGTGGTGATGGGGCAGAGAAGG - Intergenic
967857052 3:194125994-194126016 TAGGGGTGATGGTCCAGGGCAGG - Intergenic
967890609 3:194361767-194361789 TGGTGGTGATGGGCTGGGCAGGG - Intronic
967911713 3:194547855-194547877 CAGTGGCTAAGGGCCAGGCATGG - Intergenic
968008252 3:195257285-195257307 TAGTGGCGCAGGGCCTGGCATGG - Intronic
968012359 3:195292629-195292651 TGGTTAAGATGGGCCAGGCACGG + Intronic
968065217 3:195754605-195754627 TCCTGGTGCAGGGCCAGGCAGGG - Intronic
968137530 3:196229665-196229687 TAATAGAGATGGGCCAGGCGTGG - Intronic
968170465 3:196505555-196505577 TAATGCAGTTGGGCCAGGCACGG + Intergenic
969707220 4:8818613-8818635 CATTTGTGATGGGCCTGGCAGGG + Intergenic
970829200 4:20315991-20316013 TAGTGATAGTGAGCCAGGCAGGG + Intronic
971657073 4:29362368-29362390 TAATGCTATTGGGCCAGGCATGG + Intergenic
972391517 4:38618066-38618088 TGATGGTGATAGGCCAGGCATGG - Intergenic
972907832 4:43773137-43773159 AAGTGATGCTTGGCCAGGCACGG + Intergenic
973773364 4:54225972-54225994 AAATGGTGATGGGCGGGGCAAGG - Intronic
973879526 4:55255029-55255051 TGATGGTCATGGGCCAGGCCTGG - Intergenic
974194730 4:58558079-58558101 TAGAGGTAATGGGCCGGGCATGG - Intergenic
975108384 4:70595471-70595493 TAGAGGGAAAGGGCCAGGCATGG - Intronic
976147276 4:82054481-82054503 AAATTGGGATGGGCCAGGCATGG + Intergenic
976928248 4:90529518-90529540 TAGTGATTATAAGCCAGGCATGG - Intronic
977073802 4:92427970-92427992 TAATAGTTTTGGGCCAGGCACGG + Intronic
977788490 4:101069188-101069210 TAGTCATTATGAGCCAGGCATGG - Intronic
979438889 4:120727643-120727665 TACCAGTGAAGGGCCAGGCACGG + Intronic
980070540 4:128238783-128238805 TATTATTTATGGGCCAGGCATGG - Intergenic
980104493 4:128574869-128574891 TGGTGGTGGGGAGCCAGGCATGG - Intergenic
980779369 4:137477663-137477685 TAATGTTAATAGGCCAGGCACGG + Intergenic
980917931 4:139051668-139051690 AAGTGGAAATGGGCCGGGCATGG + Intronic
981656943 4:147122423-147122445 AACTACTGATGGGCCAGGCATGG + Intergenic
981945747 4:150341456-150341478 AGTTGGTGATAGGCCAGGCAAGG - Intronic
982199789 4:152949183-152949205 AAATGGTTATGGACCAGGCATGG + Intronic
982827460 4:160018971-160018993 AAGATGTGTTGGGCCAGGCACGG - Intergenic
983501454 4:168504303-168504325 CAGTTGTGGTTGGCCAGGCATGG + Intronic
984652170 4:182282024-182282046 AAATGACGATGGGCCAGGCATGG - Intronic
985252347 4:188036688-188036710 TAGTTGTTATCGGCCGGGCACGG + Intergenic
985784953 5:1888427-1888449 TAGTGGCGATGTGCGGGGCAGGG + Intergenic
985805479 5:2039710-2039732 TTGTGGGGATGGGCCAGGGAGGG - Intergenic
988012055 5:25501545-25501567 TATTTTGGATGGGCCAGGCACGG + Intergenic
988914742 5:35881053-35881075 GAGAGCTTATGGGCCAGGCACGG - Intergenic
989555494 5:42790178-42790200 TACAGATGAAGGGCCAGGCACGG + Intronic
990065715 5:51711858-51711880 TACTGGTAATAGGCCAGGCACGG - Intergenic
990123623 5:52486721-52486743 TAGTAATTCTGGGCCAGGCATGG - Intergenic
990738923 5:58892626-58892648 TACTTGTTTTGGGCCAGGCATGG - Intergenic
991638911 5:68734027-68734049 TTGTGGGGATGGGTCAGACATGG + Intergenic
