ID: 1019888075

View in Genome Browser
Species Human (GRCh38)
Location 7:3922735-3922757
Sequence TGGTGGGGCGCTCCCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019888075 Original CRISPR TGGTGGGGCGCTCCCTTTGC TGG Intronic
900394659 1:2448303-2448325 TGGGGCCGCGCTCCCTCTGCAGG + Intronic
900408458 1:2502552-2502574 TGGGTGGCCGCTCCCTCTGCAGG - Intronic
901054156 1:6440827-6440849 TGGGGGCGCGCGCCCTCTGCTGG + Intronic
902480154 1:16707504-16707526 TGGGGGCGCGCGCCCTCTGCTGG - Intergenic
904674136 1:32187883-32187905 TGGTGGGGGGATCACTATGCAGG - Intronic
911200880 1:95042595-95042617 TGGTGGGGCACACCCTCTGTGGG + Intronic
915324081 1:155071527-155071549 GGGTGGGGCCCTCAATTTGCTGG + Intergenic
915913249 1:159927286-159927308 TGGTTGGGGGCCTCCTTTGCAGG + Exonic
915924356 1:160004736-160004758 TGGTGGGTGGGTCCCTTTACTGG - Intergenic
915944486 1:160140006-160140028 TGGTGGGGCTTGCACTTTGCTGG - Intronic
922725882 1:227922782-227922804 TGGTGGGGAGGTCCCTTCCCAGG + Intronic
922994238 1:229943561-229943583 GGGTGGGGAGCACCCTTAGCAGG + Intergenic
1067030761 10:42877821-42877843 TGCTGGGGGGCACCCTATGCAGG - Intergenic
1077919402 11:6631615-6631637 TGGTGGGGGCCTCCCTATACAGG - Exonic
1077920800 11:6640584-6640606 TGGTGGGGCTCACCCTGAGCTGG - Exonic
1080650058 11:34215162-34215184 TGGTGGGATGCTGCCATTGCTGG + Intronic
1083843909 11:65320113-65320135 GGGTGGGGCACTCCCCTTGCAGG - Intronic
1084195552 11:67522233-67522255 GGGCAGGGGGCTCCCTTTGCTGG + Intronic
1084518543 11:69649206-69649228 TGGAGGGGCTTTCTCTTTGCTGG - Intronic
1089638788 11:119833364-119833386 TGGTGGGGCCCTCCTTATACAGG + Intergenic
1092215817 12:6681397-6681419 TTGTGGGGCTCTATCTTTGCTGG - Intronic
1092385664 12:8033794-8033816 AGGTGGTTCCCTCCCTTTGCCGG + Exonic
1093665183 12:21804015-21804037 TGGTGGTGCTCTCCCTTTTATGG + Intronic
1095949974 12:47776520-47776542 TGGTGGAGAGCTCCCTTCCCAGG + Intronic
1097154979 12:57006140-57006162 GGCTGGGGCGCTCCCTCTGGAGG + Intronic
1105292469 13:19061618-19061640 TGGGAGGGGGCTCCCTTTGAAGG + Intergenic
1109685865 13:65819055-65819077 TGGTGTGGCACTCACTTTCCAGG - Intergenic
1118838312 14:69492329-69492351 TCTTGGGGAGCTCCCTTGGCTGG + Intronic
1128946270 15:71824071-71824093 GTGTGGGGCCCTCCCTTTGAGGG - Exonic
1131417380 15:92272455-92272477 TGTTGGTGCATTCCCTTTGCTGG + Intergenic
1132570157 16:641007-641029 TGCTGGGGGGATCCCTGTGCTGG - Intronic
1132570206 16:641117-641139 TGCTGGGGGGATCCCTGTGCTGG - Intronic
1132570235 16:641213-641235 TGCTGGGGGGATCCCTGTGCTGG - Intronic
1132570304 16:641397-641419 TGCTGGGGGGATCCCTGTGCTGG - Intronic
1141444626 16:84049971-84049993 TGGAGGGACGCCCCCTTTGCTGG - Intergenic
1141561367 16:84869936-84869958 GGGTGGGGCACTCCCCATGCAGG + Intronic
1142145279 16:88490473-88490495 TGGTGAGGCGCTCGCCGTGCTGG + Intronic
1142679138 17:1535376-1535398 GGGTGGGCCGCTCCCTGTGGAGG - Intronic
1143519744 17:7438440-7438462 TGGGGGGAAGCTCCGTTTGCGGG + Intronic
1144671415 17:17134671-17134693 TGGTGGGGCACTGCCTTGGGTGG - Intronic
1146649743 17:34599281-34599303 TGGTGGGGTGTTCCTTATGCAGG - Intronic
1147574032 17:41588426-41588448 TAGTGGGGGGCTCCCTTCTCTGG - Intergenic
1151453721 17:74214131-74214153 AGATGGGGCGCTCTCTTTCCGGG + Intronic
1151999438 17:77636350-77636372 TGGTGGGGCGATGCCTGTGCAGG + Intergenic
1152628171 17:81397703-81397725 CGGCCGGGCGCTCGCTTTGCAGG + Intronic
1158487663 18:57881979-57882001 TGGTGTGGCGCTCCCTCTCGTGG - Intergenic
1160429071 18:78799155-78799177 TGGCGGAGCGCTGCCTTTGGTGG - Intergenic
1161079273 19:2302563-2302585 TGGTGGGACGTGCCCCTTGCTGG - Intronic
1161420684 19:4174673-4174695 TGGTGGGCCGCTCCCGTTTGGGG + Exonic
1162393618 19:10404029-10404051 TGGTATGGCCCTCCCCTTGCAGG + Intronic
