ID: 1019883316

View in Genome Browser
Species Human (GRCh38)
Location 7:3882400-3882422
Sequence AAAGAGGGGCCTCCCGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019883316 Original CRISPR AAAGAGGGGCCTCCCGCATC AGG (reversed) Intronic
900284550 1:1892804-1892826 AATGAGGGGCCTCCTGCTTTGGG + Intergenic
905386104 1:37605464-37605486 AAAGAGGTGGCTCCAGCTTCAGG + Intergenic
907111551 1:51931126-51931148 AAAGAGGGGACTCACGCCACTGG - Intronic
912954333 1:114143868-114143890 AAAGAGGGGCATCCCTCATAGGG - Intronic
914902301 1:151717148-151717170 AAAGAGGGGAGCCCGGCATCTGG + Intronic
915225509 1:154408260-154408282 AATGAAGGCCCTCCCGCTTCGGG + Intronic
1064341757 10:14492091-14492113 AAAGAGAGGCCTCTAGGATCAGG + Intergenic
1078342048 11:10504638-10504660 GCAGAGCGGCCTCTCGCATCAGG + Exonic
1082988035 11:59184797-59184819 AGGCAGGGGCCTCCCTCATCAGG - Intronic
1084191588 11:67501831-67501853 TAAGTGGGACCTCCCGCAGCTGG + Intronic
1084608387 11:70185692-70185714 AAAGAGGGACCCACCGCACCTGG - Exonic
1089356998 11:117860406-117860428 AATGCAGGGGCTCCCGCATCTGG + Intronic
1092406337 12:8224322-8224344 AAAGAGGGGACACCGGCATGGGG + Intronic
1095573662 12:43710288-43710310 AAAGGGGGGCCTCACGACTCTGG + Intergenic
1103443800 12:120981116-120981138 AAAGTGGGGCCTCCAGCGTCAGG + Intronic
1106692337 13:32131598-32131620 TAATGGGGGCCTCCAGCATCTGG - Intronic
1106881481 13:34136426-34136448 AAAGAGCAGCTTCCTGCATCAGG + Intergenic
1113617294 13:111689764-111689786 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1113622823 13:111775034-111775056 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1113789069 13:113017760-113017782 AATGAGGGGCCTCACCCAGCTGG - Intronic
1113887602 13:113669160-113669182 AGAAAGGGGCCTCCGACATCAGG + Intronic
1116340958 14:43722615-43722637 AAAGATGGGCCTCTCACATGGGG + Intergenic
1122504179 14:102221198-102221220 GGAGAGGGGCCACCCTCATCTGG - Intronic
1135610847 16:23865845-23865867 AGAGAGAGGCCTCCCTCTTCTGG - Intronic
1142283340 16:89160682-89160704 AAGGAGAGGCCTCCCGAAGCCGG + Intergenic
1143427659 17:6853070-6853092 AAAGAGGGGCCTCCCACTTTGGG + Intergenic
1143522845 17:7455343-7455365 AGTGAGGGGGCTCCGGCATCAGG - Exonic
1143895681 17:10134626-10134648 AAAGTGGGGCCTACCCCATAAGG + Intronic
1148238351 17:45983807-45983829 AAAGAGGGGCCCCGGGCCTCTGG - Exonic
1151343105 17:73484496-73484518 CAAGTAGGGCCTCTCGCATCAGG - Intronic
1151417023 17:73973241-73973263 GCAGAGGGGCCTCCTGCATTAGG + Intergenic
1151593762 17:75064206-75064228 AAAGAGGGTGCTGCCGCATCCGG - Exonic
1151950962 17:77353630-77353652 CTAGAGGGGCCTCCAGCATCAGG + Intronic
1159723179 18:71919295-71919317 AGAGAGTGGCCCCCTGCATCGGG - Intergenic
1160420664 18:78741828-78741850 AAGGAAGGGGCTCCCGCCTCTGG + Intergenic
1160904866 19:1447249-1447271 AAACAGGGGCGGCCCCCATCGGG - Intronic
1166268388 19:41699224-41699246 AAAGAGGGACCTCCGTCACCCGG + Intronic
1167463107 19:49636600-49636622 AAAGAGGGGTGTCCCGAACCTGG + Exonic
926170699 2:10550907-10550929 AAAGAGGGACATCCAGCACCAGG + Intergenic
931429100 2:62195761-62195783 CAAGAGGGGCCACCCACAACTGG + Intergenic
931790993 2:65664133-65664155 AAGTAGAGGCCTCCAGCATCAGG - Intergenic
940995418 2:160144323-160144345 AAAGGGGGTCCTCCATCATCAGG - Intronic
942146500 2:173032248-173032270 TAAGAGGTGCTTCCAGCATCTGG - Intronic
948738182 2:240024940-240024962 GCACACGGGCCTCCCGCATCAGG + Intronic
1172187744 20:33041845-33041867 GTAGAGGGGACTCCTGCATCAGG + Intronic
1172324164 20:34021378-34021400 ATCAAGGGGCCGCCCGCATCTGG + Intronic
1175812637 20:61866937-61866959 AAAGAGGGGCCTCCCAAAGAGGG + Intronic
1176140813 20:63544264-63544286 AACCAGGGGCCTTCCTCATCCGG - Exonic
1178991274 21:37358558-37358580 AAAGAGGGACCATCTGCATCCGG - Intergenic
1179371495 21:40810049-40810071 ACAGAGGGGCCTGCTGCCTCTGG - Intronic
1181260050 22:21591148-21591170 AAAGAGGGGCCTCATGCAGGTGG + Intronic
1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG + Intronic
