ID: 1019887987

View in Genome Browser
Species Human (GRCh38)
Location 7:3922008-3922030
Sequence CCTGTTACTCAGGAGCCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019887980_1019887987 -9 Left 1019887980 7:3921994-3922016 CCTGGATTCCAGCCCCTGTTACT 0: 1
1: 0
2: 0
3: 12
4: 278
Right 1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 210
1019887979_1019887987 -8 Left 1019887979 7:3921993-3922015 CCCTGGATTCCAGCCCCTGTTAC 0: 1
1: 0
2: 2
3: 86
4: 373
Right 1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 210
1019887976_1019887987 27 Left 1019887976 7:3921958-3921980 CCTGTCTCCAAAATAAGTAAATA 0: 3
1: 67
2: 989
3: 1757
4: 5604
Right 1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 210
1019887977_1019887987 20 Left 1019887977 7:3921965-3921987 CCAAAATAAGTAAATAAGCAATG 0: 1
1: 0
2: 2
3: 50
4: 640
Right 1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 210
1019887975_1019887987 28 Left 1019887975 7:3921957-3921979 CCCTGTCTCCAAAATAAGTAAAT 0: 3
1: 74
2: 1020
3: 1927
4: 7067
Right 1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019887987 Original CRISPR CCTGTTACTCAGGAGCCGCA GGG Intronic
900150692 1:1178074-1178096 CCTGTCACTCAGGCGGGGCAGGG + Intronic
901432337 1:9224622-9224644 CCTGTGACCCAGGAGCCCAAAGG + Intergenic
904104103 1:28062885-28062907 CCTGCTACTCAGGAGGCTGAGGG + Intronic
904340022 1:29828506-29828528 CCTGTTACTCAGGCTCCACCCGG + Intergenic
905891130 1:41519090-41519112 CCAGGGACTCAGGAGCCACAAGG + Intronic
909004801 1:70263593-70263615 CATTTTACTCATGAGCCTCAGGG + Intronic
911330780 1:96523422-96523444 CCAGCTACTCAGGAGACTCAAGG - Intergenic
912409772 1:109472724-109472746 CCAGTTACTCAGGAGGCTGATGG - Intronic
913584813 1:120263953-120263975 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
913623370 1:120634406-120634428 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
914566811 1:148875809-148875831 CCAGTTACTCAGGAGGCTGAGGG + Intronic
914606009 1:149254432-149254454 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
915180957 1:154059221-154059243 CCAGTTACTCAGGAGGCTGAGGG + Intronic
917103442 1:171468804-171468826 CCAGCTACTCAGGAGCCTGAGGG + Intergenic
921484124 1:215696440-215696462 TCTGTCACTCAGGGGCTGCATGG + Intronic
922914721 1:229247536-229247558 CCTGCTACTCAGGAGGCTGAGGG + Intergenic
924158507 1:241206337-241206359 CCAGCTACTCAGGAGACGGAGGG - Intronic
1063129672 10:3167533-3167555 TCTGTTACTTAGGTGCAGCATGG - Intronic
1063304704 10:4886497-4886519 CCAGCTACTCAGGAGCCTGAGGG + Intergenic
1065485320 10:26231260-26231282 AATGTCACTCAGGAGACGCAGGG + Intronic
1065882702 10:30050198-30050220 CCAGTTACTCAAGAGCCTGAAGG + Intronic
1068585217 10:58790708-58790730 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1070288190 10:75098863-75098885 CTTGCTACTCATGAGCCGTATGG - Intronic
1071589330 10:86857296-86857318 TTTGTTACTCACGAGCCTCATGG - Intronic
1076437442 10:130455677-130455699 CTTGGCACTCAGGAGCCCCATGG - Intergenic
1076623163 10:131806011-131806033 CCTGTTGCTCAGGAACTGCTGGG - Intergenic
1077063843 11:629743-629765 ATTGTTACTCAGGAGCTGAAGGG - Intergenic
1077245670 11:1536282-1536304 CCCGTTCCTCAGGAGCGGCTAGG + Intergenic
1077554051 11:3217597-3217619 CCTGTGACTCAGGTGCAGCAGGG + Intergenic
1079182894 11:18209282-18209304 CCTGGTGCGCAGGAACCGCAGGG + Exonic
1079485046 11:20927048-20927070 ACTGTAACTCAGGAACCTCATGG - Intronic
1081625152 11:44650695-44650717 CCAGTTACTCAGGAGACTAACGG + Intergenic
