ID: 1019877715

View in Genome Browser
Species Human (GRCh38)
Location 7:3829564-3829586
Sequence AGAAACGAGGGTTTTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019877715_1019877726 15 Left 1019877715 7:3829564-3829586 CCCCTCCCAAAACCCTCGTTTCT 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1019877726 7:3829602-3829624 CAACATATACCATGGAGGCTGGG 0: 1
1: 0
2: 2
3: 9
4: 149
1019877715_1019877725 14 Left 1019877715 7:3829564-3829586 CCCCTCCCAAAACCCTCGTTTCT 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1019877725 7:3829601-3829623 ACAACATATACCATGGAGGCTGG No data
1019877715_1019877728 28 Left 1019877715 7:3829564-3829586 CCCCTCCCAAAACCCTCGTTTCT 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1019877728 7:3829615-3829637 GGAGGCTGGGTGTGCTCTTGAGG 0: 1
1: 0
2: 7
3: 42
4: 377
1019877715_1019877724 10 Left 1019877715 7:3829564-3829586 CCCCTCCCAAAACCCTCGTTTCT 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1019877724 7:3829597-3829619 CAGAACAACATATACCATGGAGG No data
1019877715_1019877723 7 Left 1019877715 7:3829564-3829586 CCCCTCCCAAAACCCTCGTTTCT 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1019877723 7:3829594-3829616 AAGCAGAACAACATATACCATGG 0: 1
1: 1
2: 3
3: 54
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019877715 Original CRISPR AGAAACGAGGGTTTTGGGAG GGG (reversed) Intronic