ID: 1019873800

View in Genome Browser
Species Human (GRCh38)
Location 7:3791278-3791300
Sequence TGGAACTACAGCCAGTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019873796_1019873800 15 Left 1019873796 7:3791240-3791262 CCTAGCAACATTGTGCTGGACTA 0: 1
1: 0
2: 1
3: 8
4: 204
Right 1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019873800 Original CRISPR TGGAACTACAGCCAGTGAGT AGG Intronic
902519991 1:17010867-17010889 GGGAACCACAGCCAGGGAGGAGG - Intronic
902862426 1:19256038-19256060 TGGAAGCACAGCCGGTGAGCGGG + Exonic
904051694 1:27643675-27643697 TGGCACTAGAGCCACTGAGTGGG - Intergenic
904443268 1:30546415-30546437 TGGAACTAGAGGCAGTGACAGGG + Intergenic
906685020 1:47757630-47757652 TGGAACCTCAGCCACAGAGTAGG - Intergenic
909409338 1:75331018-75331040 TGGAAGAACACCCAGTGAGTTGG - Intronic
910794192 1:91081558-91081580 TGTAACTACAGCCAGTGCTCAGG - Intergenic
912391073 1:109303428-109303450 TGCAGATACAGCCACTGAGTGGG - Intronic
912684562 1:111752127-111752149 TGGAACTACAGCAACTGTTTGGG + Intronic
914649239 1:149683911-149683933 TGGAACTGCAGCCTGTTATTGGG + Intergenic
915226757 1:154417396-154417418 AGAAGCTACAGCCAGTGTGTAGG - Intronic
915429995 1:155859324-155859346 TGGAACCACAGCGCGTCAGTGGG + Intronic
917733569 1:177900382-177900404 TGGGATTACAGCCACTGGGTTGG - Intergenic
918097152 1:181345015-181345037 TGGAGGTAAAGACAGTGAGTGGG + Intergenic
918497868 1:185159477-185159499 AGGAACTACAGTGAGTGAATTGG + Intronic
922856341 1:228778216-228778238 AGGAAGTACAGGCAGTGGGTGGG + Intergenic
923014703 1:230117591-230117613 TGGCAGAACAGCCAGTGAGTGGG + Intronic
1063500153 10:6546099-6546121 AGGACCTACAGCTAGTAAGTGGG + Intronic
1063549269 10:7014262-7014284 TGGGGCTACAGCTATTGAGTTGG - Intergenic
1063601051 10:7481903-7481925 TGGAAAGTGAGCCAGTGAGTGGG - Intergenic
1067361391 10:45582938-45582960 TGTAACCACAGTCAGAGAGTGGG + Intronic
1075149595 10:119915113-119915135 TGGATTTATAGTCAGTGAGTTGG + Intronic
1082232872 11:49790415-49790437 CGGAAGTACAGCCAGTGGGTAGG + Intergenic
1083915169 11:65738107-65738129 TGGACCAGGAGCCAGTGAGTTGG + Intergenic
1083954144 11:65973752-65973774 TGGAATCACAGCCCGTGAGCTGG - Intronic
1085554039 11:77403260-77403282 TGGAACTAAAGCCTTTCAGTGGG - Intronic
1086617756 11:88843502-88843524 CGGAAGTACAGCCAGTGGGTAGG - Intronic
1087422323 11:97945262-97945284 TGGAGCTGCAGTCAGTGAGCTGG + Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1100313023 12:93414784-93414806 TGGAGATAAAGCCAGGGAGTGGG - Intronic
1101272996 12:103167538-103167560 TGGAGCCCCAGCCAGTGACTGGG + Intronic
1102047829 12:109840861-109840883 TGGAATCACAGCCAGTGGCTGGG - Intergenic
1104081028 12:125430731-125430753 TGGAAACAAAACCAGTGAGTCGG + Intronic
1105941355 13:25150792-25150814 TGGAAAGAGAGCCAGGGAGTGGG - Intergenic
1113162363 13:107396229-107396251 TGGAGATACAGCCTGTGAGGAGG - Intronic
1113455643 13:110446649-110446671 TGGAACCACAGACAGTGCCTGGG - Intronic
1113961768 13:114130297-114130319 TGGAGCCACATCCAGAGAGTCGG + Intronic
1114649197 14:24272713-24272735 AGGATATACAGCCAGAGAGTAGG - Intergenic
1117242982 14:53854357-53854379 AGGAACTATGCCCAGTGAGTAGG + Intergenic
1117283495 14:54263916-54263938 TGGGATTTCAGCCAGTGAGGAGG + Intergenic
1120169133 14:81231677-81231699 GGGAACCACAGCCATTCAGTTGG + Intergenic
1120948603 14:90020661-90020683 TTCAACTATAGCCAGTGAGGAGG - Intronic
1128427951 15:67561852-67561874 TGGAACTACAGCCAGACAGGAGG + Intronic