1082048741 11:47752697-47752719 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1083191763 11:61057209-61057231 CCTGTTTCCCAGGAACTGCAGGG - Intergenic
1083789377 11:64974607-64974629 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1083993537 11:66260942-66260964 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1084220356 11:67674160-67674182 CCTGTTCCCCAGGAGCCCCAGGG - Intronic
1086384525 11:86293528-86293550 TCTGTGACTCAGAAGCCCCAGGG - Intergenic
1087323850 11:96697313-96697335 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1087766589 11:102161910-102161932 CATGTTATTCAGGAGCCACAGGG + Intronic
1087837227 11:102887221-102887243 CCTATTACTCAGGAGTCCCAGGG + Intergenic
1091348410 11:134872026-134872048 CTTGTTATTCAGGAGCCCCTTGG - Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1095599141 12:43995154-43995176 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1096341021 12:50799268-50799290 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1096989880 12:55792008-55792030 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1097502741 12:60426422-60426444 CCAGTTACTCAGGAGGCGTAAGG - Intergenic
1097956752 12:65494736-65494758 CCTTTTACTCAGGGGGAGCAGGG + Intergenic
1099232013 12:80037917-80037939 CCTGTTCCTCAGGAGTATCAAGG + Intergenic
1104690774 12:130824507-130824529 CCTGTTCCTCTGGAGCCATACGG - Intronic
1106599349 13:31174563-31174585 TATGTTACTCTGGAGCTGCAAGG - Intergenic
1108130274 13:47291831-47291853 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1113150604 13:107259292-107259314 CCTGGTAATCAGGAGTCCCAGGG + Intronic
1117311318 14:54526262-54526284 CCTGCTACTCAGGAGGCTAAGGG - Intronic
1117703168 14:58435820-58435842 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1117862698 14:60109553-60109575 CCAGCTACTCAGGAGGCTCAGGG - Intronic
1119504786 14:75163125-75163147 CCAGCTACTCAGAAGCCTCAGGG + Intronic
1119732202 14:76958008-76958030 CCAGTTACTCAGGAGGCTGAAGG - Intergenic
1122735143 14:103834703-103834725 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1123716898 15:23040115-23040137 CCTGTTCCTCAGGGGCGGCTTGG + Intergenic
1124182851 15:27493867-27493889 CCTCTTACTGAGGTGCCCCACGG - Intronic
1124291930 15:28459910-28459932 CATGTTACAAAGGAGCCTCATGG + Intergenic
1125667913 15:41446915-41446937 CCAGTTACTCAGGAGGCCAAGGG - Intronic
1127943455 15:63725358-63725380 CCTGTTCCTCTGGAGACACAGGG + Exonic
1129906112 15:79188456-79188478 CCAGCTACTCAGGAGCCTGAGGG - Intergenic
1131245662 15:90790238-90790260 CGTGTTGCTCAGGAGCTCCAGGG - Intronic
1131797594 15:96035257-96035279 CCTGTTTCCCAGGTGCCTCATGG + Intergenic
1132357936 15:101186687-101186709 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1132501861 16:288028-288050 CCTCGTACTCAGGAGCCCGATGG - Exonic
1133076911 16:3286965-3286987 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1134626755 16:15727856-15727878 CCAGCTACTCAGGAGGCGGATGG + Intronic
1136706851 16:32197765-32197787 CATGTTACAAAGGAGCCTCATGG - Intergenic
1136761060 16:32731652-32731674 CATGTTACAAAGGAGCCTCATGG + Intergenic
1136807043 16:33138734-33138756 CATGTTACAAAGGAGCCTCATGG - Intergenic
1137259184 16:46809172-46809194 CCAGCTACTCAGGAGGCTCAGGG + Intronic
1137602015 16:49762668-49762690 GCTGTCACTCAGGAGGTGCAAGG + Intronic
1141416612 16:83880369-83880391 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1142007584 16:87697042-87697064 CCTGCCACTCAGGGGCCGCGGGG - Exonic
1142314979 16:89338068-89338090 TCTGCCACTCAGGAGCCCCAGGG + Intronic
