ID: 1019865232

View in Genome Browser
Species Human (GRCh38)
Location 7:3702503-3702525
Sequence TGAGAGTGGTGAATGCTATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019865232_1019865238 25 Left 1019865232 7:3702503-3702525 CCGGATAGCATTCACCACTCTCA 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019865232 Original CRISPR TGAGAGTGGTGAATGCTATC CGG (reversed) Intronic
903401911 1:23059689-23059711 TGAAAGTGATGAATGGTATGGGG + Intronic
904233766 1:29099902-29099924 AGACAGTGGTAAATGCTATAAGG + Intronic
905361490 1:37423751-37423773 TGAGACTTGTGAATATTATCTGG - Intergenic
909844137 1:80369244-80369266 TTAGAATGGTGAATCCTTTCCGG - Intergenic
910690837 1:89964145-89964167 GGAGAGTGCTGACTGCTAACAGG - Intergenic
912015377 1:105027645-105027667 AGATTGTGGTGAATGCTACCAGG - Intergenic
919947214 1:202328404-202328426 TGAGAGGGATGGATGCTCTCTGG + Intergenic
922938307 1:229437798-229437820 TGTGAGTTGAGAATGCTTTCTGG - Intergenic
923123424 1:231014915-231014937 GGACAGTGGTAAATGCTAACTGG - Intergenic
924906091 1:248453790-248453812 TCAGAGTGGTGACTGTGATCGGG + Intergenic
924921799 1:248638247-248638269 TCAGAGTGGTGACTGTGATCGGG - Intergenic
1063564656 10:7162314-7162336 TGAGTGGGGTGAATGCCAGCAGG + Exonic
1063947899 10:11195247-11195269 TGAGAGTGTTAACTGCTATTTGG + Intronic
1065133413 10:22644614-22644636 TTAGAGTGGTGGGTGCCATCTGG - Intronic
1066222407 10:33347953-33347975 TGAAAGTGGTGAATGGATTCAGG + Intergenic
1077242246 11:1516730-1516752 AGACAGTGGTGAAACCTATCAGG + Intergenic
1078831859 11:14985203-14985225 TCAGAGTGGGGAATGCTTTCTGG - Intronic
1086443940 11:86854572-86854594 TCAGAGTGGACAATGCTTTCTGG - Intronic
1088741468 11:112770794-112770816 TGGGAGAGGTGAATGCTAGAGGG - Intergenic
1094130509 12:27069637-27069659 TGATAGTGGTGAATGCTGTCTGG + Intergenic
1094155665 12:27334490-27334512 TGAAATTGGTGAGTGCTGTCTGG + Intronic
1094179914 12:27581310-27581332 TGATAGTGGTGAATGCTGTCTGG + Intronic
1095633458 12:44404275-44404297 TTAGTGTGGTGACTGCTATTTGG - Intergenic
1098796836 12:74899431-74899453 TGAGAGTGGCTATTGCTTTCTGG - Intergenic
1102912513 12:116728425-116728447 TGGGAATGGTGAATGGTACCAGG - Intronic
1104246336 12:127045645-127045667 TGAGAGTGATAGATGTTATCTGG + Intergenic
1106714702 13:32375467-32375489 TTAGAATGGTGAATCCTTTCTGG + Intronic
1116087011 14:40253652-40253674 AGATTGTGGTGAATGCTATTAGG + Intergenic
1120671560 14:87368240-87368262 TGAGAGTGGGTAATGGTTTCGGG + Intergenic
1122322667 14:100864834-100864856 AGAGAGCGCTGAATGCTATTTGG + Intergenic
1127013306 15:54654138-54654160 TGAGTCTGGATAATGCTATCTGG - Intergenic
1127196445 15:56591162-56591184 AGATTGTGGTGAATGCTGTCTGG - Intergenic
1131022574 15:89111722-89111744 TAAGACTGGTGAATGCTTTCTGG - Intronic
1143413728 17:6729371-6729393 TGCTTGTGGTGAATGCTACCAGG - Intergenic
1143476216 17:7205187-7205209 TGGGAGTGGTGAAAGACATCCGG + Intronic
1144922048 17:18772240-18772262 GGAGAGTGGTGAAAGTTACCAGG - Intronic
