ID: 1019865233

View in Genome Browser
Species Human (GRCh38)
Location 7:3702517-3702539
Sequence GAAGACTAAGCAGGTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019865233_1019865238 11 Left 1019865233 7:3702517-3702539 CCACTCTCACCTGCTTAGTCTTC 0: 1
1: 0
2: 6
3: 22
4: 341
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019865233 Original CRISPR GAAGACTAAGCAGGTGAGAG TGG (reversed) Intronic
901385927 1:8909184-8909206 AAAGAAAAAGCAGGAGAGAGCGG - Intergenic
901829786 1:11885463-11885485 CAAGCCTAAGCATGTGACAGTGG + Intergenic
902892386 1:19453642-19453664 GAAGACCTAGAAGGAGAGAGAGG - Intronic
903126304 1:21250558-21250580 CAAGACAAAGGAGGTGAGAGAGG + Intronic
903315720 1:22504129-22504151 GCAGACTAAGAAAGTGGGAGTGG + Intronic
903620247 1:24693004-24693026 AAAGACTGAGAAGGTGAGAAGGG - Intergenic
905554453 1:38871302-38871324 GAAGTCTAAGGAGGCCAGAGTGG - Intronic
905845187 1:41224100-41224122 GTAGACTGAGGAGGTGAAAGAGG - Intronic
906046375 1:42834224-42834246 GAAGCCTAGGCAGGAGAGAAAGG - Intronic
907164704 1:52399981-52400003 GAAAGCTAAGCAGGGAAGAGAGG - Intronic
907971784 1:59390097-59390119 AAAAAATAAGCTGGTGAGAGAGG - Intronic
909149493 1:71983609-71983631 GAAGACTTAGCAGTTGAAAAGGG - Intronic
909829892 1:80174690-80174712 TAAGACCAAGCAAGAGAGAGAGG + Intergenic
910860535 1:91739019-91739041 GAAGACCAAGGAGGTCAGTGTGG + Intronic
911035903 1:93547365-93547387 GAAGGCAAAACAGGTGGGAGAGG + Exonic
912794993 1:112687933-112687955 GAAGTGTAAGCAGATGTGAGAGG - Intronic
914086188 1:144456167-144456189 GAGGAGAAAGCAGGTGAAAGGGG + Intronic
914192082 1:145420118-145420140 GAGGAGAAAGCAGGTGAAAGGGG + Intergenic
914328532 1:146644648-146644670 GAATACTAAGTAGGTCACAGTGG - Intergenic
914362005 1:146943908-146943930 GAGGAGAAAGCAGGTGAAAGAGG - Intronic
914489620 1:148143047-148143069 GAGGAGAAAGCAGGTGAAAGAGG + Intronic
914589989 1:149098068-149098090 GAGGAGAAAGCAGGTGAAAGGGG + Intronic
916497637 1:165359584-165359606 GAAGACTGGGCAGGAGAGTGAGG - Intergenic
917223865 1:172761162-172761184 GATGAGTAACCTGGTGAGAGAGG + Intergenic
917286768 1:173429461-173429483 GAAGACAGAGAAGCTGAGAGGGG + Intergenic
917508553 1:175650744-175650766 GAGGAGTAATCAGGTGGGAGAGG - Intronic
917930844 1:179821523-179821545 TATCACTGAGCAGGTGAGAGGGG + Intergenic
920113656 1:203604234-203604256 GAAAAAGAAGCAGGAGAGAGAGG - Intergenic
920806758 1:209241869-209241891 GAAGAATAAGCAGGAAAGAAGGG + Intergenic
920898993 1:210087564-210087586 GAAGCCCAAGCAGGTAAGAAAGG - Intronic
921268414 1:213445540-213445562 GAAGTCTAAGCAGGAGGGAAGGG + Intergenic
922251139 1:223849623-223849645 AAAGAATAAGCAGGTGAGGGTGG - Intergenic
923986237 1:239386376-239386398 GAACACCAAGCAGGAGAGAGGGG - Intergenic
924418741 1:243887237-243887259 CAAGCCTAAGCAGATGAGTGCGG - Intergenic
924474060 1:244367891-244367913 GAGGAGGAAGCAGGGGAGAGAGG - Intronic
924652358 1:245940943-245940965 GCAGAATAACCAGTTGAGAGAGG + Intronic
924928074 1:248702913-248702935 GGAGAATAAGGAGGTGAGAAAGG - Intergenic
1062959650 10:1562834-1562856 GGAGACAATGCAGGTGACAGTGG + Intronic
1065165885 10:22976509-22976531 GAAGAACAATCAGGAGAGAGGGG - Intronic
1066558052 10:36637537-36637559 CAAGACTGAGCAGGAGGGAGAGG - Intergenic
1067367023 10:45641819-45641841 GAAGAAACTGCAGGTGAGAGAGG + Intronic
