ID: 1019886147

View in Genome Browser
Species Human (GRCh38)
Location 7:3907718-3907740
Sequence CCGCAACAGCAGAGGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019886142_1019886147 8 Left 1019886142 7:3907687-3907709 CCAAAATGAAATAAATCACAAAG 0: 1
1: 0
2: 7
3: 133
4: 1092
Right 1019886147 7:3907718-3907740 CCGCAACAGCAGAGGTGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019886147 Original CRISPR CCGCAACAGCAGAGGTGGTG AGG Intronic
903443054 1:23402594-23402616 CAGCCTCAGCTGAGGTGGTGAGG - Intronic
903544692 1:24116639-24116661 CAGCACCAGCAGGGGAGGTGGGG + Intergenic
903853230 1:26320723-26320745 ACGCAACTGCAGGGTTGGTGAGG - Intergenic
904698243 1:32342615-32342637 GCGGAATAGGAGAGGTGGTGGGG - Intergenic
906598762 1:47105199-47105221 CAGCCACAGCAGCTGTGGTGGGG + Intronic
907412288 1:54291276-54291298 CTGTCACAGCAGAGGAGGTGAGG - Intronic
908311693 1:62890581-62890603 CCGAAACAACAGAGGTTGAGGGG - Intergenic
909982978 1:82126453-82126475 CAGCAACACCACAGGTGATGTGG - Intergenic
914504981 1:148281099-148281121 CCACAGAAGCAGAGGAGGTGCGG + Intergenic
914507583 1:148303049-148303071 CCACAGAAGCAGAGGAGGTGCGG - Intergenic
915354901 1:155250319-155250341 TGGCAGCAGCAGCGGTGGTGGGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916414101 1:164576659-164576681 CCGGGACAGAAGAGGTGGCGGGG - Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
922239620 1:223747190-223747212 CAGCAAGAGCAGATGGGGTGAGG - Intronic
1063243516 10:4194888-4194910 CTCCAACAGCACAGGTGGGGAGG + Intergenic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1071894859 10:90055138-90055160 CAGAAAGAGCATAGGTGGTGAGG - Intergenic
1072438133 10:95431947-95431969 CTGGAAAAGCAGAGGTGGGGAGG - Intronic
1076942848 10:133621342-133621364 CTGCCACAGGACAGGTGGTGGGG - Intergenic
1077979017 11:7279895-7279917 CTGCAAAAGCAGAGCTGATGAGG + Intronic
1080994814 11:37586741-37586763 CAGCAAAAGAAGAGGTGGTGGGG - Intergenic
1083622033 11:64053908-64053930 CCGGGCCAGCAGAGGTGGTGGGG - Intronic
1084972601 11:72780112-72780134 CAGCAACATCAGATGTGTTGGGG + Intronic
1087348428 11:97000667-97000689 GCGCCCCAGCAGGGGTGGTGTGG + Intergenic
1091214482 11:133892297-133892319 CAGCCACAGCAGAGGCGGAGAGG - Intergenic
1091284873 11:134402997-134403019 CCTACACAGCAGAGGAGGTGTGG + Intronic
1092579229 12:9820760-9820782 CTGCAACTGCAGTGGTGGAGGGG - Intergenic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1097140617 12:56899970-56899992 CAGGAGCAGCAGTGGTGGTGGGG + Intergenic
1097141699 12:56908132-56908154 TAGCAGCAGCAGTGGTGGTGAGG + Intergenic
1098064917 12:66603579-66603601 CAGCAACTGCACAGGTAGTGAGG + Intronic
1101854764 12:108432957-108432979 GGGCAACAGCAGAGGAGGTAGGG + Intergenic
1102636774 12:114331486-114331508 CTGGGAGAGCAGAGGTGGTGAGG - Intergenic
1104908449 12:132228081-132228103 CCGCCCCAGCAGGGGTGGCGGGG + Intronic
1113835791 13:113327814-113327836 CCCCAACCCCACAGGTGGTGTGG + Intronic
1113913322 13:113855004-113855026 CCGCAACAGCTGCCGTGGAGAGG + Intronic
1114675639 14:24438522-24438544 CAGTAACAGCAGAGTTGGTCTGG - Exonic
1115398280 14:32933456-32933478 CCGCACCAGCAAAGGGGGCGAGG + Intergenic
1116069438 14:40025402-40025424 GGGCAACAGGAGAGGTGGGGTGG + Intergenic
1123006488 14:105326290-105326312 CCGCAGCAGCAGTGGAGTTGAGG + Intronic