1147695221 17:42347228-42347250 TGAGAGTGGGTAATAATATCTGG - Intronic
1149906274 17:60529092-60529114 AGTGTGTGGTGAATGCTGTCTGG - Intergenic
1152886796 17:82856567-82856589 AGAGCTTGATGAATGCTATCAGG + Intronic
1155876334 18:31094123-31094145 GGAGAGTGCTGAAAACTATCAGG + Intronic
1157319844 18:46625619-46625641 TGAGGGTGATGAATGGTATAGGG - Intronic
1159681891 18:71364243-71364265 TGAAAATAGTGAATGCCATCAGG - Intergenic
1160314671 18:77830832-77830854 TGACAGTGCTGAATGTTTTCAGG + Intergenic
1161216950 19:3099358-3099380 TGAGAGCGGTGGATGCGATTAGG + Intronic
1162724920 19:12684372-12684394 CAATAGTGGTGAGTGCTATCAGG + Intergenic
1164543986 19:29144025-29144047 TGAGTGTGGTCAATGCTACCTGG - Intergenic
928458776 2:31450294-31450316 TGAGATTGGTGATTCCTCTCTGG - Intergenic
929105533 2:38361489-38361511 TGAAAGTGGTGTATGCTTTCTGG - Intronic
930778297 2:55196990-55197012 AGCTAGTGGTGAATGCTACCAGG - Intronic
940131744 2:150389539-150389561 TGGGAGTGGAGAATGATGTCAGG + Intergenic
941135510 2:161713013-161713035 TGAAAGTAGTGAATGCCATGAGG + Intronic
941427876 2:165371536-165371558 TGAGAGATGTGAATGCTAGCAGG + Intronic
943449206 2:188027210-188027232 TGGTAGTGGTGAATTCTCTCAGG + Intergenic
943748676 2:191488559-191488581 TGAGAGCGGTGTATTCTAGCGGG + Intergenic
946662899 2:222019984-222020006 TGAGCATGGTGACTGCAATCTGG - Intergenic
948617495 2:239210222-239210244 TGAGAGTGTAGAATTGTATCTGG + Intronic
1169866108 20:10201784-10201806 TGAGAGAGATGAATGATAGCAGG + Intergenic
1171508210 20:25657021-25657043 TGGTGGTGGTGAATTCTATCTGG + Intergenic
1173036399 20:39415277-39415299 TGAGAGTCTTGAATGCCACCAGG + Intergenic
1178150476 21:29788569-29788591 GGAGAGTGGGGAATGGTTTCAGG + Intronic
953330774 3:42051317-42051339 CTAGAATGGTGAAAGCTATCAGG - Intronic
958041362 3:88230524-88230546 TGAGAGTGGGGAATCCTGTCAGG - Intergenic
958064382 3:88524508-88524530 TGGTAGTGGTGAATTCTCTCAGG + Intergenic
959148890 3:102584423-102584445 TAAGAGTTGTGAATGTTCTCTGG - Intergenic
962150024 3:132882775-132882797 AGAGAGTGCTTAATGCTCTCAGG + Intergenic
962714098 3:138112531-138112553 TGAGAGTGTTGCATGTTACCTGG + Intronic
962825884 3:139100803-139100825 TTAGAGTGGAGAAGGCTATGGGG - Intronic
965096477 3:164234407-164234429 AGAGAGCTGTGAATGCTATGAGG - Intergenic
968631191 4:1652911-1652933 TGTGTGTGGTGAGTGCTGTCTGG - Intronic
970000332 4:11358425-11358447 TGAGAGTGGTAACTTCAATCAGG - Intergenic
976346937 4:84014665-84014687 TCAGTGTGGTGGATGCTAGCAGG - Intergenic
985200917 4:187484467-187484489 GGAGAGTGGACCATGCTATCAGG + Intergenic
987770595 5:22298632-22298654 TGAGAATAGTGAATGCTTACAGG - Intronic
989521514 5:42407317-42407339 TGAGAGTGGGGAATTTTACCAGG + Intergenic
992284990 5:75225952-75225974 AGCTTGTGGTGAATGCTATCAGG - Intronic
998540053 5:142972241-142972263 AGTGAGGGGTGACTGCTATCTGG + Intronic
999580651 5:153034933-153034955 GGAAAGTGGTGCATGCTCTCAGG - Intergenic
999874409 5:155786565-155786587 GGAAAGAGGTGCATGCTATCAGG + Intergenic
1001329071 5:170749485-170749507 TGTGAGTGGGGAATGAAATCTGG - Intergenic
