ID: 1019870292

View in Genome Browser
Species Human (GRCh38)
Location 7:3754668-3754690
Sequence CTAAGTAAGGGGAAGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019870278_1019870292 29 Left 1019870278 7:3754616-3754638 CCAGGGAAGTTCTCCCCGGATTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG No data
1019870280_1019870292 16 Left 1019870280 7:3754629-3754651 CCCCGGATTGCTGACTGGAGAAA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG No data
1019870277_1019870292 30 Left 1019870277 7:3754615-3754637 CCCAGGGAAGTTCTCCCCGGATT 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG No data
1019870282_1019870292 14 Left 1019870282 7:3754631-3754653 CCGGATTGCTGACTGGAGAAACA 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG No data
1019870281_1019870292 15 Left 1019870281 7:3754630-3754652 CCCGGATTGCTGACTGGAGAAAC 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019870292 Original CRISPR CTAAGTAAGGGGAAGGGGGG TGG Intronic
No off target data available for this crispr