ID: 1019865234

View in Genome Browser
Species Human (GRCh38)
Location 7:3702526-3702548
Sequence TTTGGGGCAGAAGACTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019865234_1019865238 2 Left 1019865234 7:3702526-3702548 CCTGCTTAGTCTTCTGCCCCAAA 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019865234 Original CRISPR TTTGGGGCAGAAGACTAAGC AGG (reversed) Intronic
902570410 1:17343411-17343433 TCAGGGGCAGAAGAGTAAGAGGG + Intronic
903024504 1:20417856-20417878 TTAATGGCAGAGGACTAAGCTGG + Intergenic
903999708 1:27332007-27332029 TTTGGGCCAGATGACAAACCTGG - Intronic
904089193 1:27932661-27932683 TTTGGGGAAGAAGACTTCTCAGG - Intergenic
904171631 1:28595374-28595396 TTTGGGGAAGAAAAGGAAGCAGG - Exonic
904718147 1:32484785-32484807 ATTGTGGCAGAAGACAAAGGGGG - Intronic
905265947 1:36754503-36754525 TTTTGTGCAGATGGCTAAGCTGG - Intergenic
906856228 1:49308090-49308112 CTTGTGGCAGAAGGCAAAGCAGG - Intronic
908844182 1:68307731-68307753 TTTGGGGCAGGTGACTCACCTGG - Intergenic
910830561 1:91456980-91457002 TCTGGGGAAGAAAACAAAGCAGG + Intergenic
916378967 1:164187739-164187761 ATTGGGACAGGAGACTAATCAGG + Intergenic
918822210 1:189269711-189269733 TTTTGGGCAGAAGACTGATTGGG + Intergenic
921190489 1:212703989-212704011 TTTATGGCAGAATACAAAGCAGG + Intergenic
922224544 1:223634009-223634031 TTTGAAGCAGAAGCCAAAGCAGG + Intronic
1069079207 10:64069946-64069968 TTTGGGGCAGAGGATACAGCTGG + Intergenic
1069559445 10:69419271-69419293 CTTGGGGCAGCAGACAAGGCAGG + Intergenic
1070678160 10:78429232-78429254 TGTGGGGCAGAAAACTAAAGAGG - Intergenic
1078825971 11:14930653-14930675 TCTGGGGGAGAAAATTAAGCAGG + Intronic
1083730499 11:64650045-64650067 TATGGGGCAGAGGACGTAGCAGG - Intronic
1084358071 11:68652539-68652561 CCTGGGGCAGAATACTGAGCTGG - Intergenic
1086980431 11:93191404-93191426 TATATGGCAGAAGATTAAGCTGG + Intronic
1087736634 11:101841515-101841537 TTTTGGGGAGAAGACCAAGTGGG - Intronic
1088822060 11:113464810-113464832 ATTGGGCCAGAAACCTAAGCTGG - Intronic
1089818432 11:121198531-121198553 ATTGTGGCAGAAGGCAAAGCAGG + Intergenic
1089909281 11:122079769-122079791 TTTGGGGTAGAATATTGAGCAGG - Intergenic
1090320152 11:125836088-125836110 TTTCGGGCATAAGAATAATCTGG - Intronic
1091139559 11:133223380-133223402 TTTGGGAGAAACGACTAAGCAGG + Intronic
1092845003 12:12576254-12576276 CCTGGGGCAGAAGATTCAGCCGG + Intergenic
1096923935 12:55120985-55121007 TGGGGGCCAGAAGACTTAGCCGG + Intergenic
1097338972 12:58416197-58416219 CTTGGGTCAGAAGACTCAGCAGG + Intergenic
1100026046 12:90129557-90129579 TTTGAGGAAGAAGTCAAAGCCGG + Intergenic
1101778511 12:107815216-107815238 CCTGGGGCAGAAGACTGAGGGGG + Intergenic
1110057846 13:70999368-70999390 TTTGGGGCAGAATAATAAAAAGG + Intergenic
1112006239 13:95256008-95256030 TTTAAGGAAGAAGACTAAGATGG - Intronic