1067509712 10:46884829-46884851 GAAACCGAACCAGGTGAGAGAGG + Intergenic
1067652542 10:48167029-48167051 GAAACCGAACCAGGTGAGAGAGG - Intronic
1068512053 10:57978975-57978997 AGAGACTAAGGAGGGGAGAGGGG + Intergenic
1068594677 10:58889891-58889913 GAAAACTAAGCAAGTGCTAGAGG - Intergenic
1070652153 10:78245223-78245245 AAAGGCTAAGCAGGTCAAAGGGG - Intergenic
1070815356 10:79319391-79319413 GAAAACTAAACAGATGAAAGAGG - Intergenic
1071002570 10:80847078-80847100 GAAGACTGGGAGGGTGAGAGGGG + Intergenic
1073376562 10:103040395-103040417 GAAGCTTAAGAAGGGGAGAGTGG + Intronic
1075551820 10:123398300-123398322 GGAGACTTAGCAGGTGAGAGAGG - Intergenic
1077284526 11:1759780-1759802 GCAGGCTGAGCAGGTGGGAGTGG - Intronic
1077859977 11:6169417-6169439 GAAGACTAAGCAGATACGTGAGG - Exonic
1080097288 11:28424383-28424405 GAAAACTAAGTGGGAGAGAGGGG - Intergenic
1081573744 11:44306916-44306938 GGAGACTCAGCTGCTGAGAGAGG + Intronic
1083783518 11:64930677-64930699 AAAGACAAAGAAGGTGAGATAGG - Intronic
1083888541 11:65584522-65584544 GAACAACAAGCAGGTGAGATGGG + Exonic
1083969269 11:66063499-66063521 GAAGACAAACCAGATGAGACAGG + Exonic
1084964632 11:72738267-72738289 GCAGACTATGCAGGTGACGGAGG - Intronic
1086168450 11:83807894-83807916 GAAGATTAAGTAGGGGAGAAAGG - Intronic
1086271953 11:85078669-85078691 GAAGAAGAAACAGGAGAGAGAGG + Intronic
1086493900 11:87383341-87383363 GAAGCCTAAGTATATGAGAGAGG + Intergenic
1086562269 11:88181463-88181485 GGAGTCTAAGAAGGTCAGAGTGG - Intergenic
1088124927 11:106412936-106412958 AAAGATTAAACAGGAGAGAGAGG - Intergenic
1089389086 11:118087805-118087827 GAAGAAGAGGCAGGTGAGAAAGG + Intronic
1089407682 11:118212015-118212037 GTAGCAGAAGCAGGTGAGAGGGG - Intronic
1089426329 11:118378993-118379015 GAAAACTAAGCTGGTGAAAAGGG - Intronic
1090025927 11:123167777-123167799 GAAGTCACAGCAGGTGAGATTGG - Intronic
1090394444 11:126409399-126409421 GAAGATTAAGCAGGTGATGATGG + Exonic
1091310860 11:134574270-134574292 GCAGACAAAGCAGGAGAAAGAGG - Intergenic
1093094065 12:14952671-14952693 TAAGACTAATCAGATGAGACAGG + Intronic
1095049750 12:37545181-37545203 GAAGACTAGGCTGGTCACAGTGG - Intergenic
1095362189 12:41355823-41355845 AAACACTAACCAGGAGAGAGTGG + Intronic
1096221172 12:49828736-49828758 GAAAACTAAGTAGGTGCGCGCGG + Intronic
1096513666 12:52145178-52145200 GAAGGCTGAGGGGGTGAGAGAGG + Intergenic
1096880218 12:54661466-54661488 TAAGACTAAGCAGATTAAAGAGG - Intergenic
1097835428 12:64268220-64268242 TAAGAGTAAGCAAGAGAGAGAGG + Intronic
1098192286 12:67962335-67962357 GAAAACTAAGCAGGTGGGCTTGG - Intergenic
1098372026 12:69769442-69769464 GAAGTCCCAGTAGGTGAGAGAGG - Intronic
1098399038 12:70053583-70053605 GAATACTAAGAAAGAGAGAGAGG - Intergenic
1098908851 12:76188903-76188925 GAAGGGTAGGCAGGGGAGAGGGG - Intergenic
1101519307 12:105466801-105466823 GAAGACAAAGCAGTTGAGTTAGG - Intergenic
1102255395 12:111411928-111411950 GAAGCCTGAGCAGGTGAGGGGGG + Intronic
1103162766 12:118743922-118743944 GAAAATTAACCAGGTGAGGGAGG + Intergenic
1103233662 12:119353570-119353592 GAAGAAGAAGAAGGAGAGAGGGG - Intronic
1103499304 12:121388549-121388571 GATGACTAAGCAGGTGGTGGGGG + Intronic
1103690200 12:122766330-122766352 GAAGACTAAGGAGGAGTGATAGG - Intronic
1103935281 12:124472942-124472964 GAAGAAGAAGCAGGTGTGAATGG - Exonic
1105224870 13:18423092-18423114 AAAGACAAAGCAGGTGTTAGAGG - Intergenic