1184257819 22:43297043-43297065 AAAGAGGGGCCTCACTGGTCAGG + Intronic
1184984227 22:48118528-48118550 AAAGAGGGGGCTCCAGGGTCAGG + Intergenic
954441438 3:50524438-50524460 AAAGAGTGGCCTGCCCAATCCGG - Intergenic
954753491 3:52826721-52826743 AAAGAGGGGCCGCCCTCAGCAGG + Intronic
954783560 3:53077394-53077416 AAAGATGAGCCTCCAGCATAAGG + Intronic
959338474 3:105097047-105097069 AAAGAGGGTTCTCAAGCATCTGG + Intergenic
960899117 3:122536690-122536712 AAAGACGGGCTTCCTGGATCTGG + Intronic
966909558 3:184551422-184551444 ACAGAGGGCCCTCTCCCATCAGG + Intronic
968276728 3:197445969-197445991 ACAGCGGGGCCTCCCTCAGCAGG + Intergenic
969759791 4:9173661-9173683 AAAGAGGGGACACCGGCATGGGG - Intronic
973247534 4:48025288-48025310 AAAGAAGGGCCTCTTGCAACTGG + Exonic
982031314 4:151303835-151303857 AAAGAGGAGCCTCACTCAGCTGG - Intronic
982647049 4:158037309-158037331 GAAGAGGGTCCTCCAGCACCAGG - Intergenic
985985860 5:3515715-3515737 CTAGAGGGGCCTCCTGCATTTGG - Intergenic
998347373 5:141476600-141476622 AAAGAGTTGCTTCCCACATCGGG - Exonic
999705865 5:154272100-154272122 ACAGAGGGGCCGCCTGCACCAGG - Intronic
999855923 5:155593803-155593825 AAAGAGGTGCCTGCATCATCTGG + Intergenic
999936110 5:156486956-156486978 ACAGAGGGTCCTCAAGCATCTGG - Intronic
1007729926 6:43939573-43939595 AGAGAGGGGCCACAGGCATCAGG - Intergenic
1019065317 6:169291389-169291411 AAAGAGGGGCTTCCAACACCTGG + Intergenic
1019883316 7:3882400-3882422 AAAGAGGGGCCTCCCGCATCAGG - Intronic
1029393087 7:100288442-100288464 AGAGAGGAGCCTCCCACTTCAGG + Intergenic
1030109575 7:106015324-106015346 AAAGAGGGGGTCCCCGCATGAGG - Intronic
1030175628 7:106650250-106650272 ATAAAGGGCCCTCCAGCATCAGG + Intergenic
1036263386 8:7257392-7257414 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036264689 8:7265014-7265036 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036265988 8:7272636-7272658 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036267290 8:7280258-7280280 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036268593 8:7287880-7287902 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036269897 8:7295502-7295524 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036301911 8:7574495-7574517 AAAGAGGGGACACCGGCATGGGG + Intergenic
1036303208 8:7582144-7582166 AAAGAGGGGACACCGGCATGGGG + Intergenic
1036315430 8:7715931-7715953 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036316738 8:7723579-7723601 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036318045 8:7731227-7731249 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036319352 8:7738875-7738897 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036320661 8:7746522-7746544 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036321971 8:7754170-7754192 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036323280 8:7761818-7761840 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036324575 8:7769465-7769487 AAAGAGGGGACACCGGCATGGGG - Intergenic
1036351459 8:8014842-8014864 AAAGAGGGGACACCGGCATGGGG + Intergenic
1036352765 8:8022488-8022510 AAAGAGGGGACACCGGCATGGGG + Intergenic
1036354056 8:8030136-8030158 AAAGAGGGGACACCGGCATGGGG + Intergenic
1036846715 8:12175261-12175283 AAAGAGGGGACACCAGCATGGGG + Intergenic
1036868081 8:12417580-12417602 AAAGAGGGGACACCAGCATGGGG + Intergenic
1037553942 8:20004225-20004247 AAAGAGGAGCCACCCACTTCAGG - Intergenic
1049337057 8:142092201-142092223 GAGCAGGGGCCTCCCTCATCAGG - Intergenic
1052991732 9:34522753-34522775 TAAGAAGGGCCTCCCGCCACGGG - Intronic
1188465770 X:30479171-30479193 TAAGAGGGCCCTCCCATATCAGG - Intergenic
1192554878 X:72081478-72081500 AAGGAGGGGCCACCCTCACCTGG + Intergenic
1196840147 X:119852549-119852571 AAAGAGGGGACTCCCCAAACGGG - Intronic
1197286708 X:124603579-124603601 AAAGTGTGGGCTCCAGCATCAGG - Intronic
1199399088 X:147376285-147376307 AAAGAGGTCACTCCCTCATCAGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic