ID: 1019867604

View in Genome Browser
Species Human (GRCh38)
Location 7:3727473-3727495
Sequence ATTCTCTCCCTGGCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019867604_1019867607 18 Left 1019867604 7:3727473-3727495 CCTCTTTTTGCCAGGGAGAGAAT 0: 1
1: 0
2: 3
3: 23
4: 223
Right 1019867607 7:3727514-3727536 GGAGCCTCGCTCTGTCACTCAGG 0: 3
1: 578
2: 15088
3: 70347
4: 118458
1019867604_1019867609 22 Left 1019867604 7:3727473-3727495 CCTCTTTTTGCCAGGGAGAGAAT 0: 1
1: 0
2: 3
3: 23
4: 223
Right 1019867609 7:3727518-3727540 CCTCGCTCTGTCACTCAGGCTGG 0: 22
1: 1339
2: 28920
3: 125242
4: 166288
1019867604_1019867606 -3 Left 1019867604 7:3727473-3727495 CCTCTTTTTGCCAGGGAGAGAAT 0: 1
1: 0
2: 3
3: 23
4: 223
Right 1019867606 7:3727493-3727515 AATTTTCTTTTTTTTTGAGACGG 0: 24
1: 1659
2: 10998
3: 116805
4: 90007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019867604 Original CRISPR ATTCTCTCCCTGGCAAAAAG AGG (reversed) Intronic
900439148 1:2644722-2644744 TTTCTCTCCCGGGCAACTAGAGG + Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
900827783 1:4940560-4940582 ATTCTCTCCATGTCAAACATCGG - Intergenic
900843783 1:5079722-5079744 ATTCTCTCCCTGGTGCAGAGAGG - Intergenic
901196425 1:7442684-7442706 ATTCCCTCACTGGCAAAATGCGG + Intronic
902749250 1:18495719-18495741 ATTCTCTCCATGGCAACCAGAGG - Intergenic
903002362 1:20275383-20275405 ATTCTCTCCCTCCCCTAAAGAGG + Intergenic
904787126 1:32991656-32991678 ATTCTCTCCCTAGGAGAAAGAGG - Intergenic
905038321 1:34930944-34930966 ATCATCTCCCTGGGGAAAAGAGG - Intergenic
905271915 1:36792888-36792910 AAACTCACCCGGGCAAAAAGGGG - Intergenic
905607928 1:39320395-39320417 ATTTTCTGCATGCCAAAAAGAGG + Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
907052532 1:51339471-51339493 CTTCTTTCCCAGGAAAAAAGAGG - Intronic
912645421 1:111387502-111387524 ATTTGCTCCCTGGCAAGATGGGG + Intergenic
914221101 1:145682626-145682648 ACTCTCTTCCAGGTAAAAAGGGG - Exonic
914473673 1:148005499-148005521 ACTCTCTTCCAGGTAAAAAGGGG - Intergenic
914807813 1:151004401-151004423 TTTCTCTCCCTGATAAAGAGTGG - Intronic
916395641 1:164384140-164384162 TTTATTTCCCTGACAAAAAGAGG + Intergenic
917031308 1:170695201-170695223 AATCTCTTACTGGCAAAATGAGG + Intronic
917534725 1:175865948-175865970 ATCCTGCTCCTGGCAAAAAGTGG - Intergenic
918217597 1:182406304-182406326 ATTCTCCCACTGGCAAAAAGTGG - Intergenic
919341793 1:196318200-196318222 ATTCTAGTCCTTGCAAAAAGGGG - Intronic
922608779 1:226908805-226908827 ATTTTCTCACTGACAAGAAGTGG + Intronic
923172095 1:231427159-231427181 AATTTCTCACTGGCCAAAAGTGG - Intergenic
923496597 1:234531030-234531052 ATTCTCTCCCTTGAAAAACAGGG + Intergenic
923867810 1:237959224-237959246 CTTCTATACTTGGCAAAAAGAGG + Intergenic
924015481 1:239716610-239716632 ATTCACTCTCTTGCAAAAAAAGG - Intronic
924117173 1:240759510-240759532 ATATTCTCCCTGGGGAAAAGAGG - Intergenic
1063105058 10:2985649-2985671 GTTTTCTCACTGGCAAAGAGGGG - Intergenic
1063179944 10:3589038-3589060 ATTCTCTCACTTGCAAGATGGGG + Intergenic
1064519736 10:16188453-16188475 ATGCAGTCCCTGGCAAAAATAGG + Intergenic