1112342379 13:98563378-98563400 TTTCTTGCAGAAGACAAAGCAGG + Intronic
1113162596 13:107398950-107398972 TTTGGAGCAGAAAGCTATGCTGG + Intronic
1114265109 14:21069305-21069327 TCTGGCGCAGGAGACAAAGCAGG - Intronic
1114639774 14:24211722-24211744 TTTGGAGCAGAAGATTCAACAGG - Exonic
1115521365 14:34235848-34235870 TTTGGAGCTGAAGTATAAGCTGG - Intronic
1119152371 14:72373392-72373414 ATTGGGGCAGAACACTGAACTGG + Intronic
1119384381 14:74248164-74248186 TTTGGGTCAGAGGACTCTGCAGG + Intronic
1120935809 14:89893703-89893725 TTTGGGGAAGAAAAGGAAGCAGG - Intronic
1123739171 15:23218596-23218618 TCTGGGGCAGAAGGCAAAGTAGG + Intergenic
1124290389 15:28447552-28447574 TCTGGGGCAGAAGGCAAAGTAGG + Intergenic
1124292848 15:28469996-28470018 TCTGGGGCAGAAGGCAAAGTAGG - Intergenic
1125331788 15:38589694-38589716 TTTTGGTCAGAAGGCCAAGCTGG - Intergenic
1126232868 15:46347489-46347511 TTTGGGGAAGAAGACCAAACAGG + Intergenic
1127884515 15:63187938-63187960 ATTGTGGCAGAAGACTTAGTTGG - Intergenic
1130547597 15:84868288-84868310 TCTGGGGCTGAGGACTCAGCTGG - Exonic
1131917587 15:97287033-97287055 TTTGGGGAGGAAGACTAAAGAGG - Intergenic
1136708343 16:32210063-32210085 TCTGGGGCAGAAGGCAAAGTAGG - Intergenic
1136759560 16:32719346-32719368 TCTGGGGCAGAAGGCAAAGTAGG + Intergenic
1136808544 16:33151040-33151062 TCTGGGGCAGAAGGCAAAGTAGG - Intergenic
1138465071 16:57183855-57183877 TTTTGGGCACAAGATTAAGATGG - Intronic
1139291953 16:65867460-65867482 ATTGGGGAAGAAGATAAAGCAGG + Intergenic
1203061715 16_KI270728v1_random:979654-979676 TCTGGGGCAGAAGGCAAAGTAGG + Intergenic
1144233070 17:13228596-13228618 TTTGGGGCAGAAAACATGGCAGG + Intergenic
1144449289 17:15362271-15362293 TTTGGGGCATAAAACTCAGAAGG + Intergenic
1146434639 17:32833049-32833071 TTTGGGTTAGAAGTCCAAGCTGG - Intronic
1147394237 17:40129155-40129177 TCTGGAGCAAAAGAATAAGCTGG - Intronic
1148768888 17:50055880-50055902 TTTGGGGGAGAAGGCGGAGCTGG + Intergenic
1149688193 17:58550981-58551003 TTTGGTGGAGGAGACTAATCTGG - Intergenic
1151387145 17:73761930-73761952 TTTGGGGCAGGAGAATGAGAGGG + Intergenic
1152682793 17:81677891-81677913 TTTGCGGCAGAAAAGTAGGCAGG - Intergenic
1153180649 18:2429216-2429238 TGTGGGGCAGAAGATTGAGCTGG - Intergenic
1155497992 18:26461458-26461480 TCTGGGTCAGGAGGCTAAGCAGG - Intronic
1155676823 18:28440220-28440242 ATGGTGGCACAAGACTAAGCAGG + Intergenic
1156005105 18:32430907-32430929 TTTTGGCCAGAAGACTAGGAAGG + Intronic
1158305580 18:56101700-56101722 TGTGGCCCAGGAGACTAAGCAGG + Intergenic
1162381303 19:10333437-10333459 TCTGGGGCCGAAGTCGAAGCCGG - Exonic
1163009582 19:14416627-14416649 GTCAGGGCAGAAGACAAAGCTGG + Intronic
1164249272 19:23462884-23462906 TTTATGGCAGAAGAGGAAGCAGG + Intergenic
1166993074 19:46704828-46704850 CTTGGGGCAGAACTCTAAGGAGG - Intronic
1167776508 19:51561172-51561194 ATTGGAGCAGAAGACCATGCTGG + Intergenic