991677048 5:69098120-69098142 GTGGGGGGATGGGCCAGGCATGG - Intronic
992404672 5:76445752-76445774 TGGTTGAAATGGGCCAGGCATGG - Intronic
992607035 5:78468379-78468401 TAATGGTTTTGGGCCAAGCAGGG + Intronic
993448101 5:88039688-88039710 AAGGGATGATGGGCCAGGCGCGG + Intergenic
994090713 5:95807542-95807564 TATTGGAAAAGGGCCAGGCATGG + Intronic
994316125 5:98335864-98335886 TAGTGGTAATGGGCCGGGTGCGG + Intergenic
994601358 5:101909870-101909892 TACTGGAGTTGGGCCAGGCGTGG + Intergenic
997174054 5:131755716-131755738 TAAGGAAGATGGGCCAGGCACGG + Intronic
997198103 5:131993061-131993083 TAGTGGAGAGGGGCCAGAGATGG - Intronic
997450014 5:133974974-133974996 CAGAGATGATTGGCCAGGCATGG + Intronic
997622557 5:135308181-135308203 CAGTGCTGACGGGACAGGCAGGG + Intronic
997717524 5:136053146-136053168 AAGAGATGGTGGGCCAGGCAGGG - Intronic
998408253 5:141887008-141887030 TATTGGTTTTGGGCCAGGCACGG + Intergenic
998445541 5:142195745-142195767 AAGGGGCAATGGGCCAGGCATGG + Intergenic
998516999 5:142765414-142765436 TAATGATGATGGGCCTGGCGCGG - Intergenic
998607035 5:143646065-143646087 TAGGGGAGATGGGGTAGGCAGGG + Intergenic
998844378 5:146292523-146292545 TTGTAGTTGTGGGCCAGGCACGG - Intronic
999153244 5:149440671-149440693 AAGTGGGTAGGGGCCAGGCAAGG + Intergenic
999158984 5:149479643-149479665 AGGTGGCCATGGGCCAGGCACGG + Intergenic
999167855 5:149566134-149566156 TAGAGTTTCTGGGCCAGGCACGG - Intronic
999746938 5:154599840-154599862 TACTTGAGGTGGGCCAGGCATGG - Intergenic
1001622056 5:173095477-173095499 TAGTAATTATAGGCCAGGCACGG - Intronic
1001951615 5:175820453-175820475 CAGGTGTGGTGGGCCAGGCATGG + Intronic
1002078578 5:176724257-176724279 AAAAGGTGATGGGCAAGGCAGGG - Intergenic
1002256154 5:177959676-177959698 CAGCGGTGATGGGGCAGCCATGG - Intergenic
1002347210 5:178556330-178556352 TAGTTGAAATGGGCCAGGCATGG + Intronic
1002472990 5:179448383-179448405 TAGTGGGGATGGCACTGGCAGGG - Intergenic
1002481234 5:179502271-179502293 TAGTGGGGATGGCACTGGCAGGG + Intergenic
1002565543 5:180111283-180111305 GAGTGGCAATGGGCCAGCCAGGG + Intronic
1002642668 5:180637818-180637840 GATGGGAGATGGGCCAGGCATGG - Intronic
1003032699 6:2616333-2616355 TGGGTATGATGGGCCAGGCATGG - Intergenic
1003126942 6:3363239-3363261 TGGTGAGGATGGGCCAGCCAGGG - Intronic
1003635153 6:7825428-7825450 TAGTGGTTTTAGGCCAGGCGTGG + Intronic
1003721618 6:8709659-8709681 AAATGGTCATGGGCCAGGCGTGG + Intergenic
1003786841 6:9496402-9496424 CAGTGCTCATGGGCCAGGCGAGG + Intergenic
1003900471 6:10650322-10650344 TAGTACTGATAGGCCAGGCGCGG - Intergenic
1004389845 6:15201003-15201025 GAGTATTGATGGGCCGGGCACGG + Intergenic
1004617851 6:17307450-17307472 AACTGGTGTTGGGCCGGGCATGG + Intergenic
1004993452 6:21164494-21164516 TAGTGGTAAAGGGCCAGCCCCGG - Intronic
1005227622 6:23660726-23660748 TGGTGGGGGTGGGCCAGGCAAGG - Intergenic
1005349757 6:24922567-24922589 ATGTGGTAAGGGGCCAGGCACGG + Intronic
1005422997 6:25672396-25672418 AAGTGGAGTTGGGCCAGGAATGG + Intronic
1005445298 6:25916369-25916391 TAATATTGCTGGGCCAGGCATGG - Intronic