1067486756 10:46657795-46657817 TTTCACTCCCTGGTAATAAGAGG - Intergenic
1067607994 10:47683870-47683892 TTTCACTCCCTGGTAATAAGAGG + Intergenic
1068624541 10:59227375-59227397 GTTCTCACCCTAGCAGAAAGCGG - Intronic
1071218012 10:83430149-83430171 CTTCTCTTCCTGGTACAAAGTGG + Intergenic
1071623598 10:87145581-87145603 TTTCACTCCCTGGTAATAAGAGG + Intronic
1071737503 10:88318199-88318221 ATTCTGTCTCTGGCAAACATGGG + Intronic
1071818305 10:89254403-89254425 ACTCTAGCCATGGCAAAAAGGGG - Intronic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1074616358 10:115072795-115072817 CTTCTCTTCCTGGCACAAGGAGG + Intergenic
1074987095 10:118668383-118668405 GTTTTCTCCTTGGCAAGAAGAGG - Intergenic
1075259386 10:120949554-120949576 ATTCTCTCTTTTGCAAAATGGGG + Intergenic
1076195132 10:128512370-128512392 ATTCTCTCCCTGGTGAAAAGTGG - Intergenic
1077995045 11:7445736-7445758 ATTGCCTCCCTGGCTGAAAGAGG - Intronic
1078429785 11:11280233-11280255 GGTTTCTCCCTGGCAAACAGTGG - Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1086897901 11:92334701-92334723 ATTCTTTCCCTGGTAGAATGTGG + Intergenic
1086917442 11:92547189-92547211 AGTCTCACCCTGCCTAAAAGGGG + Intronic
1087511613 11:99102132-99102154 ACTCTAGCCATGGCAAAAAGGGG - Intronic
1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG + Exonic
1089906125 11:122040579-122040601 ATTTTCTACCTGGCAGAAATCGG - Intergenic
1090117718 11:123992524-123992546 AAACACTCCCTGGCACAAAGGGG - Intergenic
1094228094 12:28069458-28069480 ATTCTCTTCTAGGCAAAAAATGG - Intergenic
1097842753 12:64337908-64337930 CTCCTCTCCCTGGTATAAAGAGG - Intronic
1098195072 12:67991167-67991189 ATTTTCTCATTAGCAAAAAGAGG + Intergenic
1101352081 12:103939735-103939757 ATTTTCTCACTGGGAAAAAATGG - Intronic
1103749182 12:123147817-123147839 CTTCTTTCTCTGGGAAAAAGGGG + Intronic
1103943148 12:124511722-124511744 ATGCACTCCCAGGCACAAAGGGG + Intronic
1104510720 12:129375172-129375194 ATCATCTCCCTTGCATAAAGTGG - Intronic
1108409851 13:50134473-50134495 ACTCTCTCCCAGTGAAAAAGAGG + Intronic
1110151632 13:72261642-72261664 ATTTTCTCATTGGCAAAATGAGG + Intergenic
1110430731 13:75420082-75420104 ATTCTGTCTCTGCCAAAATGTGG - Intronic
1111960666 13:94806500-94806522 AGTCTTTCCTTGGCAAAATGTGG + Intergenic
1112802430 13:103127171-103127193 AATCTCTGCTTGGCAAACAGAGG - Intergenic
1113010249 13:105756804-105756826 AATCTCTCCATGGCAACAATAGG - Intergenic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1113329665 13:109316059-109316081 ATTCTCTTAGTGGTAAAAAGGGG - Intergenic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1117199568 14:53374431-53374453 AAACATTCCCTGGCAAAAAGAGG - Intergenic
1118296752 14:64577142-64577164 ATCCTCACCATGGCAGAAAGAGG + Intronic
1119099755 14:71868932-71868954 AGTCTGTCCCTGGAAGAAAGGGG - Intergenic
1119224663 14:72935653-72935675 ATGCTCTCCCTGGCCCAAATTGG + Intronic
1120028867 14:79616956-79616978 ATTCTCTCCCAGGAAGGAAGAGG - Intronic
1120220512 14:81727228-81727250 ACTCTCTGCCTGCCAAAAACAGG + Intergenic