927441872 2:23124573-23124595 TTTGGGGAGGAGGACTAGGCAGG + Intergenic
927628457 2:24749121-24749143 TTTGGGCCAGTAGAGTAAGAGGG + Intronic
928363789 2:30686349-30686371 TTTGGGGCAGAAGGTTAAGGAGG - Intergenic
932454878 2:71843270-71843292 CCTGGGGCAGAAGACGAAGTTGG - Intergenic
932462200 2:71889697-71889719 TTTGAGGTAGAAGGCTAACCCGG - Intergenic
933475473 2:82784486-82784508 ATTATGGCAGAAGACAAAGCGGG + Intergenic
934765579 2:96878356-96878378 CTTGGGGGAGAAGACACAGCTGG + Intronic
938263965 2:129913234-129913256 TTTGGGGCCGTAGCCTCAGCTGG - Intergenic
938860034 2:135358804-135358826 ATTGGGGCAGAAGGGTAAGAGGG - Intronic
939482734 2:142770065-142770087 TTTATGGCAGAAGGCTAAGAGGG - Intergenic
940908687 2:159191321-159191343 TCTGGTGCAGTGGACTAAGCAGG + Intronic
943099523 2:183471393-183471415 AGTGGGGTAGAACACTAAGCAGG - Intergenic
943536242 2:189154405-189154427 TTTGTGGAAGAAGAAGAAGCAGG - Intronic
943804400 2:192104474-192104496 TATGAGTTAGAAGACTAAGCTGG - Intronic
943815754 2:192252068-192252090 TTTTGAGCAGAAGAATGAGCTGG - Intergenic
944325819 2:198402365-198402387 TTTGTGGCAGAATATTAATCAGG - Intronic
944371429 2:198987872-198987894 TTGGGGTCAGAAGACTAAGATGG - Intergenic
944675902 2:202034093-202034115 TTTGGGGCTGAAGAAGGAGCGGG + Intergenic
945108998 2:206344813-206344835 ATTGTGGCAGAAGGCTAAGCAGG - Intergenic
947868090 2:233415362-233415384 TTTGAGGGAGATGACTCAGCTGG - Intronic
1169300975 20:4441661-4441683 TTGGGGCCAGGAGACAAAGCTGG + Intergenic
1169652703 20:7887397-7887419 TATGAGGCTGAAGACTAAACAGG + Intronic
1170630413 20:18059826-18059848 TTTGGGGATGAAGACTTAACAGG + Intergenic
1170770657 20:19329695-19329717 TCTGGGGCAGAAGATTCAGAAGG - Intronic
1172917094 20:38451221-38451243 TTTGGGAGAGAAGACTATGACGG + Intergenic
1173040070 20:39453916-39453938 ACTGGGGCAGAAGAGTATGCAGG - Intergenic
1174720580 20:52807713-52807735 TTTGGGGGAGAAGACTGAAGAGG - Intergenic
1175501364 20:59453267-59453289 TTTAGGGCAGCAAACTAAGGTGG - Intergenic
1175619364 20:60430590-60430612 TTTGGAGCAGAGGAGGAAGCTGG - Intergenic
1177206205 21:18014719-18014741 TTCATGGCAGAAGACAAAGCAGG - Intronic
1177998868 21:28135446-28135468 TGAGGGCCAGAAGACTCAGCAGG - Intergenic
1178587502 21:33882403-33882425 TTTGGGGCTGAAGACTTTGTCGG - Exonic
1178708945 21:34897342-34897364 TATGGTGCAGGAGACTAATCTGG - Intronic
1180566278 22:16668751-16668773 TTTGGGGGAGAAGGTTAAGTTGG - Intergenic
1181379508 22:22489780-22489802 TTTGGAGTTGAAGAGTAAGCTGG + Intronic
1181400023 22:22645652-22645674 CTTAGGGCAGAAGAATGAGCAGG - Intronic
1183312166 22:37116202-37116224 TTTGGGGGAGGAGAGTAAGATGG - Intergenic
1184311747 22:43650043-43650065 TGTGGGGCAGAAGACTAAGTAGG + Intronic
1184402521 22:44282212-44282234 GCTGGGGCAGAGGAGTAAGCTGG - Intronic
949460734 3:4290566-4290588 TTTGGGGCAGAAGACCTGGAGGG - Intronic