1105878408 13:24580914-24580936 GAAGCCTCAGTAAGTGAGAGAGG - Intergenic
1105921447 13:24968160-24968182 GAAGCCTCAGTATGTGAGAGAGG + Intergenic
1106107946 13:26750580-26750602 GAACAGTAAGCTGGTTAGAGTGG + Intergenic
1107076175 13:36323201-36323223 AAAGACTAGGGAGTTGAGAGGGG + Intronic
1107991659 13:45824084-45824106 GAAGATTAAACAGATGAGAATGG - Intronic
1108626681 13:52235995-52236017 GAAGCCTCAGTATGTGAGAGAGG + Intergenic
1108659389 13:52570490-52570512 GAAGCCTCAGTATGTGAGAGAGG - Intergenic
1108864847 13:54911194-54911216 GAAGACTCAGTAGCTGAAAGAGG + Intergenic
1110052638 13:70923802-70923824 GAAGACTTAGGAGCTGACAGGGG + Intergenic
1110402484 13:75109769-75109791 GTAGAATAAGCAGTTTAGAGAGG + Intergenic
1111522689 13:89426898-89426920 GCAGAATAAGCAGTTTAGAGAGG - Intergenic
1113658133 13:112083000-112083022 GAAGCCACAGCAGGTCAGAGGGG + Intergenic
1119031064 14:71193060-71193082 CAAGACTGGGCAGGTGCGAGTGG + Intergenic
1120324164 14:83004567-83004589 GAAGTGACAGCAGGTGAGAGAGG + Intergenic
1120370961 14:83634813-83634835 GAAGAGGAAGCAGGAGAGACAGG + Intergenic
1122288394 14:100666429-100666451 ACAGACAGAGCAGGTGAGAGAGG + Intergenic
1123392177 15:19888033-19888055 AAAGACAAAGCAGGTGTTAGAGG - Intergenic
1123672489 15:22673362-22673384 GAAGAGTAAGAGGGTGGGAGGGG - Intergenic
1124107551 15:26754218-26754240 GAAGAGTAAGAATGGGAGAGAGG + Intronic
1124324539 15:28746651-28746673 GAAGAGTAAGAGGGTGGGAGGGG - Intergenic
1124888286 15:33707901-33707923 GAAAAGTAAGCAGGTGAAATGGG - Intronic
1125596925 15:40893406-40893428 GTCGCCTAAGCAGGTGAGAGAGG + Intergenic
1125824708 15:42666512-42666534 GAAGACTAAGCTGGTTAGAATGG + Intronic
1127304058 15:57684662-57684684 GCAGAGTGAGCAGGTAAGAGAGG + Exonic
1127488548 15:59440885-59440907 GAAGAATAAGCAGGCAAGCGGGG - Intronic
1127629902 15:60818437-60818459 GAAGACAAAGAAGCTCAGAGAGG + Intronic
1127655110 15:61048396-61048418 CAAGACCATGGAGGTGAGAGAGG + Intronic
1128871252 15:71156943-71156965 GCAGAGTAAGCAGGGGAGGGGGG - Intronic
1129893735 15:79089269-79089291 GAAGATAAAGCAGATGATAGTGG - Intronic
1130318505 15:82818274-82818296 GAAGAGTAAGAGGGTGGGAGGGG - Intronic
1131098303 15:89669696-89669718 GAAGAGAAAACAGGTCAGAGAGG + Intronic
1132920629 16:2388834-2388856 GAAGAGAAAGCTGGTAAGAGAGG + Intergenic
1133101735 16:3484226-3484248 GAATAATAAGCAGGAAAGAGAGG + Intronic
1135518763 16:23157298-23157320 GAAGAACAAGCAGATCAGAGTGG + Intergenic
1139662071 16:68428027-68428049 GAAGTCTAAGAAGCTGACAGAGG - Intronic
1139786634 16:69398230-69398252 CAAGACTCAGAAGCTGAGAGGGG - Intronic
1140005032 16:71066294-71066316 GAATACTAAGTAGGTCACAGTGG + Intronic
1140318999 16:73929501-73929523 TATGGCTAAGCAGGAGAGAGAGG - Intergenic
1146453437 17:32992087-32992109 GAAGAGTGACCAGCTGAGAGAGG + Intronic
1146534727 17:33640118-33640140 GAAGGCTAAGGAGGTTGGAGGGG + Intronic
1146888173 17:36486262-36486284 CAAGAATAAGCAGATGAGATGGG + Intergenic
1147060062 17:37868851-37868873 GTTGACTAACCAGGTGGGAGGGG + Intergenic
1148409336 17:47451340-47451362 GTTGACTAACCAGGTGGGAGGGG + Intergenic
1148557639 17:48587997-48588019 GGAGAGAAAGCAGGTGGGAGAGG + Intronic
1148574813 17:48702558-48702580 GAAGAATAAGAAGGAGAAAGAGG - Intergenic
1148746290 17:49920142-49920164 GAAGCCTAGGCAGGGGTGAGAGG - Intergenic
