ID: 1019874745

View in Genome Browser
Species Human (GRCh38)
Location 7:3799780-3799802
Sequence TTGGAGGAGCAAGTAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019874745_1019874746 -10 Left 1019874745 7:3799780-3799802 CCTGAGTTTACTTGCTCCTCCAA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1019874746 7:3799793-3799815 GCTCCTCCAAATGCTAAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 160
1019874745_1019874749 -3 Left 1019874745 7:3799780-3799802 CCTGAGTTTACTTGCTCCTCCAA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1019874749 7:3799800-3799822 CAAATGCTAAATTTGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019874745 Original CRISPR TTGGAGGAGCAAGTAAACTC AGG (reversed) Intronic
903413612 1:23167388-23167410 TTGGAGGAGAAAATACTCTCTGG - Intronic
909051887 1:70776443-70776465 TTGGAGGAGTAAAAAATCTCTGG - Intergenic
911549592 1:99263436-99263458 TTGGAGGAGCAACTAAAAAAGGG + Intergenic
911892992 1:103396452-103396474 TTGGAGGAGAGAGGGAACTCTGG + Intergenic
913081132 1:115388365-115388387 TTGGAGGAGAAAAGACACTCTGG + Intergenic
915433692 1:155887076-155887098 TAGGAGGATCAATTTAACTCAGG - Intergenic
915986131 1:160466831-160466853 TGGGAGGATCAATTGAACTCAGG - Intergenic
916073119 1:161183380-161183402 TGGGAGGATCACTTAAACTCAGG - Intergenic
916831632 1:168498161-168498183 TTGGTGAAGAAAGTAAACTCTGG + Intergenic
917619183 1:176778364-176778386 TAGGATGAGCAAATAAAGTCAGG + Intronic
919061393 1:192638360-192638382 TTGGAAGAGATAATAAACTCAGG + Intronic
922120862 1:222666193-222666215 TTTGGGGAACATGTAAACTCAGG + Exonic
1063349753 10:5343338-5343360 TTGCTGGTGGAAGTAAACTCGGG + Intergenic
1064014692 10:11762993-11763015 TTGCAGGAGCAAGAGAACACGGG + Intronic
1065243200 10:23729173-23729195 GTGGATGAGTAAGTAAACTATGG - Intronic
1068388345 10:56360384-56360406 CTGGAGGGGCAAGGAAACACAGG + Intronic
1068799037 10:61118489-61118511 TGGGAGGATCACTTAAACTCAGG + Intergenic
1069011882 10:63383469-63383491 TGGGAGGATCACTTAAACTCAGG + Intronic
1070105314 10:73425852-73425874 TGGGAGGAGCAAGTAGAGACCGG - Exonic
1070826658 10:79394189-79394211 TTGTAGGAGGGAGTAAACTGAGG + Intronic
1073178921 10:101572364-101572386 TGGGAGGAGGAAGGGAACTCTGG + Intronic
1074270191 10:111945756-111945778 TTGGAGGAGAGAGGGAACTCTGG - Intergenic
1074448701 10:113541323-113541345 TTGGAGGAGAAAATGAACTCTGG + Intergenic
1074454135 10:113582714-113582736 TTAGAGAAGCAAGTAACTTCTGG + Intronic
1078746607 11:14121424-14121446 TTGGTGGAGAAAATAAGCTCGGG + Intronic
1079328781 11:19516980-19517002 TGGGAGGAGCAACTGAACCCAGG + Intronic
1081647753 11:44801802-44801824 TGGGAGGATCAATTAAACCCAGG + Intronic
1081814114 11:45929114-45929136 TTGGGGGAGCAAGGGCACTCTGG + Intergenic
1088717507 11:112561670-112561692 TTTGAGGATCAAGGAAACTGGGG - Intergenic