1135113238 16:19706989-19707011 TGGAAGTACAGCCGGGGAGCCGG - Exonic
1137445664 16:48530475-48530497 GGGAACGGCAGCCAGAGAGTGGG - Intergenic
1146372646 17:32275179-32275201 GGGAACTGCAGGCAGGGAGTGGG - Intronic
1150248738 17:63694442-63694464 TGGAACTGCTGCCACTGAGGGGG + Exonic
1156955531 18:42958387-42958409 AGTAACTGCAGCCAGTGAGAAGG - Intronic
1158327282 18:56325487-56325509 TGGAACCACAGCCAGTATCTCGG - Intergenic
1159130807 18:64278379-64278401 TGTAGCTGCTGCCAGTGAGTAGG + Intergenic
1160339224 18:78072510-78072532 TGGAAGCACAGCCTGTGCGTCGG - Intergenic
1162198267 19:9002498-9002520 AGGAACCACAGGAAGTGAGTAGG - Intergenic
1163166489 19:15501681-15501703 TGGAACTAAGCCCAGTGACTGGG + Intergenic
1166069985 19:40381351-40381373 TGGAACTTGGGCCAGTGATTTGG - Intronic
1166752676 19:45172163-45172185 AGGAGCCACAGCCAGTGTGTAGG - Intronic
1166752943 19:45173355-45173377 AGGAGCCACAGCCAGTGTGTAGG - Intronic
1168397633 19:56062523-56062545 TGGAAATTCAGCCAGTCAGAAGG - Intergenic
928400057 2:30971331-30971353 TGGAAGAAGAGCCAGTGAGCGGG + Intronic
930684065 2:54288917-54288939 TGAAACTAAAGCCAGTAGGTGGG - Intronic
931077836 2:58736119-58736141 TGGAACTACAGCAAGACAGAAGG - Intergenic
931643884 2:64404447-64404469 TGTAACCAAAGCCAATGAGTTGG + Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
935316007 2:101834426-101834448 TGGCATTACAGCCATTGAGATGG + Exonic
936490081 2:112962430-112962452 GGGAACTACAGCCCATCAGTGGG - Intergenic
939633900 2:144558149-144558171 TGTAACAAGAACCAGTGAGTTGG + Intergenic
941283365 2:163580250-163580272 TGGAGCTAGAGACATTGAGTTGG + Intergenic
946768548 2:223063203-223063225 TGGCACCACAGACAGTGATTTGG + Intronic
1169755545 20:9039513-9039535 TGGAACTAGAGCCAGTGCAGAGG + Intergenic
1171297457 20:24030903-24030925 GGGATCAACAGCCAGTAAGTGGG + Intergenic
1172979825 20:38932567-38932589 TGGATCTACAGCAAGTATGTAGG - Intronic
1176855676 21:13968656-13968678 TGAATCTAAAGTCAGTGAGTTGG - Intergenic
1179199645 21:39204700-39204722 TGGGACTGGGGCCAGTGAGTGGG + Intronic
1180785548 22:18545339-18545361 TGGGACTACAGCTAGTAGGTGGG + Intergenic
1181129134 22:20719379-20719401 TGGGACTACAGCTAGTAGGTGGG + Intronic
1181242454 22:21484691-21484713 TGGGACTACAGCTAGTAGGTGGG + Intergenic
1182085955 22:27561347-27561369 TGGACCAACAGCTGGTGAGTTGG - Intergenic
1184106019 22:42368047-42368069 TGGAGCTACAGAGAGGGAGTGGG + Intergenic
1184234493 22:43175615-43175637 TGGAAATGCTGGCAGTGAGTGGG - Intronic
1184321439 22:43744844-43744866 GGGAGGTACAGCCAGTGAGCAGG + Intronic
1184476607 22:44725391-44725413 TGGAACTGCAGGCAGACAGTGGG - Intronic
1185169144 22:49282257-49282279 TGGAATAACAGCCAGGGAGCTGG - Intergenic
949452192 3:4198193-4198215 TGGAAATAAAACCAGTGAGTGGG + Intronic
949819123 3:8096005-8096027 TGGAGCTACAGGCAGGGAGGAGG + Intergenic
949949436 3:9217025-9217047 TGGAACTGCACCCAGTGAACAGG - Intronic
951124266 3:18964895-18964917 TGTAACTACACTCAGTTAGTAGG - Intergenic
952914562 3:38223850-38223872 TGGAATTACAGCAATTGAATTGG + Exonic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
957414957 3:79889988-79890010 GGGAACGACTGCCAGTGAGCTGG - Intergenic
958929789 3:100196939-100196961 AGGAACTACAGAGAGTGAGTAGG + Intergenic
959618623 3:108375988-108376010 TGAAACTACAACCAGGGAGCTGG - Intronic
962183179 3:133230092-133230114 TCAAACCAAAGCCAGTGAGTTGG + Intronic
966763269 3:183435810-183435832 GGGAACTACAGTCACTGAGTTGG + Intergenic
970309787 4:14769940-14769962 TGGAACTTCAGCTACTGAGAGGG + Intergenic