957886187 3:86290475-86290497 TTTGTGGCAGAAGGCAAAGGGGG - Intergenic
958048188 3:88311851-88311873 GCTGGGGCACAAGACTAAGCTGG + Intergenic
958829378 3:99068707-99068729 TGTAGCCCAGAAGACTAAGCCGG - Intergenic
959448548 3:106469815-106469837 TTCGTGGCAGAAGGCAAAGCAGG - Intergenic
960694127 3:120379234-120379256 TTTGTGGCAGAAGGCAAAGGGGG + Intergenic
960706915 3:120490857-120490879 CTTGGGGCAGAGGAGTAGGCAGG - Intergenic
961014654 3:123458303-123458325 TTTGAAGCAGAAAACTATGCTGG + Intergenic
963101321 3:141608100-141608122 ATGGGAGCAGAAGACAAAGCTGG - Intronic
963369137 3:144375721-144375743 ATTGGGGCAGAAGACGTAGCAGG - Intergenic
963693897 3:148540579-148540601 TTTGGGGCAGAAAATGGAGCTGG + Intergenic
964159679 3:153631998-153632020 TTCTGGGCAGAAGAATCAGCAGG + Intergenic
965008568 3:163057028-163057050 TTTGGGGCAGAGGTCTAACAAGG + Intergenic
965765567 3:172126729-172126751 TGTGGGTCAGAAAACTGAGCCGG + Intronic
967153250 3:186668710-186668732 TTATGGGCAGAAGACAAATCAGG + Intronic
967456644 3:189694586-189694608 TTTGGGGAGGAAGACCATGCAGG + Intronic
967817856 3:193814491-193814513 TGGGGGGCTAAAGACTAAGCAGG - Intergenic
971261325 4:25059471-25059493 ATTGGGCCACAAGAATAAGCAGG - Intergenic
971730590 4:30374488-30374510 TATTTGGCAGAAGACCAAGCAGG - Intergenic
972262239 4:37420923-37420945 TGTGGGCCAAAAGATTAAGCTGG - Intronic
972649776 4:41005425-41005447 TTTGGTGAAGAAAACTAATCTGG + Intronic
977499627 4:97822663-97822685 CTTATGGCAGAAGACAAAGCAGG + Intronic
983974927 4:173922264-173922286 TTTGAGGCATATGACTAAGCAGG + Intergenic
984520789 4:180798323-180798345 TTCTGGGCAGCAGAATAAGCCGG + Intergenic
985424274 4:189813087-189813109 TTGGGAGCAGAAAACTTAGCAGG - Intergenic
986173772 5:5334626-5334648 TTGGAGGCTGAAGACTAAGCAGG - Intergenic
993384375 5:87246843-87246865 TTTTGGGCAGAATTCTAAGATGG + Intergenic
994128505 5:96197281-96197303 CTTGGGACAGAAAATTAAGCAGG - Intergenic
994661207 5:102656603-102656625 TTTGGGGCTGTAGTCTTAGCTGG - Intergenic
994857539 5:105143420-105143442 TTTTGGGCAGAAGAAAATGCAGG - Intergenic
995993253 5:118268343-118268365 TTTGTGGTAGAAACCTAAGCAGG - Intergenic
996811873 5:127524758-127524780 TTTGGGGCAGAAGTTGAAGGTGG - Exonic
997584854 5:135038170-135038192 TGTGGGGAAGAAGACTAGGAAGG + Intronic
999674342 5:153983823-153983845 TATGGGGAAGAAGACAAACCTGG - Intergenic
1000795637 5:165661077-165661099 TTTGGGAGAGAGGTCTAAGCTGG + Intergenic
1003599116 6:7501627-7501649 TTTGGGGCAGGAGAAGAAGGAGG + Intergenic
1003717965 6:8667842-8667864 TATGGGGCAGAGAACTAGGCAGG + Intergenic
1003996371 6:11544995-11545017 TTTGGGTCAGAACACTAAGATGG - Intronic
1014465943 6:121756990-121757012 TTTAAGGCAGAAGACTAAGCCGG + Intergenic
1015187319 6:130432943-130432965 CTTGAGGCAGAAGACCTAGCAGG - Intronic
1016523130 6:144969091-144969113 TTTGGGGCAGAGTAGTGAGCAGG + Intergenic