1089481989 11:118813332-118813354 TTGGAGGATCACTTGAACTCAGG - Intergenic
1093244038 12:16713374-16713396 TTCCAGGAGCAAGTAAACAGAGG + Intergenic
1096404499 12:51333618-51333640 TGGGAGGATCACTTAAACTCAGG - Intronic
1100845849 12:98656717-98656739 ATGGAGAAGGTAGTAAACTCAGG - Intronic
1103019144 12:117519847-117519869 TTGGAGAAGCACATAAACACCGG + Intronic
1103560877 12:121792935-121792957 TTGGAGGAGGAGGTGAACTCTGG - Intronic
1103983827 12:124754277-124754299 TTGGATCAGCAAGTTAACCCAGG + Intergenic
1104527411 12:129537321-129537343 TTGGAGGATCAACTAAAATCAGG - Intronic
1107603576 13:42038333-42038355 TTGAAAGAGCAGGTAAACTTAGG + Intergenic
1108671313 13:52692023-52692045 TTGGAGGAGCAACTTTACTAAGG - Intronic
1108961026 13:56229739-56229761 TTGAAGGAGCAAGGAAATTCTGG + Intergenic
1109646986 13:65271836-65271858 TTGGAGGTGATAGTAAAGTCAGG + Intergenic
1111725369 13:92001236-92001258 TTGGAAAAGCAATTAATCTCAGG + Intronic
1113461273 13:110484322-110484344 CTGGAGGAGTAAGTGAAATCTGG - Intronic
1114848205 14:26349593-26349615 ATGCAGGAGGAAGTAAACTTGGG - Intergenic
1115424140 14:33235525-33235547 TTGAAGGAGAAAGTAAAAGCTGG + Intronic
1117496223 14:56308197-56308219 TGGGAGGATCATGTAAGCTCAGG - Intergenic
1118432798 14:65738349-65738371 TTGGAGGCTTATGTAAACTCAGG + Intronic
1123816347 15:23983332-23983354 TTGGAGTAATAAGAAAACTCTGG - Intergenic
1128401710 15:67289295-67289317 TTGGAGTAGGAGGTAGACTCTGG + Intronic
1129460631 15:75698485-75698507 TTGGTGGCGGAAGTAAAATCGGG - Intronic
1130223174 15:82038562-82038584 TTGTTGGAGCAAGGTAACTCGGG - Intergenic
1131553882 15:93380132-93380154 TGGGAGGATCAATTAAGCTCAGG + Intergenic
1133232492 16:4373164-4373186 TGGGAGAAGAGAGTAAACTCAGG - Intronic
1133456527 16:5947121-5947143 TAGGAGGATCATGTGAACTCAGG + Intergenic
1133594380 16:7276619-7276641 TTGGAGGAGTGAGGAAATTCTGG - Intronic
1135532305 16:23265240-23265262 TGGGAGGAGCAATTGAACCCAGG - Intergenic
1137487187 16:48901427-48901449 TGGGAGCAGGAAGGAAACTCTGG + Intergenic
1138665601 16:58565203-58565225 TTGGAGGATCATCTGAACTCAGG - Intronic
1138788333 16:59872313-59872335 TTGGGTGAGCAAGAAAACTTTGG + Intergenic
1140439463 16:74975921-74975943 TGGGAGGATCACTTAAACTCAGG + Intronic
1152218864 17:79049921-79049943 CTGGAGGAGCGAGGCAACTCAGG - Intergenic
1156637819 18:39052076-39052098 TTGGATGAGCAGTTAAACTCTGG + Intergenic
1156676369 18:39531411-39531433 AGGGAAGAGGAAGTAAACTCAGG - Intergenic
1157568420 18:48696248-48696270 CTGGAGGTGAAAGTAAACTCTGG - Intronic
1159235871 18:65672144-65672166 TTGGAGGAGAAAAGACACTCTGG - Intergenic
1162119588 19:8455065-8455087 TGGGAGGATCACTTAAACTCGGG - Intronic
1162936021 19:13982004-13982026 TTGGAGGAGCAAGTGGGCTTGGG + Intronic
1163329938 19:16629547-16629569 TTGGAGGAGAAAAGAAACACGGG + Intronic