1124251879 15:28112281-28112303 CCGCATCCACACAGGTGGTGTGG - Intronic
1126414836 15:48406690-48406712 CCTCCATAGCAGAGCTGGTGGGG + Intergenic
1127263929 15:57346265-57346287 CAGCCACATCAGAGGTGGTGGGG - Intergenic
1131187501 15:90287365-90287387 GCCCAACAGCAGTGGTGGAGAGG - Intronic
1132233244 15:100200374-100200396 CAGCCACAGCAGGGGTGGGGAGG + Intronic
1132845501 16:1999242-1999264 CCACACCAGCAGCAGTGGTGTGG - Intronic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1135994470 16:27237798-27237820 ACGCCAAACCAGAGGTGGTGTGG - Intronic
1135994516 16:27238121-27238143 CAGCAGCAACAGAGGTGGCGTGG + Intronic
1136599090 16:31272097-31272119 CCCCACCGGCAGAGGTGGGGAGG + Intronic
1137760807 16:50938918-50938940 TGGCATCAGCAGAGGTGGGGAGG + Intergenic
1138121784 16:54406014-54406036 CCCCAACCACAGAGGTGGTGAGG + Intergenic
1139878221 16:70163506-70163528 CTGCCACAGCAGCAGTGGTGGGG - Intergenic
1140359342 16:74331306-74331328 CTGCCACAGCAGCAGTGGTGGGG + Intergenic
1141181352 16:81755049-81755071 CCACAATAGCAGAGGAAGTGAGG - Intronic
1142905688 17:3040202-3040224 CAGTAACAGCAGAGGTGGATGGG + Intergenic
1143421192 17:6793915-6793937 CTGCAACAGCAGAGAGTGTGGGG - Intronic
1144707600 17:17379918-17379940 CCGCAGCAGGTGAGGTGGAGGGG + Intergenic
1145694324 17:26774952-26774974 CCGCAAAAGCAGCGGCGGCGGGG - Intergenic
1147898716 17:43769581-43769603 CCTCTCGAGCAGAGGTGGTGGGG + Exonic
1148224187 17:45886918-45886940 CCAAAACAACAGAGGTGGTTTGG - Intergenic
1148674595 17:49438182-49438204 TCGAAACAGAAGAGGTGGAGGGG - Intronic
1148830437 17:50427193-50427215 CAGCAACATCAGATGGGGTGTGG + Intronic
1150291873 17:63987100-63987122 CAGGGACAGTAGAGGTGGTGGGG - Intergenic
1150446569 17:65231185-65231207 CCGGAAAAGCAGAGGTAGGGTGG + Intergenic
1150653871 17:67027094-67027116 CCGCAGGAGCAGGGATGGTGGGG - Intronic
1151705263 17:75764005-75764027 CGGCACCCTCAGAGGTGGTGAGG + Exonic
1151934838 17:77255322-77255344 CCCCAGCAGCAGAGGTGGAGTGG - Intergenic
1151947398 17:77327196-77327218 CCACTACAGGAGGGGTGGTGGGG - Intronic
1152215564 17:79029810-79029832 CAGGAACAGCACAGGTGGTAGGG - Intronic
1154452502 18:14488979-14489001 CCCCAACAGCCGAGTTTGTGGGG + Intergenic
1154463491 18:14619774-14619796 ACGCAGCAGTAGGGGTGGTGAGG + Intergenic
1155084912 18:22448600-22448622 ATGCAACAGCAGGGATGGTGGGG + Intergenic
1155491642 18:26406448-26406470 CGGAAACAGGAGAGGTGGGGTGG - Intergenic
1156962532 18:43050468-43050490 CTCCAGCAGTAGAGGTGGTGTGG + Intronic
1157296741 18:46450466-46450488 ACTCACCAGCAGAGGTGGGGAGG - Intronic
1159060895 18:63512772-63512794 CAGCTTCAGCAGTGGTGGTGGGG + Intergenic
1161404371 19:4083400-4083422 CCGCTGCCGCAGAGGTTGTGTGG + Intergenic
1163176425 19:15566867-15566889 CAGCACCAGCAGACGTGCTGAGG - Intergenic
1163298662 19:16429528-16429550 GCGCAGCAGCAGAGGTGGAGAGG - Intronic
1163670862 19:18627682-18627704 CCGCCAGAGCAGAGGGAGTGAGG - Intergenic
1163790598 19:19303920-19303942 CCACAACGACAGAGGGGGTGGGG + Intronic
1164982745 19:32626565-32626587 CTGCTGCAGCAGAGCTGGTGTGG + Intronic
1167389261 19:49183051-49183073 CAGCAAAAGGAGGGGTGGTGAGG - Intronic
1167516155 19:49924349-49924371 CAGCAAGAGTAGGGGTGGTGTGG - Intronic
1168508096 19:56953145-56953167 CCTCAACAGAAGAGGAAGTGTGG - Intergenic
925741269 2:7007850-7007872 CTGCAAGAGAAGCGGTGGTGTGG - Intronic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