1149140402 17:53426538-53426560 TAAGAGTAAGCAGATGAGAATGG + Intergenic
1149910033 17:60558663-60558685 CCAGACTAAGCAGTTGAGACAGG - Intergenic
1151516407 17:74599010-74599032 GAAGAGGGAGCAGGTGACAGAGG + Intergenic
1152743076 17:82026999-82027021 GAAGTCCAAGCAGGTGAGGATGG + Exonic
1154528491 18:15316430-15316452 AAAGACAAAGCAGGTGTTAGAGG + Intergenic
1156622265 18:38866690-38866712 TAAGAATAAGCAAGGGAGAGAGG - Intergenic
1157027108 18:43857961-43857983 AAAGAAAAAGCAAGTGAGAGAGG - Intergenic
1157070536 18:44402650-44402672 AAAGACAAAACAGGTGAGAATGG + Intergenic
1158474411 18:57767235-57767257 GCAGACTAAGCAGGTGGGGAAGG + Intronic
1160372967 18:78389979-78390001 GAAGAGCAGGCAGGTGAGACAGG - Intergenic
1165395426 19:35561111-35561133 GAAGACAGAGCAGGCGAGTGTGG - Intronic
1165929337 19:39346025-39346047 CCAGACTTAGCAGCTGAGAGGGG - Intronic
1166144410 19:40824246-40824268 CAAGACTAAGCAGGTGGAGGCGG + Intronic
1167564477 19:50247763-50247785 GAACATTAAGCAGGTCAGTGAGG + Intronic
1168501172 19:56894736-56894758 GAAGACTTGGCAGGCGAAAGTGG + Intergenic
925006400 2:446108-446130 GAAGACGAAGCAGGGAAGGGAGG + Intergenic
925280657 2:2682398-2682420 GGAAACTGAGCAGGTGTGAGAGG + Intergenic
925397712 2:3548101-3548123 TAAGACTAAGGAGGTGAAAAAGG - Intronic
926166145 2:10523014-10523036 GAGGAATAAGAAGGTGACAGTGG + Intergenic
928125841 2:28615199-28615221 GAAGAGAAAGAAGGTCAGAGTGG + Intronic
928177194 2:29042622-29042644 ACAGACTAAGCAGCTGAGACAGG - Intronic
928231349 2:29501172-29501194 GAAGACTTAGCAAGGGACAGAGG - Intronic
928605566 2:32942529-32942551 GGAGAGGAAGCAGGAGAGAGAGG - Intergenic
928688078 2:33770224-33770246 GAAGAGCAAGGAGGTGAGTGTGG + Intergenic
930104173 2:47627293-47627315 GAGGCCTGAACAGGTGAGAGGGG + Intergenic
930874657 2:56201353-56201375 GAAGACTAGGCATTTGAAAGTGG + Intronic
931258009 2:60590778-60590800 GATAACTGAGCAAGTGAGAGTGG - Intergenic
931295277 2:60917900-60917922 GAAGATTAATCTGGTGACAGTGG + Intronic
933875598 2:86618235-86618257 GCAGATTAAGGAGATGAGAGTGG - Intronic
933887931 2:86737747-86737769 AAAGGCTAAGCAGGTATGAGGGG - Intronic
933922247 2:87058958-87058980 AAAGGCTAAGCAGGTATGAGGGG + Intergenic
934758841 2:96842355-96842377 GAAGAAGAAGAAAGTGAGAGAGG - Exonic
934851896 2:97707044-97707066 GAAGAATAAGGTGGAGAGAGTGG + Intergenic
938053526 2:128196199-128196221 GAGGACTAAGTAGGGGCGAGGGG + Intergenic
938101883 2:128503185-128503207 GCAGACTGGACAGGTGAGAGTGG - Intergenic
938527598 2:132147893-132147915 AAAGACAAAGCAGGTGTTAGAGG + Exonic
938708122 2:133951633-133951655 GAAGGATAAGCAGATGAGAGAGG - Intergenic
938773351 2:134519932-134519954 GAAGACTGAGCAGATGAATGTGG + Intronic
941595662 2:167473779-167473801 GAAGAATAAACAGGAGAGAAAGG + Intergenic
941648840 2:168071001-168071023 GAAGACTGAGAAGGCCAGAGTGG - Intronic
942292529 2:174486863-174486885 GCAGACGAAGCAGGTGAGAGGGG - Exonic
942909578 2:181226983-181227005 GAAGGGTGAGAAGGTGAGAGTGG - Intergenic
943616679 2:190100887-190100909 GAAGCCCCAGTAGGTGAGAGAGG + Intronic
943633001 2:190275197-190275219 GAAGACTAGGAGGGAGAGAGAGG + Intronic
944429599 2:199618704-199618726 GAAGACTAAGGAGTTCAAAGTGG + Intergenic
945849501 2:214988562-214988584 GAAAACTAAGCATGTTAGAAAGG + Intronic
946309018 2:218872575-218872597 GCAGACTCAGGAGGTGGGAGTGG + Intronic
947913836 2:233819411-233819433 GAAGGCTATCCAGGTGACAGAGG - Exonic