925608893 2:5686721-5686743 ATGCAGGAGGAAGTGAACTCAGG + Intergenic
925692532 2:6539675-6539697 TTGGAGTAGCATGCCAACTCTGG - Intergenic
926789592 2:16556776-16556798 ATGGAGGAGCAAGTAGAGACAGG + Intronic
929407589 2:41660432-41660454 TTTTAGGATAAAGTAAACTCTGG - Intergenic
931131383 2:59340290-59340312 TAGAAGCAGCAAGTAAACTTTGG + Intergenic
931263929 2:60643754-60643776 TTGGAGCTGGAAGTAAAGTCCGG - Intergenic
931462224 2:62458896-62458918 TTTGAGGAGAAACTAAATTCTGG + Intergenic
931901574 2:66795138-66795160 TAGGAGGACCAATTAGACTCTGG + Intergenic
933598740 2:84308498-84308520 TAGGAGGAGCAGTTAAGCTCTGG - Intergenic
939198305 2:139001458-139001480 TTGGAGGAGAAAGGAACCTGAGG - Intergenic
940791098 2:158031237-158031259 TTGGAGTAGGAAGTAAAGTGAGG + Intronic
940860622 2:158767055-158767077 TTGAAGTAGCAAGTAAAATTGGG - Intergenic
942813562 2:180024719-180024741 TTGGAGGAACATGCAAACTTGGG + Intergenic
945682627 2:212932454-212932476 TTGGAGTAGCAACAGAACTCAGG + Intergenic
946315133 2:218906450-218906472 TTGGAAGAGGAAGTAAACCATGG + Intergenic
1169306996 20:4500875-4500897 TTGGAGGAGAAGGGACACTCTGG + Intergenic
1175652147 20:60734701-60734723 TTTCAGGAGAAAGTTAACTCAGG + Intergenic
1178275573 21:31233801-31233823 TTGGAGAAGAAAGGAAGCTCTGG + Intronic
1180671024 22:17553206-17553228 TTTGATGAGCAGCTAAACTCAGG + Exonic
1181149802 22:20875109-20875131 TTGGAGCATCATGAAAACTCAGG + Intronic
950155613 3:10719409-10719431 TGGGAGGGGTAAGGAAACTCTGG + Intergenic
951743106 3:25945837-25945859 TTGGCCAAGCAATTAAACTCTGG - Intergenic
951833686 3:26958735-26958757 TTGGAGGAGAAGAGAAACTCTGG + Intergenic
952209547 3:31215592-31215614 ATGGAGGGGCAGGTAAATTCTGG + Intergenic
952732222 3:36650650-36650672 TTGGAGGATCACTTGAACTCAGG + Intergenic
954323640 3:49849235-49849257 TGGGAGGAGCACTTAAGCTCAGG - Intronic
954518124 3:51198201-51198223 TTGGAGAAGCAAATAGACCCAGG + Intronic
956787788 3:72656506-72656528 TTGGAGGAGGAAGTAAAGGTAGG + Intergenic
956925105 3:73978084-73978106 GTGGAAGAGCAATTACACTCTGG - Intergenic
958091915 3:88887088-88887110 GTGGAGAAACAAGTACACTCAGG - Intergenic
959258825 3:104049015-104049037 TTGGAGGAGAAAATGCACTCTGG - Intergenic
960107892 3:113817735-113817757 TGGGAGGATCACTTAAACTCAGG + Intergenic
960308024 3:116086325-116086347 TTGTACGATCAAGTAAACTTGGG + Exonic
960513392 3:118576858-118576880 TTGGAGGAAGAAGAAAACTAAGG + Intergenic
967825706 3:193875652-193875674 TTGTTGGATCAAGTTAACTCAGG + Intergenic
969082128 4:4627072-4627094 TTGGAGGAGAAAGGAGACTCAGG - Intergenic
969465358 4:7353211-7353233 TTGGAGGTGCCAGTAAGCACTGG + Intronic
969894645 4:10292143-10292165 GCTGAGGACCAAGTAAACTCGGG - Intergenic
970109720 4:12624255-12624277 TTGGAGCAAAAAGTAAGCTCAGG - Intergenic
970882136 4:20944765-20944787 TTGGAGGAGCCAGGAAGCTTTGG + Intronic