972835754 4:42868188-42868210 AGGAGCCAGAGCCAGTGAGTAGG + Intergenic
973540180 4:51927621-51927643 GGGAACTTCAGCCACTGAATTGG - Intergenic
981447686 4:144859137-144859159 TGGGACCACAGTTAGTGAGTTGG - Intergenic
982097200 4:151933921-151933943 TTGAACTAGACCCTGTGAGTTGG + Intergenic
982851261 4:160318777-160318799 TGGAACTTCAGTCACTGAATTGG - Intergenic
986188129 5:5464437-5464459 TGCAGCTTCAGCCAGTGAGAGGG + Exonic
990190875 5:53259179-53259201 TGGAAATACAGCTAGTGATTAGG + Intergenic
990950191 5:61291107-61291129 TGGAGCTACAGGAAGTGGGTGGG - Intergenic
990961459 5:61398082-61398104 TGGAACCACAGCAAGAGAGCAGG - Intronic
995526630 5:113055357-113055379 GGGGACTACAGCTACTGAGTTGG - Intronic
1000205826 5:159057611-159057633 TGGAACCAGAGCCAGGGACTTGG + Intronic
1001404207 5:171464143-171464165 AGGAAACACAGCCAGTGAGAGGG - Intergenic
1001943722 5:175760395-175760417 TGGTACTACAGAGAGTGAGGTGG + Intergenic
1002418573 5:179133842-179133864 TGGGACTACAGGCAGCGACTCGG - Intronic
1004625591 6:17373724-17373746 TGGAACCCCAGCCAGGGACTTGG + Intergenic
1007222334 6:40288768-40288790 TGGCACTGCAGCCAGTCAATAGG + Intergenic
1007501833 6:42304454-42304476 TAGCACTATACCCAGTGAGTGGG + Intronic
1010071011 6:71745665-71745687 TGAAACTAGAGCATGTGAGTGGG + Intergenic
1011424209 6:87208849-87208871 TGGAAGTTCAGGCAGTGAGTTGG + Intronic
1012950844 6:105516115-105516137 TGGTACTACAGTAAGTGAGCTGG - Intergenic
1015443507 6:133275389-133275411 TGGAACTAGAGGCAGTGGGAGGG + Intronic
1016526179 6:145004093-145004115 TGAAAGTACAGCCAGAGAGGTGG - Intergenic
1017617479 6:156260431-156260453 TGGAACAACAACCAGAAAGTAGG + Intergenic
1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG + Intronic
1020434434 7:8147375-8147397 TGGAACTGCAGCCATTCCGTTGG - Intronic
1026872744 7:73863144-73863166 TGCAAATCCAGCCCGTGAGTGGG + Intronic
1027420787 7:78015761-78015783 TGGAACTACAGCCAGGCATTTGG - Intergenic
1029026496 7:97422274-97422296 AGGTCATACAGCCAGTGAGTGGG + Intergenic
1029940270 7:104473066-104473088 TGGAACTAAAGGCAGTGAAATGG + Intronic
1030626790 7:111853679-111853701 TGGGATTAAAGCCAGTGGGTGGG - Intronic
1031131915 7:117842628-117842650 TGAAACTGGAGCCAGTGAGGAGG - Intronic
1033601397 7:142891575-142891597 TGGAGCTACAACGAGTGATTGGG - Intergenic
1039608668 8:38902030-38902052 TGGAACTCCAGACAGTGAAAAGG + Intronic
1039857704 8:41430584-41430606 ATGAACTACATCCATTGAGTTGG + Intergenic
1041658825 8:60380821-60380843 TTTAACTACAGCCTATGAGTTGG - Intergenic
1042093820 8:65189833-65189855 TGAATCTACAGCCAGTAATTAGG + Intergenic
1042210363 8:66374234-66374256 TGGGACTGCAGCAAGTGACTTGG - Intergenic
1044792121 8:95858325-95858347 GGGAACCACAGCCAGTGACAGGG + Intergenic
1045826406 8:106403421-106403443 GGGAACTACACCCATTGATTTGG - Intronic
1048419099 8:134259484-134259506 TGGACATTCAGACAGTGAGTAGG - Intergenic
1048535391 8:135289682-135289704 TGAGACTTCAGCCAGTGAGAAGG - Intergenic
1049234348 8:141504781-141504803 TGAAACTACAGACAGAGAGCAGG + Intergenic
1050585498 9:7107195-7107217 TGGAAATACAGCCAGAAACTAGG - Intergenic
1057485433 9:95479230-95479252 AAGAATTGCAGCCAGTGAGTTGG - Intronic
1057995109 9:99815330-99815352 ATGAACTATAGCCACTGAGTGGG - Intergenic
1059386206 9:113966569-113966591 TGGAACTCCACCCTGGGAGTTGG + Intronic
1190146015 X:47892303-47892325 GGGAACTGCAGCCACTGAGTAGG - Intronic
1196995971 X:121384261-121384283 AGGAACTACAGCAAGTCCGTAGG + Intergenic
1199210648 X:145206180-145206202 TGGACCCACAGACAGTGAGCTGG + Intergenic