1203063212 16_KI270728v1_random:991969-991991 CTTGTTACAAAGGAGCCTCATGG + Intergenic
1142880367 17:2878770-2878792 CCTGCTGCCCAGGAGCCCCACGG + Intronic
1145899379 17:28480216-28480238 CCTGTTACTTAGGAGAACCAAGG + Intronic
1146204411 17:30890003-30890025 CCAGCTACTCAGGAGGCTCAGGG - Intronic
1146342909 17:32037378-32037400 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1148042316 17:44717910-44717932 CCAGCTACTCAGGAGGCTCAGGG + Intronic
1148578320 17:48726627-48726649 ACTGTTCCTCAGGAGCGGCCTGG - Exonic
1148597861 17:48871371-48871393 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1148880095 17:50719185-50719207 CCTGTTAATCAGGAGACTCAGGG + Intergenic
1150668971 17:67172718-67172740 CCTGCTACTCAGGAGGCTGAGGG - Intronic
1150783042 17:68138523-68138545 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1151256339 17:72879701-72879723 CCTGTCACTCAGCAGCTGCAGGG - Intronic
1151874400 17:76858598-76858620 CCGGTTACTCAGGAGGCCAAGGG - Intergenic
1153811456 18:8755574-8755596 CCTGGAACTCAGAAGCTGCATGG - Intronic
1155438350 18:25835873-25835895 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1155459333 18:26059303-26059325 CCTGTTACTCAGCAAACTCAAGG - Intronic
1157379409 18:47198452-47198474 CCAGCTACTCAGGAGACGGAGGG + Intergenic
1157727349 18:49974957-49974979 CCAGTTACTCAGCAGCAGCCTGG - Intronic
1160459931 18:79031409-79031431 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1161445430 19:4316173-4316195 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1161650000 19:5478465-5478487 CCTCTTCCACAGGCGCCGCAGGG - Intergenic
1162371181 19:10280490-10280512 CCTGCTACTCAGGAGGCTAAGGG - Intronic
1163359188 19:16835039-16835061 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1163707259 19:18822074-18822096 CCAGCTACTCAGGAGGCTCAGGG - Intergenic
1163782343 19:19257173-19257195 CCTGTTACCCAGAAACTGCAGGG + Exonic
1167241931 19:48349075-48349097 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1167670546 19:50850556-50850578 CCTCTGACTCAGGAGTCTCATGG - Intergenic
1168023065 19:53623833-53623855 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
925207966 2:2023351-2023373 CCTGTTTCCCAGGAGCTGCCTGG + Intronic
928908567 2:36395127-36395149 CCAGTTACTCAGGAGGCTGAAGG - Intronic
930710898 2:54550230-54550252 CCAGTCACTCAGGAGCGCCAAGG - Intronic
932306790 2:70709522-70709544 TCTGTCACTCAGTAGCTGCATGG + Intronic
932593381 2:73080129-73080151 CCTGGGCCTCAGGAGCCTCAGGG + Intronic
934712536 2:96525424-96525446 TCTGTCACTCAGGAGTGGCAAGG - Intergenic
935657136 2:105433293-105433315 CCAGTTACTCAGGAGGCTGAGGG - Intronic
937027942 2:118714710-118714732 CCTGTTTCTCAGGCCACGCATGG + Intergenic
938153860 2:128910892-128910914 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
938305610 2:130252327-130252349 CCCGTTGCTCAGGCGGCGCAGGG - Intergenic
938448541 2:131395454-131395476 CCCGTTGCTCAGGCGGCGCAGGG + Intergenic
944826061 2:203484292-203484314 CCTGTTAGTCACGATCAGCAAGG - Intronic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1172701776 20:36857762-36857784 CCTGGTACCCAGGAGCCACTGGG + Intronic
1173753344 20:45493749-45493771 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1174171151 20:48618931-48618953 CCTGTTAATCAGGAGGAGGAAGG + Intergenic
1174611970 20:51805133-51805155 CCAGCTACTCAGGAGCCTGACGG + Intergenic
1175388749 20:58613510-58613532 TCAGGTACTCAGGAGCCTCATGG + Intergenic
1175960505 20:62634261-62634283 CCTGTGTCTGAGGAGCTGCAAGG - Intergenic