972560935 4:40228472-40228494 TTGGACCAGCAAGTAAAAGCAGG + Intronic
972854557 4:43091073-43091095 TTGGAGGAGTAAGTAAAAAAGGG + Intergenic
972926976 4:44021516-44021538 TTTGAGCAACAAGTAAATTCCGG - Intergenic
976632577 4:87253932-87253954 TAGGAGGATCACTTAAACTCAGG - Intergenic
978589974 4:110314382-110314404 TGGGAGGATCATGTAAACTCAGG + Intergenic
979267560 4:118720947-118720969 TTGGAGAAGCAAGTAGAGTGAGG - Intergenic
979638992 4:122989947-122989969 TGGGAGGATCAACTAAACTCAGG - Intronic
982588155 4:157269350-157269372 TTTGGGGAGCAAGAAAACACAGG - Intronic
985583752 5:715378-715400 TGGGAGGAGCACGTAGACTCAGG + Intronic
985597260 5:799675-799697 TGGGAGGAGCACGTAGACTCAGG + Intronic
988187744 5:27888934-27888956 TTGGAGGAGAAGGGACACTCTGG + Intergenic
988547432 5:32172050-32172072 TTGGATGAAAAAGTAAACTAGGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
994832945 5:104809754-104809776 TGGGAGGAACAAACAAACTCCGG - Intergenic
995245759 5:109933508-109933530 TAGGAAGAGAAAGTAAAATCTGG - Intergenic
996125177 5:119717974-119717996 TGGGAGGAGTTAGTAAACTAAGG - Intergenic
996789628 5:127278868-127278890 ATGGAAGAGCAAGTGAACTAAGG + Intergenic
997931352 5:138074663-138074685 CAGGAGGATCAATTAAACTCAGG + Intergenic
998549245 5:143061184-143061206 TTGGAAGAGAAAGAAAACTGAGG - Intronic
1001603776 5:172945909-172945931 TAGGAGGATCACGTGAACTCAGG - Intronic
1003858225 6:10297216-10297238 TTCGAGGACCAAGGAAACTGTGG + Intergenic
1003969028 6:11280616-11280638 GTGGAGAAGGAAGTAAAGTCTGG + Intronic
1009030988 6:58057821-58057843 TTGGAGGAGGAAGATAAATCAGG + Intergenic
1009206842 6:60812281-60812303 TTGGAGGAGGAAGATAAATCAGG + Intergenic
1010196056 6:73241246-73241268 TTTAAGGTGCAAGAAAACTCTGG + Intronic
1012960653 6:105618187-105618209 TTTGAGAAGAAAGAAAACTCTGG - Intergenic
1014598589 6:123378370-123378392 TTGGAGGATCAATTAAGCCCAGG - Intronic
1014678968 6:124404451-124404473 TTGGAGAAGGAAAGAAACTCAGG - Intronic
1014808448 6:125858259-125858281 TTGGAGTTTCAAGAAAACTCTGG + Intronic
1016085078 6:139903409-139903431 TTAGAGGATCAAGAAATCTCAGG + Intergenic
1019040270 6:169098134-169098156 TTGGAAGAGCATGCAAACTCTGG - Intergenic
1019874745 7:3799780-3799802 TTGGAGGAGCAAGTAAACTCAGG - Intronic
1021444019 7:20713461-20713483 TGGGAGGACCACGTGAACTCAGG - Intronic
1022554968 7:31284015-31284037 TGGGAGGGGCTAGGAAACTCTGG - Intergenic
1023383595 7:39632965-39632987 GTAGAGAAGCAAGAAAACTCAGG - Intronic
1024645395 7:51366720-51366742 TTGGAGGAGCAGATAAAATCAGG + Intergenic
1025870246 7:65424373-65424395 TTGGAGGAGGGAGAGAACTCTGG - Intergenic
1026652623 7:72228852-72228874 TGGGAGGATCATGTAAACCCAGG - Intronic
1031805831 7:126304985-126305007 TTGGAGGAGTAAAAAATCTCTGG - Intergenic
1031808291 7:126334249-126334271 GTGGAGCAGCGAGTAAAATCAGG - Intergenic