1121928079 14:97947442-97947464 ATTCTCTCTCTGGCAGCAATGGG - Intronic
1122347135 14:101067548-101067570 ATGCTCTCCCTGGCAGAGGGAGG - Intergenic
1124166213 15:27328071-27328093 GTTCCCTCCCTGGCAAAATGAGG - Intronic
1125166403 15:36710927-36710949 ATTGTTACCATGGCAAAAAGTGG - Intronic
1125906333 15:43396250-43396272 ATTCTCTAACTTGCAACAAGAGG - Intronic
1127629681 15:60815327-60815349 TGTCTCTCCCTGGCAAAACAAGG + Intronic
1128899995 15:71411881-71411903 AGTCTCTCCCTGGAAAACAATGG - Intronic
1129551401 15:76453824-76453846 TCTCTCTCACTGGTAAAAAGTGG + Intronic
1129798027 15:78392723-78392745 AAACTTACCCTGGCAAAAAGAGG + Intergenic
1129864229 15:78891175-78891197 AGTTTCTCCTTGGCAAAAAGAGG - Intronic
1135521384 16:23181326-23181348 AGTTTCTCCCCGGCACAAAGGGG + Intergenic
1140189413 16:72802544-72802566 AACCTCTCCCTGAAAAAAAGGGG + Intronic
1141861676 16:86721273-86721295 TTTCTCTTTCTGCCAAAAAGGGG - Intergenic
1143110804 17:4551810-4551832 GAGCTCTCCCTGCCAAAAAGGGG - Intronic
1143773599 17:9183448-9183470 ATTTCCTCCATGGCAAAGAGAGG + Intronic
1146021010 17:29278891-29278913 GTTCTCTCACTGGGAGAAAGGGG + Intronic
1146941220 17:36845643-36845665 ATCTTCTTCCTGGCAAGAAGGGG + Intergenic
1150368260 17:64611223-64611245 ACTCTCTCCCAGGAAAAATGTGG - Intronic
1155190377 18:23424026-23424048 ATTCCCTCCCTTGTAAAGAGAGG - Intronic
1157135247 18:45047894-45047916 ATTCTCTCCCTGGGAGACACTGG + Intronic
1157327228 18:46678058-46678080 ATTCCCTCCCTGGGAGAAATAGG + Intronic
1157542540 18:48521933-48521955 ATTCTCTCCCTGGGGAAACTGGG - Intergenic
1157574884 18:48736842-48736864 CTGCTCTCCCAGGAAAAAAGAGG - Intronic
1157890578 18:51412648-51412670 ATTGTATCCCTGGCAAGAGGGGG - Intergenic
1158209706 18:55034568-55034590 ATTCTATCCCTGGAGAAATGGGG + Intergenic
1160127655 18:76192066-76192088 AATCTCTCCATTGCTAAAAGTGG + Intergenic
1160968535 19:1757278-1757300 ACTCTCCCCGTGGCAGAAAGGGG - Intronic
1164645256 19:29854717-29854739 AGTCTCTCCCTGTGAAAAAGGGG + Intergenic
1167104741 19:47423657-47423679 ATTCTCTCCCTGGGGAAGTGCGG - Intergenic
927694944 2:25233226-25233248 AGGTTCTCCCTGCCAAAAAGGGG - Exonic
927797224 2:26060624-26060646 ATTTTCTCACTGGCAAAATAAGG - Intronic
927885527 2:26715932-26715954 ATTCTCTCCCTCACAAACAGTGG - Intronic
930445223 2:51462403-51462425 ATTCTCTCCCTTGCTCAAATGGG + Intergenic
930988244 2:57615782-57615804 TTTTTCTCCCTGACAAAAAATGG - Intergenic
931079427 2:58752771-58752793 ATTCTAGCCCTGGCTAAAAGGGG + Intergenic
932820729 2:74897574-74897596 TGCCTCTCCCAGGCAAAAAGGGG + Intergenic
933188201 2:79302285-79302307 ATTCTCTCCTTGGCAATACTGGG + Intronic
935170885 2:100610801-100610823 ATTCCCTCCCTTGCAAAATGGGG - Intergenic
937193252 2:120125292-120125314 ATTCTTGCCCTGCCAAACAGTGG + Intronic
937598356 2:123697387-123697409 ATTCTCCCCATGGCAAAATGGGG + Intergenic
937697093 2:124820035-124820057 ATTCTCTCCCTTGCAGAAATGGG + Intronic
942530658 2:176906362-176906384 ATTGTTTCCCTGGGAAAAAAAGG + Intergenic
942961115 2:181830718-181830740 CTGCTCTCCCTGGCACACAGAGG - Intergenic
945120570 2:206453052-206453074 ATCCTCTCCCTGGCTCCAAGAGG - Intronic