1002772275 6:300264-300286 TGAGATTGGAGAATGCCTTCGGG + Intronic
1003138525 6:3452919-3452941 TGGGAGTGGTGGATGAAATCAGG - Intronic
1010773869 6:79863136-79863158 GGAGAGTGGAGGATGCTCTCTGG - Intergenic
1014687889 6:124526439-124526461 TGAAAATGGTGAATGCTTCCAGG + Intronic
1014775082 6:125499393-125499415 CTAGAATGGTGAATGCTTTCTGG + Intergenic
1016350326 6:143159820-143159842 TGGGTGTTGTGCATGCTATCTGG - Intronic
1019865232 7:3702503-3702525 TGAGAGTGGTGAATGCTATCCGG - Intronic
1022358595 7:29638898-29638920 TGAGAGTGATGAATCCAAGCAGG + Intergenic
1022692525 7:32670860-32670882 TGGGAGTGGTGAATGGGACCAGG + Intergenic
1023606343 7:41934675-41934697 TGACAGTGGTGAATGACATGAGG - Intergenic
1024059992 7:45690414-45690436 TGAAGGTGGTGAATCCTATCAGG - Intronic
1025176885 7:56806683-56806705 TGAGAGTGGTGACAGCTCTGGGG + Intergenic
1025694908 7:63769703-63769725 TGAGAGTGGTGACAGCTCTGGGG - Intergenic
1027733077 7:81900985-81901007 TGGTAGTGGTGAATTCTCTCAGG + Intergenic
1037498844 8:19466215-19466237 TGAGAGTGGTAAATACTGTCAGG + Intronic
1038873722 8:31524245-31524267 TATGTGTGGTGAATGCTATGAGG - Intergenic
1039351640 8:36770053-36770075 TCAGAGTGGTGGAGGCAATCAGG + Intergenic
1040511467 8:48100036-48100058 AGCTTGTGGTGAATGCTATCTGG + Intergenic
1040808570 8:51423692-51423714 TGAGAGTGGTAAATTCCATGTGG - Exonic
1041170240 8:55134227-55134249 TCAGAGTAGTGGATGCTATTTGG + Intronic
1043985673 8:86692921-86692943 TGGTAGTGGTGAATTCTCTCAGG + Intronic
1044698020 8:94942420-94942442 TGAGAGTGGTGGATGGAAGCAGG - Intronic
1046701688 8:117407909-117407931 TCCCAGTGGTGAATGATATCTGG + Intergenic
1051759043 9:20440118-20440140 TGAGATTATTAAATGCTATCTGG - Intronic
1053524188 9:38812121-38812143 TGAGTGTGATGAATGCGATGGGG - Intergenic
1054196421 9:62036531-62036553 TGAGTGTGATGAATGCGATGGGG - Intergenic
1054641985 9:67552156-67552178 TGAGTGTGATGAATGCGATGGGG + Intergenic
1056478944 9:86981469-86981491 GGAGAGTGGAGAATGCTGCCTGG - Intergenic
1056492788 9:87124351-87124373 TGAAATTGATGAATGCTATGGGG - Intergenic
1057778966 9:98034600-98034622 TGAGAGTTGTGAAAGCTTTGGGG + Intergenic
1058662007 9:107275138-107275160 AGAGAGTGGTGACTCATATCAGG - Intergenic
1061929097 9:133823097-133823119 TGGGAATCGTGAATGCTCTCGGG + Intronic
1186291735 X:8107748-8107770 AGACAGTGGTGAATGCTTCCAGG + Intergenic
1186874741 X:13805816-13805838 TAAGAGTGTTGAATGACATCAGG - Intronic
1187492249 X:19762904-19762926 TGCGAGTGGAGATTGGTATCTGG + Intronic
1188311838 X:28626746-28626768 TGACAGTGGTGCATGGTTTCAGG - Intronic
1194393168 X:93346436-93346458 AGCTAGTGGTGAATGCTGTCTGG + Intergenic
1195823360 X:108970705-108970727 AGATTGTGGTGAATGCTATCAGG - Intergenic
1196347788 X:114686082-114686104 TGAAAGTGGTGAATGCTAATAGG - Intronic
1196618463 X:117794721-117794743 AGAGAATGATGAATGCTATGTGG - Intergenic
1197025024 X:121738109-121738131 AGCTAGTGGTAAATGCTATCAGG - Intergenic
1199084368 X:143611664-143611686 TGAAAGAGGTGAATGCCATAGGG - Intergenic