947984566 2:234437454-234437476 GAAGAGAGAGCAGGGGAGAGTGG + Intergenic
1170555875 20:17514180-17514202 GAAGAAAAAGCAGCTCAGAGAGG + Intronic
1171544267 20:25988695-25988717 GAAGACTAGGCTGGTCACAGTGG - Intergenic
1172052986 20:32133471-32133493 GAAGATGGAGCAGGTGAGAAAGG - Intronic
1172286709 20:33745826-33745848 GAACTATAAGGAGGTGAGAGTGG + Intronic
1172626780 20:36351981-36352003 GAAGCCCAGGCAGGTGAGACAGG + Intronic
1174701834 20:52617072-52617094 GAAGGCCAAGGAGGGGAGAGAGG - Intergenic
1174836743 20:53863005-53863027 GAAAACTGAGAAGCTGAGAGGGG - Intergenic
1175449748 20:59053399-59053421 GAAGAACAAACAGGTGAGGGTGG + Intergenic
1176768920 21:13052110-13052132 AAAGACAAAGCAGGTGTTAGAGG - Intergenic
1178156558 21:29860441-29860463 GAGGACAGAGCTGGTGAGAGAGG - Intronic
1179509799 21:41865025-41865047 GAGGACTGAGCAGGGGAGTGGGG - Intronic
1180433475 22:15278268-15278290 AAAGACAAAGCAGGTGTTAGAGG - Intergenic
1180994289 22:19957475-19957497 GAATACTGACCAGGTGACAGAGG + Intronic
1183271727 22:36866494-36866516 GAAGACAAGGCAGGGGAGAGAGG - Intronic
1184438412 22:44494466-44494488 GAACACGGAGCAGATGAGAGAGG - Exonic
949654655 3:6203818-6203840 GAAAGCTAAGCAGGACAGAGAGG + Intergenic
949727243 3:7063386-7063408 GAAGACTAAGCAGGTGAAGCTGG + Intronic
950830933 3:15875553-15875575 GAAGACTTAGGATGAGAGAGAGG - Intergenic
951252519 3:20410422-20410444 GCAGGCTGAGCAGGTGAGGGGGG + Intergenic
951775867 3:26309694-26309716 CAGGACAAAGCAGGTGATAGAGG - Intergenic
952825068 3:37517843-37517865 GAACACTGAGCTGGTGAGAAGGG - Intronic
952965055 3:38616021-38616043 GAATACTGTGCAGGTTAGAGAGG + Intronic
954458900 3:50615086-50615108 GAAGGCTAGGCAGCTGAGGGTGG - Intronic
954616328 3:51970509-51970531 GGAAACTGAGCAGCTGAGAGAGG - Intronic
955089006 3:55730915-55730937 GAAGACTGAGCAGGCCAGAAGGG + Intronic
955155109 3:56408941-56408963 CAAGACAAAGCAGGTGTGACGGG + Intronic
955249582 3:57265743-57265765 GATGAGTAATCAGGTAAGAGAGG - Intronic
956159676 3:66335932-66335954 GATGAGTAGGCAGGTGAGAAAGG + Intronic
956226232 3:66962057-66962079 GAAGACCAAGCAGGGCAAAGAGG - Intergenic
956847897 3:73200597-73200619 GAAGACAATGCAGGGGAGGGAGG - Intergenic
957660048 3:83138467-83138489 GTAGAGTAAGTAGGTAAGAGGGG + Intergenic
960855513 3:122098439-122098461 GGAGAGTAAGCAGGGGAAAGAGG + Intronic
961660191 3:128464510-128464532 GAAAACGAATCAGGTGAGTGAGG + Intronic
962244437 3:133780107-133780129 GAATACTAGACAGTTGAGAGAGG - Intergenic
963488751 3:145971961-145971983 GAAAACCATGCTGGTGAGAGAGG + Intergenic
966211416 3:177457356-177457378 GAGGACAGAGCAGGTGATAGAGG - Intergenic
966287622 3:178316012-178316034 GCAGACTTAGAAGTTGAGAGTGG + Intergenic
968628726 4:1639300-1639322 GATGACTACGCAGGTGACTGTGG + Intronic
969057224 4:4409601-4409623 GAAGACGACGCAGGTGAGGAAGG - Exonic
969207896 4:5662062-5662084 GAAGAGGCAGCAGGGGAGAGAGG - Intronic
969547614 4:7841850-7841872 GAAGACAAAGCAGGGGAGGGGGG + Intronic
970227579 4:13875730-13875752 GAAGACTAAGCCAGATAGAGAGG - Intergenic
971220997 4:24705914-24705936 GCAGAGGAAGCAGGTGATAGTGG + Intergenic
973002008 4:44962490-44962512 GAAGCCTCAGTATGTGAGAGTGG - Intergenic
973246978 4:48019510-48019532 GAGGACTAAGCAACTCAGAGAGG - Intronic
975115031 4:70670797-70670819 GAAGACTAGGGAGGGAAGAGGGG + Intronic