946013932 2:216588763-216588785 ATTCTCTCCCCAGAAAAATGGGG + Intergenic
947646349 2:231744330-231744352 CTTCTCTCCCTTGAAATAAGGGG - Intronic
947648184 2:231760597-231760619 AGTCTCTCCCTGGTACAAACTGG - Intronic
1168966573 20:1902163-1902185 CTCCTCTCCCTAGCAAAAATAGG - Intronic
1171445089 20:25197018-25197040 TTTCTCTCCTTGGCAAAAACCGG - Intronic
1173404065 20:42749584-42749606 ATGCTCTCACTGGTAAAAGGTGG + Intronic
1174540226 20:51283557-51283579 ATTGTCTCCCTGACAAAGTGAGG + Intergenic
1175521823 20:59606646-59606668 TTTGTCTCCCTGGCAGTAAGAGG + Intronic
1176976892 21:15332707-15332729 ATTCTCTTCCTGCCCACAAGAGG - Intergenic
1176989515 21:15478414-15478436 CTCATCTCCCTGGCACAAAGGGG - Intergenic
1177166912 21:17613149-17613171 CTTCCCTCCCCGGCAAAAAGCGG + Intergenic
1177345726 21:19866652-19866674 ACTCCCTCCTTGACAAAAAGAGG - Intergenic
1181860557 22:25814632-25814654 ACTATCTCCCTTCCAAAAAGGGG - Intronic
1183089308 22:35510529-35510551 ATTTTCTTCCTGGGAAAATGAGG + Intergenic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
949153464 3:799196-799218 ATTCACTCCTTGGCTAAGAGAGG + Intergenic
949970389 3:9398158-9398180 TCTCTCTCCCTGGGAAAATGGGG - Intronic
950077254 3:10195921-10195943 AGTCTCTCCCTGCCAGAGAGGGG + Intronic
951867710 3:27325936-27325958 TTTGTCCCCTTGGCAAAAAGGGG - Intronic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952948967 3:38502803-38502825 ATGATTTCCCTGCCAAAAAGTGG + Intronic
954792731 3:53145158-53145180 GTTTTCTCCCTGGTAAAATGGGG - Intergenic
960925536 3:122792452-122792474 ATTGTCTCCCTGGTAGAAAGTGG + Intronic
961546321 3:127636435-127636457 ATCCTCTCCCAGGAACAAAGGGG + Intronic
963717303 3:148818391-148818413 CTTCTCTTCCTGGAACAAAGCGG + Intronic
966258018 3:177941408-177941430 ATACTTTCCCTGACATAAAGGGG - Intergenic
966817158 3:183898657-183898679 ATTCTGTCCTTGGCAGAAATTGG - Intergenic
968042290 3:195598868-195598890 ATTTTCACCCAGGCAAAAATGGG - Intergenic
970389113 4:15589634-15589656 ATTCTGTCCCTTGAAAAATGTGG + Exonic
970924571 4:21436095-21436117 GTTCACTCTCTGGCTAAAAGGGG + Intronic
972836335 4:42875063-42875085 ATTCTCACCCAACCAAAAAGTGG - Intergenic
974344479 4:60661651-60661673 TTTTTCTACATGGCAAAAAGGGG - Intergenic
976582102 4:86749138-86749160 ATTTTCTCTCAGGCATAAAGAGG - Intronic
978270298 4:106881331-106881353 GTTTTCTCTCTGGCAAAATGTGG - Intergenic
979615039 4:122732966-122732988 ATTCTTTCCCTGGCCCGAAGAGG - Intronic
979761652 4:124413420-124413442 ATTCTTTCCCAAGCAAAAATGGG + Intergenic
981200404 4:141973069-141973091 ACTCTAGCCATGGCAAAAAGGGG - Intergenic
981316467 4:143344551-143344573 ATATTACCCCTGGCAAAAAGTGG + Intronic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
982418720 4:155167983-155168005 ACTTTCCCCCTGCCAAAAAGGGG - Intergenic
982469229 4:155767010-155767032 ATTCTCTCATTTGCAAAATGAGG - Intronic
984557398 4:181231377-181231399 ATTCTCTACATAGCAAAAGGAGG - Intergenic
987275854 5:16361782-16361804 ATTCTCAGCATGGCAACAAGAGG - Intergenic
988465822 5:31490695-31490717 ATTCTCTCTCTAGCAAGAAAAGG + Intronic