926698295 2:15785616-15785638 CCTAAACAGCAGAGGAGATGGGG - Intergenic
931249514 2:60517441-60517463 CTGCAACAGCACAGGTGATTGGG + Intronic
933858533 2:86441757-86441779 ACGCAACCGCAGAGGGAGTGAGG - Intronic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
934556077 2:95287638-95287660 GCGCTGCAGCAGAGGTGGGGTGG - Intronic
934923866 2:98367666-98367688 CCCCAACAGCTGGGGTGATGGGG - Intronic
938763731 2:134446683-134446705 CATCAAGAGCAGGGGTGGTGGGG + Intronic
939825546 2:147011168-147011190 TCACACCAGCAGATGTGGTGGGG + Intergenic
941063821 2:160878426-160878448 CCGAAGAAGCAGAGGAGGTGGGG - Intergenic
941404111 2:165068202-165068224 CCGAAACAGCAGGGCTGGTTGGG - Intergenic
942033073 2:171982426-171982448 CAGCAGCAGCAGAGATGGAGAGG - Intronic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
943872096 2:193012395-193012417 CCTGAGCAGCAAAGGTGGTGTGG - Intergenic
944310774 2:198231671-198231693 CAGCAACAGCAGAGTGGGAGGGG - Intronic
1169851386 20:10055518-10055540 CCACAACAGCAGAGCTGATCAGG + Exonic
1170208717 20:13826797-13826819 CTGCAACAGAAGTGGTGGGGAGG - Intergenic
1171866089 20:30488401-30488423 CCGCGACAGTGGCGGTGGTGGGG - Intergenic
1172223043 20:33286734-33286756 CCACAACATCAGAAGTGCTGAGG - Intronic
1174796250 20:53525006-53525028 CCACAACAGCAGAGGTGCTCTGG + Intergenic
1176359428 21:5982662-5982684 TGGCAACAGCAGTTGTGGTGTGG + Intergenic
1176443525 21:6799313-6799335 CCCCAACAGCCGAGTTTGTGGGG - Intergenic
1176555520 21:8252683-8252705 CCGCGACTGCGGCGGTGGTGGGG + Intergenic
1176821694 21:13664356-13664378 CCCCAACAGCCGAGTTTGTGGGG - Intergenic
1179174914 21:39001181-39001203 CAGCAGCAGCAGAGATGGGGTGG - Intergenic
1179764090 21:43555888-43555910 TGGCAACAGCAGTTGTGGTGTGG - Intronic
1180582337 22:16851191-16851213 CCACAACATCAGAGGTAGAGTGG - Intergenic
1181558250 22:23684472-23684494 CTGCTACAGCAGAGCTGTTGGGG + Intergenic
1182116279 22:27758268-27758290 CCGCAGCAGCAAAGGTGTGGAGG - Intronic
1182394585 22:30026244-30026266 CCGCCACATCAGAGCTGGTTGGG + Exonic
1184840187 22:47048093-47048115 CAGCAACAGCAGTGGAGCTGGGG - Intronic
1185280024 22:49966063-49966085 CCAAAGCAGCAGAGGTGGGGTGG - Intergenic
949169288 3:979405-979427 CAGCACCAACAGAGATGGTGCGG + Intergenic
950075672 3:10185170-10185192 CCGAATCAGCAGATGAGGTGGGG - Intronic
955930200 3:64048608-64048630 AGGCAACAGCAGTTGTGGTGAGG + Intergenic
959933416 3:112006215-112006237 CCCCAACAGCAGAGTTTCTGAGG + Intronic
961262334 3:125612108-125612130 CAACAGCAGCAGTGGTGGTGGGG + Intergenic
963049534 3:141129194-141129216 CCTCCACAGCAGAGGTGGGCAGG - Intronic
966152271 3:176877681-176877703 CTGCAACTGCAGAGATGGAGGGG - Intergenic
966203021 3:177377218-177377240 AAGCAACTGCAGAGGTGGTGTGG + Intergenic
966223853 3:177577329-177577351 CTGGAGCAGCAGAGGTGGTGTGG - Intergenic
966964910 3:184981371-184981393 GCACACCAGCAGAGGTGGGGTGG + Intronic
968027080 3:195451497-195451519 AGGCAAAAGCAGAGTTGGTGAGG + Intergenic
968916153 4:3497849-3497871 CCACCAGACCAGAGGTGGTGGGG + Intronic
969184311 4:5464094-5464116 CAGGAACAGCAGTGGGGGTGGGG + Intronic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
980784018 4:137529601-137529623 CCTCAACAGCAGGAGTGGCGTGG + Exonic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
990440802 5:55843036-55843058 CCTGAACAGAAGGGGTGGTGGGG - Intergenic