1176673732 21:9757699-9757721 CCTGTCATTCAGGAGCCCAAGGG + Intergenic
1178206073 21:30468069-30468091 TCTAATACTCAGGAGCAGCATGG - Intergenic
1179503339 21:41823449-41823471 CCTGTGGCAGAGGAGCCGCATGG + Exonic
1180012371 21:45059311-45059333 CCTGTCACTCGGGTGCCTCAGGG - Intergenic
1181114955 22:20626337-20626359 CCAGCTACTCAGGAGGCTCAGGG - Intergenic
1183279494 22:36924351-36924373 CCTGTTGCTCAGGAACATCACGG + Intronic
1183284111 22:36951954-36951976 CCTGTTGCTCAGGAACATCACGG - Intergenic
1183768269 22:39899680-39899702 CCTGTTATTAAGGAGCTACAGGG + Intergenic
1184595209 22:45509695-45509717 CCAGCTACTCAGGAGGGGCAGGG + Intronic
962384728 3:134923494-134923516 CATGGCACTCAGGAACCGCAGGG - Intronic
962475467 3:135751554-135751576 CCTGTAACTCTGGATCCCCAGGG - Intergenic
964009107 3:151868392-151868414 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
965569805 3:170160790-170160812 CCAGTTACTCAGGAGGCTGAGGG + Intronic
965588103 3:170336950-170336972 CCAGCTACTCAGGAGCCTGAGGG - Intergenic
965688942 3:171334538-171334560 CCTGGCACTCAGGAGCAGCATGG + Intronic
966027967 3:175309298-175309320 CCAGTTACTCAGGAGGCTGAGGG - Intronic
966496785 3:180590355-180590377 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
969416108 4:7060463-7060485 CCAGTCACTCATGCGCCGCAGGG + Exonic
970732791 4:19126692-19126714 CCTGTTAATCAAGAGCTTCAGGG + Intergenic
973962842 4:56129188-56129210 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
976756037 4:88498683-88498705 CCAGTTACTCAGGAGGCTGAGGG - Intronic
976767257 4:88610336-88610358 CCAGTTACTCAGGAGGCTAAGGG + Intronic
977444201 4:97108465-97108487 TCTGGTACTCAGGAGTCACATGG - Intergenic
978481293 4:109193725-109193747 TGTGTTACTCAGGAGCAACAGGG - Intronic
979628689 4:122876075-122876097 CCTGTGACACAGGAGCGACAAGG + Intronic
981965965 4:150603747-150603769 CCAGCTACTCAGGAGGCTCAAGG - Intronic
982695240 4:158591632-158591654 CCAGCTACTCAGGAGCCTGAGGG + Intronic
982775232 4:159434822-159434844 CCTGTTCCACAGGAGAAGCAGGG + Intergenic
985400979 4:189593970-189593992 CCTGTCATTCAGGAGCCCAAGGG - Intergenic
986502915 5:8418929-8418951 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
990371587 5:55124752-55124774 CCTGTTACTCAGAGGCCACTGGG - Intronic
990991430 5:61688252-61688274 CCTGGGACTCAAGAGCCCCATGG + Intronic
991659259 5:68933858-68933880 CTTGTTTCCCAGGAGCCCCAAGG + Intergenic
992325225 5:75653924-75653946 CCTGTTTCTCAGGAGGAGCTGGG + Intronic
993977741 5:94502992-94503014 CCAGTTACTCAGGAGGCTGAGGG + Intronic
994076904 5:95662512-95662534 CCTGCTACTCAGGAGGCTGACGG - Intronic
994301530 5:98153611-98153633 CCTGTTACTCAGGAGGCTGAGGG + Intergenic
995809300 5:116086571-116086593 CCAGCTACTCAGGAGGCTCAGGG - Intronic
998268369 5:140683869-140683891 CCAGCTACTCAGGAGGCTCAAGG + Intronic
1000877939 5:166664250-166664272 CCAGTTACTCAGGAGGCGGAGGG - Intergenic
1001315148 5:170636626-170636648 CCTGTTTCTCAGGAGAGGGATGG + Intronic
1002127989 5:177060995-177061017 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1002607574 5:180392134-180392156 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1006112315 6:31755264-31755286 CCTGCTACTCAGGAGGCTGAGGG - Intronic
1006260108 6:32860742-32860764 CCTGTCACTCAGGAAGTGCAAGG - Intergenic
1007615902 6:43179715-43179737 CCAGCTACTCAGGAGCTGAAGGG - Exonic
1009192426 6:60645523-60645545 CCTGCTACACAGGATCCTCACGG - Intergenic
1010589078 6:77691836-77691858 CCTATTAATCAGGAGCCACTGGG + Intronic
1011572413 6:88753386-88753408 CCAGCTACTCAGGAGCCCAAAGG + Intronic