1006007413 6:31013415-31013437 TGGGGGTGAGGGGCCAGGCCCGG - Intronic
1006709955 6:36059806-36059828 AAGTTGGGATCGGCCAGGCATGG - Intronic
1006767261 6:36518711-36518733 AAGAGGGGAGGGGCCAGGCATGG - Intronic
1006804390 6:36778765-36778787 TGGTGGTGACTTGCCAGGCAGGG - Intronic
1007328129 6:41079308-41079330 AAGTGGTCATGGGCTAGACATGG - Intronic
1007404773 6:41628456-41628478 CAATAGTCATGGGCCAGGCACGG - Intergenic
1007416918 6:41696400-41696422 AAGAAGTGGTGGGCCAGGCATGG + Intronic
1007430938 6:41776550-41776572 TAGTGCTTAGTGGCCAGGCACGG - Intronic
1007445022 6:41898437-41898459 GACTGGTAGTGGGCCAGGCACGG + Intergenic
1008332210 6:50259122-50259144 TAAAGTTGCTGGGCCAGGCATGG + Intergenic
1008585329 6:52943431-52943453 CAGTGTTCTTGGGCCAGGCATGG + Intergenic
1008744755 6:54656422-54656444 TATGCATGATGGGCCAGGCATGG - Intergenic
1009412387 6:63380904-63380926 TAAAAGTGATGGGCCAGGCGTGG + Intergenic
1009456109 6:63858348-63858370 TAGCTTTGATGGGCCAGGCATGG - Intronic
1010227476 6:73504599-73504621 TATTTGTGACAGGCCAGGCACGG + Intronic
1010376200 6:75173663-75173685 TAGTAGTGATCGGGCAGGCGTGG - Intronic
1011241078 6:85271951-85271973 AAGGGGTGAAGGGCCGGGCACGG - Intergenic
1012728331 6:102845793-102845815 TAGTTGAAAGGGGCCAGGCATGG + Intergenic
1012894368 6:104931955-104931977 TAATAATGTTGGGCCAGGCATGG - Intergenic
1012953946 6:105548446-105548468 AAGAGGTGAAGGGCCAGGCATGG - Intergenic
1013219512 6:108065526-108065548 AAGTGATAATAGGCCAGGCATGG - Intronic
1013513765 6:110867101-110867123 AAGTGTTGTTGGGCCAGGCCCGG - Intronic
1013553048 6:111228737-111228759 TAATAGTGCTGGGCCGGGCACGG + Intronic
1013618150 6:111864005-111864027 CAGTGGGTATGGGCCAGGCAGGG - Intronic
1014519190 6:122418760-122418782 AAAAGGTGATGGGCCAGGCGTGG - Intronic
1014600699 6:123408385-123408407 TAATTGTTTTGGGCCAGGCACGG + Intronic
1014952245 6:127569771-127569793 GAGAGGAGATGGGCCAGGCGCGG - Intronic
1015869611 6:137762570-137762592 AAAGTGTGATGGGCCAGGCATGG - Intergenic
1016688411 6:146907509-146907531 ATGTGTTGATTGGCCAGGCATGG - Intergenic
1016763153 6:147762487-147762509 AATTGGTTTTGGGCCAGGCACGG - Intergenic
1017025853 6:150179909-150179931 TAACTGAGATGGGCCAGGCACGG + Intronic
1017086235 6:150715772-150715794 TAAATGTGAGGGGCCAGGCATGG - Intronic
1017313901 6:153006139-153006161 AGGTGGTAATGGGCCAGGCACGG - Exonic
1017413580 6:154195435-154195457 TATTGTAGCTGGGCCAGGCACGG - Intronic
1017884159 6:158585251-158585273 TAGGTGTGATGTGCCTGGCATGG + Intronic
1019057729 6:169235310-169235332 TGGTGGTGTGGGGCCGGGCACGG - Intronic
1019083095 6:169449589-169449611 TGGTGGGGCTGGGGCAGGCAGGG - Intergenic
1019515519 7:1438261-1438283 TAGTGGTGGGGAGCCGGGCAGGG - Intronic
1019861101 7:3658906-3658928 TAGTGGTGATGGGCCAGGCATGG - Intronic
1020108666 7:5435418-5435440 GAGGTCTGATGGGCCAGGCATGG - Intronic
1020483373 7:8690467-8690489 TATTGGTGATTGACCAGGAATGG + Intronic
1020620923 7:10517798-10517820 TAGTGGTGGAGGGACAGGCATGG + Intergenic