991498675 5:67253499-67253521 CCACAACAGCAGAGGAGGCTGGG - Intergenic
992743331 5:79795496-79795518 CTGAAACTGCAGAGGAGGTGCGG - Intronic
993225736 5:85165820-85165842 CTGCAACTGCAGTGGTGGAGGGG + Intergenic
995393930 5:111667321-111667343 CAGCAAGAGCTGAGCTGGTGAGG + Intronic
997382861 5:133449895-133449917 CCCCAAGAGCAGAGGTCCTGGGG - Intronic
997574789 5:134966352-134966374 CAGGGACAGCAGAGATGGTGGGG + Exonic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1003285793 6:4732876-4732898 CAGGGACAACAGAGGTGGTGAGG + Intronic
1003887494 6:10534550-10534572 CCGCAGCCTGAGAGGTGGTGTGG - Intronic
1004258827 6:14089819-14089841 CCGCAAGGGTGGAGGTGGTGGGG + Intergenic
1007293436 6:40803725-40803747 CAGCCACAACAGAGGTTGTGAGG + Intergenic
1007474067 6:42107378-42107400 CAGCAGCAGGGGAGGTGGTGGGG + Exonic
1009598882 6:65772149-65772171 TCGCATCAGTAGTGGTGGTGAGG - Intergenic
1010155177 6:72784233-72784255 CCTGAACAGCAGTGGTGGTTTGG - Intronic
1011242298 6:85285983-85286005 CCTCAACAGCTGAGTTGGGGAGG - Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1017453317 6:154574990-154575012 GAGCAACAGCACAGGTGGAGTGG + Intergenic
1017540639 6:155398988-155399010 GCTGAACAGAAGAGGTGGTGCGG + Intronic
1019886147 7:3907718-3907740 CCGCAACAGCAGAGGTGGTGAGG + Intronic
1020982700 7:15091512-15091534 CCGCAATAAGAGAGGTGGTGGGG - Intergenic
1022001506 7:26230471-26230493 CCACAAGGGAAGAGGTGGTGGGG - Intergenic
1024626354 7:51211187-51211209 CTGCTCCATCAGAGGTGGTGAGG - Intronic
1029433396 7:100547171-100547193 AAGCAAAAGCAGCGGTGGTGGGG - Intronic
1030177025 7:106665118-106665140 CCACCCTAGCAGAGGTGGTGGGG - Intergenic
1030414452 7:109224269-109224291 CCTCCACAGCAGAGCAGGTGTGG - Intergenic
1030438847 7:109559686-109559708 CCAAGACAGCAGAGGTGGTTTGG + Intergenic
1032958960 7:137007476-137007498 CTACAACAGCAGTTGTGGTGGGG - Intronic
1037821159 8:22135303-22135325 GTGCAAGAACAGAGGTGGTGTGG + Intergenic
1041611185 8:59851258-59851280 CCCCACCAGCAAAGGTGGAGTGG - Intergenic
1042325725 8:67525865-67525887 CCGCAAAAGCAGAGGGGTGGTGG + Intronic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1045344295 8:101280734-101280756 CTGCGATGGCAGAGGTGGTGGGG + Intergenic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1049336558 8:142089718-142089740 CCATCACAGCAGAGGAGGTGGGG + Intergenic
1049589002 8:143447120-143447142 CTGAATCAGCACAGGTGGTGAGG - Intronic
1057694419 9:97313208-97313230 GAGCAACAACAGAGGTGATGAGG - Intronic
1059868667 9:118546106-118546128 TTGCACCAGCAGTGGTGGTGTGG - Intergenic
1060004969 9:119991897-119991919 AGGCACCAGCAGTGGTGGTGAGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060921126 9:127421259-127421281 CCGCAAGTGCAAAGGTTGTGTGG + Intergenic
1060987197 9:127826549-127826571 GCTCAGCAGCAGAGGTGATGGGG + Exonic
1062197575 9:135282786-135282808 CAGGAACAGCACAGGTGGTCAGG + Intergenic
1203525675 Un_GL000213v1:85214-85236 CCCCAACAGCCGAGTTTGTGGGG + Intergenic
1187276810 X:17823549-17823571 GGTCAAGAGCAGAGGTGGTGGGG + Intronic
1191085476 X:56563515-56563537 CCGCGTCAGCAGAGGGGGCGGGG + Intergenic
1192055537 X:67769488-67769510 CTGCAACTGCAGTGGTGGAGTGG - Intergenic
1197674229 X:129312554-129312576 GCTCATCAGGAGAGGTGGTGGGG + Intergenic
1199419291 X:147625473-147625495 CCAAAACAGTAGAGGAGGTGTGG + Intergenic