976054941 4:81052784-81052806 TAAAACCAAGCAGGTCAGAGGGG - Intronic
976542460 4:86294229-86294251 GAAGAGTAGGGAAGTGAGAGAGG - Intronic
976545889 4:86335522-86335544 GAAGAAGAAGGGGGTGAGAGAGG - Intronic
976628356 4:87210791-87210813 CAAGAGTTAGCAGGAGAGAGGGG - Intronic
977881630 4:102211256-102211278 GGAGACTAAGCAGGAGAGACAGG + Intergenic
978194438 4:105954440-105954462 GAACAGGAAGAAGGTGAGAGTGG - Intronic
978779350 4:112533726-112533748 GAAGACTAGGTAGGTCAGAGAGG - Intergenic
979871551 4:125829199-125829221 GAAGATCAAGGAGTTGAGAGAGG + Intergenic
980271331 4:130587838-130587860 GTATACTAAACAGGTGGGAGGGG - Intergenic
981031159 4:140127154-140127176 GAAGAAGAGGCTGGTGAGAGAGG - Intronic
981413060 4:144455847-144455869 GAAAACTTTGCAGGTTAGAGGGG + Intergenic
982227024 4:153175592-153175614 GAAGAGTAAGGAGGTCAAAGTGG + Intronic
982766399 4:159353881-159353903 GAAGACTCAGAAGGTGACACAGG + Exonic
982812764 4:159846914-159846936 GAGGAATAAGCAGGTGAAAGTGG - Intergenic
982901223 4:161004623-161004645 GAGGACTGAGCAGGTCAGGGAGG + Intergenic
985191895 4:187383184-187383206 GAAGACCAACCAGGGGAGTGAGG + Intergenic
985314465 4:188640851-188640873 GAATGCTAACAAGGTGAGAGGGG - Intergenic
985392527 4:189504983-189505005 GAAAACTAGGCTGGGGAGAGGGG + Intergenic
986331265 5:6717544-6717566 GAAGAAAAAGCAGGTGAAAGAGG + Intronic
986591555 5:9375922-9375944 GAAGAGAAAGCAGATAAGAGGGG - Intronic
988403932 5:30799841-30799863 GAAGAGTGAGAAGGTGGGAGTGG - Intergenic
989168619 5:38453902-38453924 GGATCCTAAGCAGGTGGGAGAGG - Intronic
989437492 5:41432027-41432049 GAAGACCAAGCAGAGGTGAGAGG + Intronic
989439864 5:41457679-41457701 CAAAACAAAGCAGGTGAAAGGGG - Intronic
989623353 5:43406601-43406623 GATGAATAGGAAGGTGAGAGAGG - Intronic
990904127 5:60785145-60785167 GAAGACTTGGGAGGGGAGAGAGG - Intronic
990986357 5:61644246-61644268 GAAGACTGAGAAGGAGAGAAAGG + Intronic
991363132 5:65841787-65841809 GAAGCCTAAGCAGCTGGGACAGG - Intronic
992083711 5:73259345-73259367 GAAGACTGAGTAGGGGACAGAGG + Intergenic
992800687 5:80293136-80293158 GAAAACTAAGCAGAGGAAAGGGG + Intergenic
993186693 5:84630772-84630794 GAAGACACAGCAGTTGAAAGTGG - Intergenic
995484990 5:112631128-112631150 GAAGACTCAGCATGTGCGTGAGG + Intergenic
995580954 5:113601675-113601697 GAATAGTAAGCAGGTCAGTGTGG - Intergenic
995728054 5:115203048-115203070 GAAGACTAAGCAGGAGAGAAGGG + Intergenic
996779320 5:127168079-127168101 GAAGAGCAATCAAGTGAGAGTGG + Intergenic
997886120 5:137631284-137631306 GAAGACAAAGCAGGGGAGAAGGG + Intronic
998848980 5:146336954-146336976 AAAGAGAAAGCATGTGAGAGTGG - Intronic
999878376 5:155833977-155833999 CAAAACTAAGCAGGTGTGAAAGG - Intergenic
999885970 5:155923127-155923149 CAAGACTAAGCAGGTGCTACAGG + Intronic
1000018739 5:157300980-157301002 AAAGAAAAAGCAGGTGAGAGGGG - Intronic
1000882451 5:166713916-166713938 GAAGAGGAAGCAGGAAAGAGAGG + Intergenic
1001754932 5:174160967-174160989 GGAGAATAAGCAGGGAAGAGGGG + Intronic
1001774389 5:174317626-174317648 AAAGAGTAAGCAGGTGATAAAGG + Intergenic
1002672113 5:180875914-180875936 GAAGACTTTGCAGGTGAAAACGG + Intergenic
1003257556 6:4487695-4487717 CAAGACAGAGCAGGTGATAGGGG - Intergenic
1003619744 6:7688988-7689010 GAAGATTAAGGGGGTGAGGGAGG - Intergenic
1004528898 6:16435640-16435662 GATGACCAAGCAGGAGACAGGGG + Intronic