1017550679 6:155503886-155503908 AGTGAGGCAGAAGACTAAGAGGG - Intergenic
1018700648 6:166423445-166423467 TTGGGGGCTGAGGACTGAGCAGG + Intronic
1019865234 7:3702526-3702548 TTTGGGGCAGAAGACTAAGCAGG - Intronic
1020800632 7:12728104-12728126 TTTGGGCCAAAACACTATGCTGG - Intergenic
1020985024 7:15122440-15122462 TTTGGGAGAGAAGTCTGAGCTGG - Intergenic
1022231501 7:28418040-28418062 TCTGGGGCAAAAGAGTAAGCTGG - Intronic
1027775191 7:82456176-82456198 TTTTGGGCAGAAAAGTAATCTGG + Intergenic
1028056464 7:86251569-86251591 TTTGGGAGAGAAGACCAAGCTGG + Intergenic
1029735935 7:102465788-102465810 TTGGGGGCAGAAGGCTTAGGGGG - Intronic
1030176590 7:106660802-106660824 TTTAGGGCAGAAGACGGGGCTGG - Exonic
1030716269 7:112811336-112811358 CTTGTGGCAGAAGGCAAAGCAGG - Intergenic
1031680890 7:124673385-124673407 TTTGGGGCAGGAGTTTAAGGAGG - Intergenic
1033191142 7:139280967-139280989 TTTGGATCAGAAGACAAAGTAGG - Intronic
1037235907 8:16719394-16719416 TTGGAGGCAGGAGACTAACCTGG - Intergenic
1038013953 8:23497581-23497603 TTGTGGGCAAAAGACAAAGCAGG + Intergenic
1038315652 8:26482402-26482424 TTGGAGGCAGATGACTCAGCAGG - Intronic
1038540689 8:28387356-28387378 CTTGGGGCAGATGAAGAAGCTGG - Intronic
1040636120 8:49274887-49274909 TGTGGGCCAGAAGACTCACCTGG - Intergenic
1041949207 8:63481608-63481630 ATTGGGGCAGGAGAAGAAGCAGG - Intergenic
1042054374 8:64748364-64748386 TTTGGGGCAGAAGACCAGGGAGG - Intronic
1043587334 8:81784286-81784308 TTTGGAGCAGAAGACTTGGCAGG + Intergenic
1048449793 8:134523355-134523377 TTTGGGGCAGGAGTCTGGGCTGG - Intronic
1048902794 8:139055880-139055902 ATTGGTGCAGAGGACTGAGCTGG + Intergenic
1049231011 8:141481627-141481649 TGTGGGGCAGAAGACACAGGTGG + Intergenic
1051892205 9:21953994-21954016 TTTGGGGAAGAAGACTACAGAGG - Intronic
1052231372 9:26158093-26158115 CTTGTGGCAGAAGGCAAAGCAGG - Intergenic
1053469373 9:38335261-38335283 TTAGGGGCAGAAGAAGGAGCTGG + Intergenic
1055647812 9:78377471-78377493 ATTTGGGTAGAAGCCTAAGCGGG + Intergenic
1057332645 9:94129932-94129954 CTTATGGCAGAAGACAAAGCTGG - Intergenic
1059453592 9:114386341-114386363 TTTGGGGGAGAAGACTGGGGAGG + Intronic
1059654080 9:116341430-116341452 TTTGGGGCAGAGGTATAATCAGG - Intronic
1061138664 9:128751328-128751350 TCTGGGGCTGGAGACTGAGCTGG - Intronic
1189206854 X:39248200-39248222 CTTGGGGCTGGAGACCAAGCTGG - Intergenic
1190065947 X:47241892-47241914 TTTAGGGCAGGAGACTGCGCTGG - Intronic
1190761413 X:53440995-53441017 TTTGGGGAAGATGAGTCAGCCGG + Intergenic
1190920102 X:54842646-54842668 TTTGAGGCCGTAGACCAAGCAGG + Intergenic
1192502595 X:71663731-71663753 TTTGGGGAAGAGAACCAAGCAGG - Intergenic
1196321407 X:114344712-114344734 TTTGGGGCATAGGAATAAGGAGG + Intergenic
1197144401 X:123155540-123155562 TTTGGGGAAGAGGTCTGAGCCGG - Intergenic
1198812314 X:140548018-140548040 ATTGGGGCAGAAAACAAAGCAGG + Intergenic