1163299495 19:16434789-16434811 TGGTGGGGCAGTGTCTTTGCAGG + Intronic
1163777203 19:19225499-19225521 TGGTGGGGAGTCACCTTTGCTGG + Intronic
1165014105 19:32868412-32868434 TGGTGGGGCAGGCCCTTTGCAGG - Intronic
1165325741 19:35113500-35113522 GGGTGGGGCCTTGCCTTTGCAGG - Intergenic
1166517966 19:43461433-43461455 TGCTGGGGCCCCCCTTTTGCAGG + Exonic
1167176648 19:47869088-47869110 TGGTTGGCCGCTCCCTGGGCTGG - Intergenic
1168346566 19:55652853-55652875 GGGTTGGGGGCTCCCTTAGCCGG + Exonic
1202714191 1_KI270714v1_random:33410-33432 TGGGGGCGCGCGCCCTCTGCTGG - Intergenic
925295521 2:2773909-2773931 TGGTGTGGCGCTCCCTTAGCAGG - Intergenic
925365848 2:3311778-3311800 TGGTGGGGGGCTCCATTCGCGGG + Intronic
925411611 2:3642979-3643001 TGGTGGGGCCATTCCATTGCTGG - Intronic
932490658 2:72117929-72117951 AGGAGGGGCGAGCCCTTTGCAGG + Intergenic
934518719 2:95005982-95006004 TGATGGCGCCCTTCCTTTGCTGG - Intergenic
937988045 2:127647461-127647483 TGGTGGGGGCCTGCCTGTGCTGG - Intronic
938095985 2:128464475-128464497 TACTGGGGAGATCCCTTTGCTGG + Intergenic
941765117 2:169288496-169288518 TGGTGGGCCAGTGCCTTTGCTGG - Intronic
948328854 2:237149663-237149685 TGCTGGGCCCCACCCTTTGCTGG + Intergenic
948550939 2:238772716-238772738 TGGTGGGGCTGTCCCCTTGACGG - Intergenic
1173850798 20:46216535-46216557 GGGTGGGGCTCCCCCTCTGCCGG + Intronic
1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG + Intergenic
1178276710 21:31245463-31245485 TTGTTGGGCACTTCCTTTGCAGG - Intronic
1178830587 21:36053300-36053322 TGGTGGGGCAGTCCCATGGCTGG - Intronic
1180834909 22:18925030-18925052 AGGTGGGGCCCCCTCTTTGCTGG - Exonic
1182466456 22:30519889-30519911 TGGTGTGGCTCTCCCATCGCTGG - Intergenic
1184607709 22:45583735-45583757 AGGTGGGGAGCACCCCTTGCAGG + Intronic
1184751884 22:46491017-46491039 TTGGGGGGCCCTCCATTTGCAGG - Intronic
1203284998 22_KI270734v1_random:150329-150351 AGGTGGGGCCCCCTCTTTGCTGG - Intergenic
949349050 3:3105636-3105658 TTGTGATCCGCTCCCTTTGCGGG - Intronic
954998708 3:54906378-54906400 TGGTGGGGCAATGCCTTTCCAGG + Intronic
968471902 4:786327-786349 TGGGGGCGCGCGCCCCTTGCCGG + Exonic
968596357 4:1487959-1487981 TGGCGTGGTGCTCCCTTGGCAGG - Intergenic
969437011 4:7194072-7194094 TGGTGGGGCTCTAGTTTTGCAGG + Intronic
969674613 4:8607925-8607947 AGGTGAGGCCCTCCCTTTTCCGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
979565828 4:122152847-122152869 TGGTAAGGCGCTCCACTTGCTGG + Intronic
985651077 5:1107885-1107907 TGGTGAGGGGCTCCCTCTCCTGG - Intronic
990728834 5:58786404-58786426 TGGTGGGGGGCTGCCTGTGGTGG + Intronic
997207322 5:132057352-132057374 TGGTGGGGCTCTGCCTGTGCTGG + Intergenic
999206509 5:149852080-149852102 TGCTGGGGCCAACCCTTTGCTGG + Exonic
1003978136 6:11363640-11363662 TGGTGGGTCCCTCCCTTTTCAGG - Intronic
1007375447 6:41453140-41453162 TGGTGGGGGGAGCCCTTTCCGGG - Intergenic
1008560979 6:52724548-52724570 AGGTTGGGCAATCCCTTTGCTGG - Intergenic
1008678641 6:53848130-53848152 TAGAGGCGTGCTCCCTTTGCTGG - Intronic
1017905951 6:158757658-158757680 TGGCGGAGGCCTCCCTTTGCTGG + Intronic
1018277946 6:162153272-162153294 TGCTGTGGCGCACCCCTTGCGGG + Intronic
1018756911 6:166857834-166857856 TGGTGTGGGGCTCCCTGTACTGG - Intronic
1019571003 7:1712125-1712147 TCGTGTGGGGGTCCCTTTGCCGG + Intronic
1019888075 7:3922735-3922757 TGGTGGGGCGCTCCCTTTGCTGG + Intronic
1019963906 7:4483669-4483691 TGGTGGGGCGGTTCTTGTGCAGG - Intergenic
1032966372 7:137103263-137103285 AGGTGGGGCGCTGCCTTACCCGG + Intergenic
1034411632 7:150945295-150945317 TGCTGGGCCGCTCCCCTTGGAGG - Exonic
1035052198 7:156005369-156005391 TGGTGCGGCTCTCCCACTGCTGG - Intergenic
1049798743 8:144508200-144508222 AGGTGGGCCCCTCCCTTGGCAGG + Intergenic