990801969 5:59614579-59614601 ATTCTCTCCATTTCTAAAAGGGG - Intronic
992166294 5:74055354-74055376 GTTCTCTACCTGGCAAAACTTGG - Intergenic
992619465 5:78578362-78578384 ATCCTTTAACTGGCAAAAAGTGG - Intronic
994018523 5:94996967-94996989 ATTGTATCCCTGGCTAACAGAGG + Intronic
994018617 5:94998281-94998303 ATTGTATCCCTGGCTAACAGAGG + Intronic
997182317 5:131843091-131843113 ATTCCATCCATGGCCAAAAGGGG - Intronic
998680604 5:144462473-144462495 ATTCTCTCCCTGGTTAAGATGGG + Intronic
1000122744 5:158212798-158212820 ATTCTCTCCTTGGCAATGAAGGG + Intergenic
1000580969 5:163035123-163035145 ATTCTAGCCATGGCTAAAAGTGG + Intergenic
1002171304 5:177376153-177376175 ACTCACTCCCGGGCACAAAGAGG + Intergenic
1003767008 6:9249178-9249200 ATTATAACCCTGGCAAGAAGTGG - Intergenic
1003778996 6:9401996-9402018 ATTTTCCCCCTGACAAAAATGGG + Intergenic
1004720300 6:18263316-18263338 TTTCCCTCCCTGGCAAACAGCGG - Intronic
1005143261 6:22658431-22658453 ACTCTCTCTGAGGCAAAAAGTGG - Intergenic
1005528656 6:26678976-26678998 ATTCTCTTCCTGGAAAGAACAGG + Intergenic
1005532165 6:26718884-26718906 ATTCTCTTCCTGGAAAGAACAGG + Intergenic
1005538630 6:26782781-26782803 ATTCTCTTCCTGGAAAGAACAGG - Intergenic
1005542140 6:26822672-26822694 ATTCTCTTCCTGGAAAGAACAGG - Intergenic
1007877409 6:45121282-45121304 ATTCTCTCTCTAGAAAAAAATGG - Intronic
1009009482 6:57825016-57825038 ATTCTCTTCCTGGAAAGAACAGG - Intergenic
1009012944 6:57864723-57864745 ATTCTCTTCCTGGAAAGAACAGG - Intergenic
1009518549 6:64652432-64652454 ATTTTCTACCTGACAAAAAATGG + Intronic
1009796105 6:68470282-68470304 ACTCTCTTCTTGGCTAAAAGGGG - Intergenic
1010401056 6:75446679-75446701 AATCTCTCCCTGGCAATAAAAGG + Intronic
1011851814 6:91638709-91638731 ATGCTGTCCCTGGCTAAAATAGG + Intergenic
1012908517 6:105094157-105094179 CTTCTCTCCCTTCTAAAAAGGGG + Intergenic
1012990468 6:105920790-105920812 ATGCTCTCCCTGGCTCACAGTGG - Intergenic
1012998427 6:105995642-105995664 ATATTCTCCCTGGGAGAAAGAGG - Intergenic
1013726056 6:113097151-113097173 GATCTCTCCCTGGCTAAGAGGGG - Intergenic
1014640909 6:123909301-123909323 ATTCTCACCCTTGCAAGTAGAGG + Intronic
1015224671 6:130843747-130843769 ATTCTCACATTGGCCAAAAGAGG - Intronic
1015513869 6:134065893-134065915 TTTCTCTACCTGTCAAAAGGGGG - Intergenic
1016494573 6:144645796-144645818 GTTCTGACTCTGGCAAAAAGTGG + Intronic
1017723958 6:157263994-157264016 ATTTTCTCCCTGGTAAAAAGTGG - Intergenic
1018304833 6:162444028-162444050 ACCCCCTCCCTGCCAAAAAGAGG - Intronic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1020154267 7:5709446-5709468 GTTCTCTCTATGGGAAAAAGAGG + Intronic
1020351635 7:7226327-7226349 ATTGTCACCTTGGCAAAATGTGG + Intronic
1021585669 7:22204954-22204976 ATTCCCTCCCTTGGAAAAAAAGG - Intronic
1023207745 7:37769491-37769513 TTTTTCTCCCTGATAAAAAGAGG + Intronic
1028823466 7:95241352-95241374 ATTCTGTCCCAAGCAAAAAGTGG - Intronic
1029243904 7:99184597-99184619 ATTCTCTCCCTACCAAAAGAGGG - Intronic
1029678665 7:102092060-102092082 ATTCTTTTCCTGTCAAGAAGTGG - Intronic
1030110868 7:106025598-106025620 GATCTCTCAATGGCAAAAAGAGG + Intronic
