ID: 1019865238

View in Genome Browser
Species Human (GRCh38)
Location 7:3702551-3702573
Sequence GCTTCATTCATACCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019865233_1019865238 11 Left 1019865233 7:3702517-3702539 CCACTCTCACCTGCTTAGTCTTC 0: 1
1: 0
2: 6
3: 22
4: 341
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data
1019865232_1019865238 25 Left 1019865232 7:3702503-3702525 CCGGATAGCATTCACCACTCTCA 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data
1019865234_1019865238 2 Left 1019865234 7:3702526-3702548 CCTGCTTAGTCTTCTGCCCCAAA 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019865238 Original CRISPR GCTTCATTCATACCTGCTTC TGG Intronic
No off target data available for this crispr