1004885868 6:20050924-20050946 GAGGACCAAGCAGATAAGAGAGG + Intergenic
1004916119 6:20333812-20333834 AAAGACTGAGCAGGTGAAAATGG - Intergenic
1005928788 6:30465547-30465569 GAAGACTTGGCAGATGGGAGAGG + Intergenic
1007359874 6:41347247-41347269 GAAGATGATGCAGGAGAGAGGGG - Intronic
1008708708 6:54196866-54196888 GAAAATAAAGCAGGTAAGAGAGG + Intronic
1009392251 6:63158068-63158090 GAAGAGTAAGCAAGTGAAGGGGG - Intergenic
1011081178 6:83491503-83491525 GAAGAGAAAACAGGGGAGAGGGG + Intergenic
1012534783 6:100282381-100282403 TAAGACTAGGCAGGCCAGAGAGG - Intergenic
1012538878 6:100336451-100336473 AAAGAGGAAACAGGTGAGAGGGG - Intergenic
1012936876 6:105377649-105377671 GAAGAGTAAGGAGGTGAGAGAGG - Intronic
1012937173 6:105380301-105380323 GAAGAGTAAGGAGGTGAGTGAGG + Intronic
1013426352 6:110016319-110016341 GAACTCAAAGCAGGTGAGAGTGG - Intergenic
1013438398 6:110137414-110137436 TAAGTCTAACCAAGTGAGAGAGG - Intronic
1015350440 6:132211122-132211144 GAAGCCCAAGTATGTGAGAGAGG - Intergenic
1015990858 6:138941325-138941347 GAAGATTCAGCAGGTAAGATTGG - Exonic
1017219737 6:151951985-151952007 GTAGACCAAGCTGGTGACAGTGG - Intronic
1018528926 6:164742429-164742451 GAGGAGTGAGAAGGTGAGAGGGG - Intergenic
1018528936 6:164742497-164742519 GAAGAGCAAGAAGGTGGGAGTGG - Intergenic
1018700651 6:166423454-166423476 GAGGACTGAGCAGGAGAGGGAGG + Intronic
1019840691 7:3440037-3440059 AATGAATATGCAGGTGAGAGGGG - Intronic
1019865233 7:3702517-3702539 GAAGACTAAGCAGGTGAGAGTGG - Intronic
1019974270 7:4568054-4568076 GAAGTCTCAGCAGGGGACAGTGG + Intergenic
1020721940 7:11756361-11756383 CAAGTCTAAGGTGGTGAGAGTGG + Intronic
1020745637 7:12075049-12075071 AAGGACAAAGCAGGTGATAGAGG - Intergenic
1020780305 7:12509613-12509635 GAAGAGTGAGTTGGTGAGAGGGG - Intergenic
1021646263 7:22792684-22792706 TAAGAAAAAGCAGGTGAGAGTGG + Intergenic
1021858556 7:24882256-24882278 GGAGACTCAGCAGGTGAGGGTGG - Intronic
1022237112 7:28472971-28472993 GAAGACTAAGCAGGGGAGGGTGG - Intronic
1022648338 7:32252135-32252157 TAAAAGTAAGCAGGTCAGAGAGG - Intronic
1022828671 7:34042957-34042979 GAAGACTTCACAGGTGAGAAGGG + Intronic
1023374445 7:39541976-39541998 GGAGACAAAGGAGGGGAGAGAGG - Intergenic
1023680735 7:42684754-42684776 GAGGACTAGGCAGGGGAGAGAGG + Intergenic
1023967041 7:44968111-44968133 AAAGAGAAAGCAGGTGTGAGGGG - Intronic
1024062920 7:45712556-45712578 GAAGCCCAAGCAGGGGAGGGAGG - Intronic
1024088468 7:45916538-45916560 TAAGAAAAAGCAGGTGAGTGAGG - Exonic
1025908684 7:65810096-65810118 GAAGACGGAGCAAGGGAGAGGGG + Intergenic
1026499266 7:70929146-70929168 GAAGACTGGGTAGGGGAGAGTGG - Intergenic
1028383270 7:90223262-90223284 CCAGACTAAGCAGCTGAGACAGG - Intronic
1028868235 7:95737513-95737535 GAAGCCTCAGTATGTGAGAGAGG + Intergenic
1029745235 7:102512694-102512716 GGAGACTGAGGGGGTGAGAGAGG + Intronic
1030798907 7:113825065-113825087 GAAGACGTAGCAGCTGTGAGGGG - Intergenic
1031449719 7:121900023-121900045 GAAGCCTGAGCAGATGTGAGAGG + Intronic
1031852387 7:126880929-126880951 AAAGACTAGGCTGGTGAGAAGGG - Intronic
1032431827 7:131868292-131868314 GAAGAAGGAGCAGGTGAAAGGGG + Intergenic
1033367449 7:140682480-140682502 GGAGGCTGAGGAGGTGAGAGGGG + Intronic
1034281682 7:149859129-149859151 AGGGACTAAGCAGGAGAGAGAGG - Intronic
1037037819 8:14189742-14189764 TAAGACAAAGCAGGTTAAAGTGG - Intronic