1021785100 7:24143495-24143517 CTGTCGTGATGGGCAAGGCAAGG - Intergenic
1022349512 7:29554429-29554451 TAGAAGTGTTGGGCCAGGCCCGG + Intergenic
1024004315 7:45214196-45214218 TAGGGACTATGGGCCAGGCATGG - Intergenic
1024698005 7:51876092-51876114 GAGTGGTGACAGGCCAGGCATGG - Intergenic
1025229663 7:57193798-57193820 TAGTGGTGGGGGGTAAGGCAAGG - Intergenic
1025888257 7:65620027-65620049 ATGTGGTTTTGGGCCAGGCATGG - Intergenic
1026074951 7:67157574-67157596 TATTGGTCATAGGCCGGGCACGG - Intronic
1026099449 7:67372526-67372548 TAGTGGTGATGGACCGGGTGCGG - Intergenic
1026701904 7:72654588-72654610 TACTGGTTATAGGCCGGGCACGG + Intronic
1027183932 7:75958687-75958709 TAGTGTTAATAGGCCTGGCATGG + Intronic
1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG + Intergenic
1027262858 7:76477372-76477394 TAGGGGTGAGGGGCCAGGAGAGG + Intronic
1027314240 7:76975481-76975503 TAGGGGTGAGGGGCCAGGAGAGG + Intergenic
1027328457 7:77065978-77066000 TAGTGAAGATGGGCCAGGGGCGG - Intergenic
1027405214 7:77853682-77853704 TAGAGCTGAGTGGCCAGGCACGG - Intronic
1027631920 7:80617434-80617456 TTGCTGTGAAGGGCCAGGCACGG + Intronic
1028111694 7:86949651-86949673 GAGTGGGGAGAGGCCAGGCAGGG - Intronic
1028581267 7:92411891-92411913 TGGTTAAGATGGGCCAGGCACGG + Intergenic
1028729638 7:94131006-94131028 TACAGGGGCTGGGCCAGGCATGG + Intergenic
1029047978 7:97651688-97651710 TATTGGTGACAGGCCAGGCGCGG + Intergenic
1029220004 7:98981109-98981131 ATGTGCTGATTGGCCAGGCACGG + Intronic
1029294706 7:99530764-99530786 AAGAACTGATGGGCCAGGCACGG + Intronic
1029389877 7:100268005-100268027 TAGTGTTCACTGGCCAGGCATGG + Intronic
1029716871 7:102333521-102333543 TATTGTTTAGGGGCCAGGCATGG + Intergenic
1029746807 7:102520188-102520210 TAGTGAAGATGGGCCAGGGGCGG + Intergenic
1029764740 7:102619148-102619170 TAGTGAAGATGGGCCAGGGGCGG + Intronic
1030065884 7:105658822-105658844 TAGTAGTCATTGGCCAGGCATGG - Intronic
1030698680 7:112614987-112615009 TAATGGTGATTTGCCAGGCACGG - Intergenic
1031352446 7:120751689-120751711 TACAGATGATGGGCCAGACATGG + Intergenic
1031480371 7:122271164-122271186 AAATGTTGATAGGCCAGGCACGG + Intergenic
1033006976 7:137576326-137576348 TAATTTTGATGGGCCAGGCGCGG - Intronic
1033121867 7:138673811-138673833 TAGGGGAGAGGGACCAGGCAGGG + Intronic
1034675120 7:152887354-152887376 AAGAGCTGATGGGCCAGGCACGG - Intergenic
1034700890 7:153094815-153094837 TCCTGGTGAGGGGCCTGGCATGG + Intergenic
1034882908 7:154776013-154776035 CAGTGCTGGTGGGCCAGGCCAGG - Intronic
1035035798 7:155892985-155893007 TAGTGGTGATGGAGAGGGCAAGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036283602 8:7422992-7423014 AACTTCTGATGGGCCAGGCATGG + Intergenic
1036337866 8:7888529-7888551 AACTTCTGATGGGCCAGGCATGG - Intergenic
1037479002 8:19286970-19286992 AGGTGGCGCTGGGCCAGGCAAGG + Intergenic
1038902372 8:31858007-31858029 TACAAGTGAAGGGCCAGGCATGG + Intronic
1039914627 8:41850770-41850792 TAGTTATTGTGGGCCAGGCATGG - Intronic
1041252018 8:55943790-55943812 AAGTGGAGATAGGCCAGGCACGG + Intronic