1030285769 7:107825334-107825356 ATTTTCTCCCAAGCATAAAGGGG + Intergenic
1031257034 7:119466168-119466190 TTTTTCCCCCTGGCAAAATGTGG - Intergenic
1032825729 7:135565962-135565984 TTTCTCTGCCTGCCAAAATGAGG - Intronic
1033492642 7:141859344-141859366 ATTCTACTCATGGCAAAAAGTGG - Intergenic
1034080301 7:148270878-148270900 GTTCTCTCCTTTGCAAAATGGGG + Intronic
1034962706 7:155372599-155372621 CTTCTCTCCCTGGGGAGAAGCGG - Intergenic
1035929967 8:3769628-3769650 ATTCTCTTAATGGAAAAAAGTGG - Intronic
1037348735 8:17926568-17926590 ATTCTCAAGCTGTCAAAAAGTGG - Intronic
1037426285 8:18758353-18758375 ATCTTCTCCCTGGCTGAAAGGGG + Intronic
1037885633 8:22594726-22594748 AGTCTCTCCCAGGAAAGAAGTGG - Intronic
1039908458 8:41804552-41804574 CTTCTCTCCCTGGCTATGAGAGG + Intronic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1043969779 8:86516019-86516041 ATTCTCGCAAAGGCAAAAAGTGG - Intronic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1047175062 8:122532674-122532696 ATGCTGTCACTGGAAAAAAGAGG + Intergenic
1047315882 8:123732531-123732553 ATTCTCTCCCCTGCACCAAGTGG + Intronic
1047339729 8:123969299-123969321 ATTCTCTCCCTGGTAAATCCTGG + Intronic
1047555673 8:125927254-125927276 CTTCTCTTCATGGCAAGAAGAGG + Intergenic
1050201445 9:3149473-3149495 ACTCTCTCCCTGGCTAGAAAGGG + Intergenic
1050956205 9:11664415-11664437 ATTCTATCCATTGCTAAAAGTGG + Intergenic
1051190077 9:14501971-14501993 CTTCTCTCCCTGGCCAGCAGAGG - Intergenic
1051698884 9:19797801-19797823 CTTCCCACGCTGGCAAAAAGGGG - Intergenic
1052124244 9:24755824-24755846 ATTCTGTCTATGGCTAAAAGGGG + Intergenic
1055336168 9:75235655-75235677 ATTCTCTCTCTGGGCACAAGTGG + Intergenic
1057880347 9:98788341-98788363 ATTCCCTCCCCTGCAAAATGGGG + Intronic
1058092961 9:100826334-100826356 ATTCTATCAGTGGCACAAAGAGG - Intergenic
1058176786 9:101744957-101744979 ATTCTCTCTCAGGTAAGAAGAGG + Intergenic
1060869309 9:127026919-127026941 ATCCACCCCCGGGCAAAAAGTGG - Intronic
1061659192 9:132117025-132117047 ATTGTCTCCTTGGTAAAACGGGG + Intergenic
1187449410 X:19383261-19383283 ATTCTCTCCATGGAAATAACTGG + Intronic
1187630600 X:21166230-21166252 ATTCTGTCTCTGGTAAAATGAGG + Intergenic
1188097403 X:26041980-26042002 ATTCTCTCTCTGGGGAAAAATGG + Intergenic
1189155606 X:38753784-38753806 ATTCCCTCACTTGCAAAATGGGG - Intergenic
1189647361 X:43148035-43148057 TCTCTCTCCCTGGGAAAAGGAGG - Intergenic
1191914971 X:66191735-66191757 ATTCTCTCCTTTGGCAAAAGAGG + Intronic
1192585248 X:72313980-72314002 CTTCTCTCCATGGCACAGAGAGG + Intergenic
1193055795 X:77148629-77148651 ATTATCTGCCAGGCAAAAAATGG + Intergenic
1193366977 X:80646225-80646247 ATTCTCTGCTAGCCAAAAAGTGG - Intergenic
1194978109 X:100412943-100412965 ATGCTCTCCTTGGAAAAGAGGGG - Intergenic
1197446551 X:126556748-126556770 ATTCTCTCCATGGCAGAAGTAGG + Intergenic
1198249410 X:134865744-134865766 ATTCTCTTCCTGTCAGTAAGTGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199641522 X:149867062-149867084 ACTCTCACCCTGGCCAAAATGGG + Intergenic
1200142020 X:153907129-153907151 ATTCTCTCCCTAATAAAAATTGG + Exonic