1037629528 8:20641280-20641302 GAAGTTTAACCAGGTGAGAAAGG - Intergenic
1038401322 8:27287013-27287035 GCAGAGTAAGCAGGGGAGACAGG - Exonic
1041771233 8:61474628-61474650 TAACACCAAGCAGGTGAGATTGG + Intronic
1044030924 8:87236214-87236236 GAAGAATAAGGGGGTAAGAGTGG - Intronic
1044592137 8:93923556-93923578 GAAGACTAAGCATTTTAGAGAGG - Exonic
1045297925 8:100888488-100888510 CAAGACCGAGCAGATGAGAGTGG - Intergenic
1045395755 8:101759335-101759357 GAAGACAAAGAAACTGAGAGAGG + Intronic
1046562582 8:115856648-115856670 GAAGACCAAGCAGATTAGAAGGG - Intergenic
1046729822 8:117712960-117712982 GAAGACTAATGAGGTAAGAAGGG - Intergenic
1047168771 8:122468982-122469004 GATGTCTAAGCACGTGAGATGGG - Intergenic
1048416421 8:134232235-134232257 GAAGACTAAAAAGTGGAGAGAGG + Intergenic
1049084232 8:140465124-140465146 GAAGAATGAACAGGTGAGATGGG - Intergenic
1049243491 8:141550271-141550293 GAAGACAAACCAGGTGAGCAGGG + Intergenic
1049551905 8:143263936-143263958 GAAGACCAGGCAGGGGAGTGTGG - Intronic
1049798511 8:144507200-144507222 GAAGGGTAGGCAGGTGGGAGCGG - Intergenic
1050845469 9:10211795-10211817 GAAGAGTAAGAAGAAGAGAGGGG + Intronic
1051398099 9:16648516-16648538 GAAGACTAAGGACCTGGGAGAGG + Intronic
1051705351 9:19873216-19873238 GAAGACGAAGGAAGGGAGAGAGG - Intergenic
1052486282 9:29104384-29104406 TAAGACAGAGCAGGAGAGAGAGG + Intergenic
1053010150 9:34628273-34628295 GAAGAGTGAGCAGATCAGAGAGG + Intergenic
1053338765 9:37303576-37303598 AAAGACTCAGCAGGCGGGAGGGG + Intronic
1055190139 9:73509285-73509307 CAAGACTAAGCACATGAAAGTGG + Intergenic
1055308315 9:74952684-74952706 GAGGACTGAGCGCGTGAGAGAGG + Exonic
1055598645 9:77892214-77892236 GAAGACAAAGCAGGGGAGAGAGG - Intronic
1056477988 9:86971330-86971352 GAAGAAAATGCAGGTGAGATCGG - Intergenic
1058866135 9:109164014-109164036 GAAGAAGAACCAGGAGAGAGGGG - Intronic
1060063532 9:120482731-120482753 GATGATTAAGTAGGTAAGAGGGG + Intronic
1060624639 9:125100403-125100425 GAAGAGTAAGCAGGCCAGATAGG + Intronic
1061570486 9:131475009-131475031 GAAGATTAAGCAGGAGCTAGGGG + Exonic
1061614516 9:131771096-131771118 GAAGACTTAGCTGGGGAAAGAGG + Intergenic
1062061954 9:134501722-134501744 GGAGACTCAGCAGGGGTGAGGGG - Intergenic
1062201151 9:135303458-135303480 GAAGAGTGAGGAGGTGGGAGGGG - Intergenic
1186653879 X:11592068-11592090 GGAGACTAAGTAGGTAAGAATGG + Intronic
1188602174 X:31981073-31981095 GAAGACTAATCAGGTTATACAGG + Intronic
1188919495 X:35955095-35955117 GAAGACGAAGGAGGAAAGAGTGG - Intronic
1189234073 X:39474328-39474350 GAAGAGGCAGCAGGTCAGAGTGG + Intergenic
1191664540 X:63686357-63686379 GAAGTGTGAGCAGGTGAGAAGGG + Intronic
1191866694 X:65709569-65709591 GATGAATAAGCATGTCAGAGAGG - Intronic
1192552984 X:72068807-72068829 GAAGGCAAAGCAGGAGAGGGAGG + Intergenic
1194342695 X:92723916-92723938 TAAGGCTAAGCATGTGGGAGGGG - Intergenic
1197799710 X:130336688-130336710 GCAGCCTCAGCAGCTGAGAGTGG + Intergenic
1197902644 X:131390757-131390779 GAAATCTAAGCAGGACAGAGAGG - Intronic
1198176613 X:134162577-134162599 GAAGAAAAAGCAGAAGAGAGAGG - Intergenic
1198417385 X:136434354-136434376 GAAGACTAAGGAGCTCAGTGTGG - Intergenic
1198662442 X:138984437-138984459 GAAGAATAAGGAGGAGAAAGAGG + Intronic
1199733435 X:150660813-150660835 GAAGAGGAAGCAAGAGAGAGGGG + Intronic
1200384922 X:155881014-155881036 TGAGACTAAGCAGGAGAGACGGG + Intergenic