1011780161 6:90779908-90779930 CCTGCTACTCAGGAGGCTGAGGG - Intergenic
1012583809 6:100898778-100898800 CCTGTTTCAAAGGAGCCCCAGGG - Intergenic
1015259474 6:131219173-131219195 CCAGCTACTCAGGAGCCTGAGGG + Intronic
1016314439 6:142770878-142770900 CATGTTATTCAGGAGCATCAGGG - Exonic
1016421675 6:143891585-143891607 CCTGCTACTCAGGAGACTGAGGG + Intronic
1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG + Intronic
1021116479 7:16751174-16751196 CCAGCTACTCAGGAGCCTGAGGG - Intergenic
1021559868 7:21958846-21958868 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1023900195 7:44470626-44470648 TCTGTAACTCAGGGGCTGCAAGG + Intronic
1024576334 7:50767630-50767652 CCTGCTGGCCAGGAGCCGCAGGG - Intronic
1026046625 7:66910032-66910054 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1026602445 7:71787780-71787802 CCAGATACTCCGGAGCGGCATGG - Exonic
1028420636 7:90628718-90628740 CCAGTTACTCAGGAGACTCAAGG + Intronic
1029205613 7:98867818-98867840 CCTGTTCCTCAGGGGTCTCAGGG + Intronic
1033713231 7:143971316-143971338 CCAGCTACTCAGGAGGCTCAGGG + Intergenic
1033754264 7:144384981-144385003 CCTGGTGCTCAGGAGCCCCTTGG - Intergenic
1033903396 7:146170910-146170932 CCAGCTACTCAGGAGGCTCAGGG + Intronic
1034880148 7:154756986-154757008 CCTGTTCCTCAGGGGCCGTGAGG - Intronic
1035100099 7:156389352-156389374 GCTGTGCCTCAGGAACCGCACGG - Intergenic
1036804822 8:11823682-11823704 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1037518930 8:19661226-19661248 TCTGTCACCCAGGAGCCACAAGG + Intronic
1037532659 8:19792652-19792674 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1038569052 8:28643878-28643900 CCAGCTACTCAGGAGGCTCAGGG - Intronic
1039264326 8:35808536-35808558 CCTGTTCCCCCTGAGCCGCAGGG - Intergenic
1039383390 8:37107068-37107090 CTTCTTACACAGGAGCCCCATGG + Intergenic
1039470811 8:37812782-37812804 CCAGCTACTCAGGAGCCTGAGGG - Intronic
1039813584 8:41071811-41071833 CCAGCTACTCAGGAGGCTCAGGG + Intergenic
1039967678 8:42295231-42295253 CCAGCTACTCAGGAGGCTCATGG - Intronic
1040751020 8:50708084-50708106 CCAGTTACTCAGGAGACCGAGGG + Intronic
1041696423 8:60741757-60741779 CCCGTTCCTCAGGTGCCCCATGG + Exonic
1043443292 8:80295716-80295738 CCTGCTACTCAGGAGGCTGAGGG - Intergenic
1047167910 8:122461300-122461322 CTTCTTACTCAGGAGCCCCTAGG - Intergenic
1051131455 9:13865574-13865596 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1051364856 9:16314682-16314704 CCTGTCACTCAGGAGAAGAAAGG + Intergenic
1052600076 9:30615914-30615936 CCCGTTACTCAGGAGGCTGATGG + Intergenic
1053408985 9:37903735-37903757 CCTGGTGCACAGGAACCGCAGGG - Exonic
1055931274 9:81561979-81562001 CCAGTTACTCAGGAGGCTGAAGG + Intergenic
1057602473 9:96470780-96470802 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1059595379 9:115714537-115714559 CCTGTTACTCAGGTTCCGACAGG - Intergenic
1061574143 9:131495642-131495664 CCTGCAACTCAGGAGCAGGAAGG + Intronic
1062581177 9:137229921-137229943 GCTGTCACTCAGGAGCCCCAGGG + Intergenic
1062651728 9:137581259-137581281 CCTGTTCTTCAGGAGCCCCCAGG + Intergenic
1188107412 X:26161027-26161049 TCTGTTCCTCAGGAGTCTCAGGG + Intergenic
1189231453 X:39455273-39455295 CCTGCTACTCAGGAGGCTGAAGG - Intergenic
1193780875 X:85699431-85699453 CCTGATAGCCACGAGCCGCATGG - Intergenic
1198403636 X:136291138-136291160 CCTCTTACTGAGGTGCCCCATGG + Intergenic
1199771678 X:150979287-150979309 CCAGCTACTCAGGAGGCTCAGGG - Intergenic
1201910087 Y:19125146-19125168 CCAGTTACTCAGGAGGCTGAAGG - Intergenic