1041266655 8:56072259-56072281 AAGTGAAAATGGGCCAGGCATGG + Intronic
1041319562 8:56599276-56599298 ACCTGGTGATGGGCCGGGCAGGG + Intergenic
1041534003 8:58905219-58905241 TAGATATGTTGGGCCAGGCACGG - Intronic
1041722047 8:60984616-60984638 TAGACTTTATGGGCCAGGCACGG - Intergenic
1041953055 8:63525776-63525798 TTGTGGTGGTGGGGTAGGCAGGG + Intergenic
1042139583 8:65664431-65664453 TAGTGGTGGTTAGACAGGCAAGG + Intronic
1042151015 8:65784051-65784073 AAGTAGTAATAGGCCAGGCATGG + Intronic
1042922856 8:73937107-73937129 TAGAGGTGAGTGGCCAGGCTGGG - Intergenic
1043110840 8:76178787-76178809 TTGTGGTATTCGGCCAGGCATGG - Intergenic
1043434985 8:80229388-80229410 TAGCTGGGGTGGGCCAGGCACGG + Intronic
1044195613 8:89373295-89373317 TAGATGCTATGGGCCAGGCACGG - Intergenic
1044968877 8:97600604-97600626 AAGTGTAGAGGGGCCAGGCACGG + Intergenic
1044994292 8:97823988-97824010 TAATGGGGCGGGGCCAGGCAAGG - Intronic
1045162922 8:99569110-99569132 TTGTGGTAATCGGCCAGGCGTGG - Intronic
1045273994 8:100685190-100685212 TAATGGGGATGGGCCAGGCGCGG + Intergenic
1045343456 8:101274102-101274124 CAGTGAAGATGGGCCGGGCATGG - Intergenic
1046312063 8:112450012-112450034 TAGGAATGATTGGCCAGGCACGG - Intronic
1046912242 8:119641035-119641057 TAGTGGCTGAGGGCCAGGCACGG - Intronic
1047511154 8:125516714-125516736 TCGTGGAGATGGGGCTGGCAGGG + Intergenic
1048629455 8:136226143-136226165 TAGTGAAGATGTTCCAGGCATGG - Intergenic
1048862469 8:138734043-138734065 TACTGGTCAAGGGCGAGGCAGGG - Intronic
1049388318 8:142355243-142355265 TAGTGGGGCTGGGTCAGGCCCGG + Intronic
1049437140 8:142591920-142591942 GAGTGGAGATGGGATAGGCATGG + Intergenic
1049473505 8:142786661-142786683 TGGTGGGCGTGGGCCAGGCAGGG - Intergenic
1049514543 8:143046712-143046734 GAGTAAGGATGGGCCAGGCATGG + Intronic
1049559304 8:143300501-143300523 AAATAATGATGGGCCAGGCATGG + Intergenic
1049655284 8:143794476-143794498 TGGTGGTGAGGGGCCAGGCAGGG - Intronic
1050307509 9:4320417-4320439 AAGTGGGGATGGGTCAGGAAGGG - Intronic
1050475004 9:6031973-6031995 TAGAGGATAAGGGCCAGGCATGG + Intergenic
1051805742 9:20990757-20990779 CAGTGGTGATGAGCAAGGGAAGG + Intronic
1052317505 9:27131189-27131211 AAGTTATGATAGGCCAGGCATGG + Intronic
1052488571 9:29133277-29133299 AAGTGGTGGTGGGACAGGGAGGG + Intergenic
1052491880 9:29179693-29179715 AAGTGCTCATGGGCCAGGCACGG - Intergenic
1052651575 9:31310187-31310209 GTGTGGAGATGGGCCAGGCATGG - Intergenic
1052903740 9:33817023-33817045 TAGTGGAGGAGAGCCAGGCACGG + Intergenic
1053138944 9:35670044-35670066 ATGTGGTGTTGGGCCAGGCATGG + Intronic
1055045452 9:71919304-71919326 GAGTGGTGAAGTGCCAGTCATGG + Intronic
1055541534 9:77311212-77311234 TAGTGAAAGTGGGCCAGGCATGG - Intronic
1055645345 9:78357335-78357357 GAGTGGGGAGGGGCCAGGCACGG - Intergenic
1056212807 9:84380951-84380973 TAGTGCTGGTAGGCCGGGCATGG - Intergenic
1056370643 9:85950844-85950866 AAATGATGATGGGCCGGGCACGG + Intronic
1057029121 9:91760242-91760264 TAGTGGGGAGGGGAAAGGCAAGG - Intronic