1031873665 7:127113947-127113969 TGGGAGGAGCATGAAAGCTCAGG - Intronic
1032464969 7:132138424-132138446 CTGGAGGGGAAAGTAAAGTCCGG - Intronic
1037272932 8:17149674-17149696 TTGGAAGAGCAGGTAATCACTGG - Intergenic
1038208906 8:25497032-25497054 TTTGGGGAGCTGGTAAACTCTGG + Intronic
1038283129 8:26183427-26183449 TTTGAGGAGTGAGAAAACTCTGG - Intergenic
1038951428 8:32419349-32419371 GTGGAGGAGCCAGTGATCTCTGG + Intronic
1039124751 8:34188833-34188855 TTTCAGGAGAAAGAAAACTCTGG - Intergenic
1039231593 8:35454615-35454637 TTGTAGGGACAAGTAAACTGTGG - Intronic
1039851166 8:41366432-41366454 TTGGGGGAGCTGGCAAACTCTGG + Intergenic
1039888014 8:41666371-41666393 GTGGAGGAGTAAGTAAACGGAGG + Intronic
1041794109 8:61728419-61728441 TTTGATGAACAAGTAAACTGAGG + Intergenic
1041981924 8:63872277-63872299 TTTAAGGAGCAAGAAAATTCTGG - Intergenic
1046366305 8:113236948-113236970 TAGGAGGTGCAAGTATATTCTGG - Intronic
1046485219 8:114878827-114878849 CTGGAGGAGAAAGGAAAATCTGG - Intergenic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1046878380 8:119280480-119280502 TTCTAGAAGTAAGTAAACTCTGG - Intergenic
1050158204 9:2690342-2690364 GTGGAGGAGCAATTGAAATCTGG + Intergenic
1052171745 9:25406997-25407019 TGGGAGGAGCACGTGAGCTCAGG + Intergenic
1053579695 9:39391669-39391691 TTGCAGGAGAGAGAAAACTCAGG + Intergenic
1053844213 9:42219749-42219771 TTGCAGGAGAGAGAAAACTCAGG + Intergenic
1054101282 9:60950478-60950500 TTGCAGGAGAGAGAAAACTCAGG + Intergenic
1054585069 9:66956403-66956425 TTGCAGGAGAGAGAAAACTCAGG - Intergenic
1057812822 9:98270834-98270856 TTGGAGAAGAAAGTAAAAACAGG + Intergenic
1058392642 9:104513302-104513324 TTGGACTAGTAAGTAAACTGTGG + Intergenic
1061592056 9:131603946-131603968 CTCGAGGAGTAAGTAACCTCGGG - Intronic
1185446693 X:261567-261589 TTTGAGGAATAAGGAAACTCCGG - Intergenic
1187697257 X:21934825-21934847 TGGGAGGATCAATTGAACTCAGG + Intergenic
1187798419 X:23030955-23030977 TTTGAGGAGCAAGTTACCTGGGG - Intergenic
1188180068 X:27044510-27044532 ATGGAGAATCAAGTAAGCTCTGG + Intergenic
1191717423 X:64203460-64203482 TTGGAGGAGTAAATAAAACCTGG - Intronic
1193301430 X:79892811-79892833 TTGGAGGAGAGAGGATACTCTGG - Intergenic
1193365050 X:80622473-80622495 TTGGAGGAGAAAAGACACTCTGG + Intergenic
1196673490 X:118394274-118394296 TTGGAGGACAAAGAAAAATCTGG - Intronic
1197093092 X:122561649-122561671 TTGGAGGAGCAATGAAATTAAGG + Intergenic
1199255074 X:145710202-145710224 ATGGAGAATCAAGTAAACCCTGG + Intergenic
1201268567 Y:12232192-12232214 TGGGAGGATCAATTAAACCCAGG + Intergenic
1201979791 Y:19893945-19893967 TTGGAGGAGAAGATGAACTCTGG - Intergenic
1202339807 Y:23851762-23851784 TTTGAAGAGCAAGAAAATTCTGG - Intergenic
1202530959 Y:25818320-25818342 TTTGAAGAGCAAGAAAATTCTGG + Intergenic