1058122430 9:101153871-101153893 AGGTATTGATGGGCCAGGCACGG - Intronic
1058451342 9:105099216-105099238 TTATGGTGATGGGCCAGGCGCGG - Intergenic
1058688519 9:107499716-107499738 TAGTCGGGATGGGCCGGGCGCGG - Intergenic
1058824577 9:108763561-108763583 GAGTAATGATAGGCCAGGCACGG + Intergenic
1058839846 9:108895482-108895504 TGGTGGTGAGGGGCAAGGGAAGG + Intronic
1059144387 9:111885220-111885242 TAGAATTGATGGGCCAGGCACGG - Intergenic
1059444241 9:114328328-114328350 GAGTCGTGATGGGCAGGGCAGGG + Intergenic
1059613234 9:115921782-115921804 GTGTGGAGATTGGCCAGGCATGG + Intergenic
1060155260 9:121315471-121315493 TACTGGTTCTGGGCCAGGCATGG + Intronic
1060626932 9:125122298-125122320 AACTGGTTGTGGGCCAGGCACGG + Intronic
1062273444 9:135720088-135720110 AACTGTGGATGGGCCAGGCAGGG + Intronic
1062352970 9:136148180-136148202 TTGCGGTGACAGGCCAGGCAGGG - Intergenic
1185510554 X:661028-661050 TGGTGGTGTTGGGACAGGCGTGG - Intergenic
1185548239 X:962992-963014 AAGATGTGATGGGCCAGGCATGG + Intergenic
1187144353 X:16624079-16624101 TTGAGGGGATGGGCCAGGCGCGG - Intronic
1187148180 X:16656702-16656724 AAGTGGAAATGGGCCGGGCATGG - Intronic
1187166853 X:16812297-16812319 TACAGGTCATTGGCCAGGCACGG - Intronic
1187193797 X:17061428-17061450 TACTGGCCATTGGCCAGGCATGG - Intronic
1187344968 X:18455020-18455042 TAGTGGCAATGAGCTAGGCATGG - Intronic
1187919412 X:24186321-24186343 AAATGATGATGGGCCAGGTAAGG + Intronic
1188462543 X:30445369-30445391 TAATAATAATGGGCCAGGCACGG + Intergenic
1189039177 X:37524354-37524376 TATTAGGGATAGGCCAGGCACGG - Intronic
1189119489 X:38379022-38379044 TAGGGCTGAAGGGTCAGGCAGGG + Intronic
1189706872 X:43767591-43767613 TGGTGGTGATGGGCTGTGCAGGG + Exonic
1189716894 X:43876248-43876270 GTGTGGTTATTGGCCAGGCATGG - Intronic
1190306578 X:49086441-49086463 AAGAGATGTTGGGCCAGGCACGG - Intronic
1190833719 X:54081479-54081501 TGGTGGTAATGGGCCAGGTGTGG + Intronic
1192529503 X:71872777-71872799 TAGTGGTCCTGGGCCAGGCCGGG - Intergenic
1192824142 X:74677442-74677464 TTTTGGTTTTGGGCCAGGCATGG + Intergenic
1194688058 X:96949551-96949573 AATTGAAGATGGGCCAGGCATGG + Intronic
1194823651 X:98534512-98534534 TAGTGGTAATAGGCTGGGCACGG + Intergenic
1195253086 X:103067138-103067160 CAATGGTGTTTGGCCAGGCACGG + Intergenic
1196065346 X:111458130-111458152 CAGAGGGGATGGGCCAGCCAGGG + Intergenic
1196092845 X:111764777-111764799 TGGTGGTGATCGGCCAGGCGCGG - Intergenic
1196223754 X:113141269-113141291 AAGAGATGAAGGGCCAGGCATGG - Intergenic
1196800184 X:119535883-119535905 TGGTTAAGATGGGCCAGGCACGG + Intergenic
1196917676 X:120555649-120555671 AAGTGGGGATAGGCCAGGCGCGG + Intronic
1197940253 X:131781686-131781708 ATCTTGTGATGGGCCAGGCACGG + Intergenic
1198064691 X:133084667-133084689 AAGAAGTTATGGGCCAGGCACGG - Intronic
1198744228 X:139873415-139873437 TGGTTAAGATGGGCCAGGCATGG + Intronic
1199374240 X:147088350-147088372 TGGTGGTGATGGGCGGGGTAGGG - Intergenic
1200241075 X:154494238-154494260 TACTGTTTCTGGGCCAGGCACGG - Intergenic