ID: 1019888426

View in Genome Browser
Species Human (GRCh38)
Location 7:3925415-3925437
Sequence TTGCCCTAACAGCTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019888426_1019888429 5 Left 1019888426 7:3925415-3925437 CCCTGCTCAAGCTGTTAGGGCAA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1019888429 7:3925443-3925465 ACGGCGTTTCTACCCTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019888426 Original CRISPR TTGCCCTAACAGCTTGAGCA GGG (reversed) Intronic
902047671 1:13538101-13538123 CTGACATAACAGCTTGGGCAAGG + Intergenic
903439930 1:23380083-23380105 TTGCCCCAACAGCTTCCCCAAGG + Intergenic
906453887 1:45976722-45976744 TTCCCCTAACATCTTGATAATGG - Intronic
912271678 1:108216844-108216866 TTGCCCTTTCATCTAGAGCAAGG + Intergenic
917674424 1:177305412-177305434 TTTCCCGAACAGCCGGAGCACGG + Intergenic
917968832 1:180194695-180194717 CTGCCCTAGCAGTTTGAGTAAGG - Intronic
918174545 1:182031367-182031389 TTGCCCTAACAACTTGATACAGG - Intergenic
918440452 1:184561331-184561353 TTGCCAAACCACCTTGAGCAGGG + Intronic
919186842 1:194161937-194161959 TTGCACTAACAGCTAGGCCATGG + Intergenic
920274915 1:204797479-204797501 TTTGCCTTACAGCTTGAGCTGGG - Intergenic
924244334 1:242067601-242067623 TTACCCTAAGAGCTTAAACAAGG - Intergenic
1068735161 10:60406069-60406091 TTGCCCTGACACTTTGAGCAAGG - Intronic
1081720068 11:45282159-45282181 GTGACCTGGCAGCTTGAGCAAGG - Intronic
1085710112 11:78821777-78821799 TGGCCCTAATAGGTTGACCAGGG + Intronic
1089246772 11:117127002-117127024 TTGCTCTCTCTGCTTGAGCAAGG + Intergenic
1091240720 11:134050559-134050581 TTGCCTTGAAAACTTGAGCACGG + Intergenic
1096258027 12:50074576-50074598 TTGACCTCACAGATGGAGCAAGG - Intronic
1097262999 12:57729983-57730005 TGGCCTTAAGACCTTGAGCAAGG + Intronic
1103094997 12:118125628-118125650 TTGCCCTCCCAGCTTGACTAAGG - Intronic
1103266495 12:119635051-119635073 TTTCCCTAGCAGCTTGAGGGCGG - Intronic
1104411427 12:128561384-128561406 TTCCCCTAAAAGCTTGAAAACGG + Intronic
1115757667 14:36545341-36545363 TTGCCCTGATGGCTTGAGAAAGG + Intergenic
1116600596 14:46917340-46917362 TTGCCATAACTGTTTGTGCAAGG + Intronic
1119127276 14:72139052-72139074 TTGCCCTAGCAGGTAGAGCAAGG + Intronic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1120704932 14:87735966-87735988 TTGCCCTGCCAGCTGGAGGAGGG + Intergenic
1121021044 14:90580398-90580420 TTGCCCTGAGAACTTGGGCAGGG - Intronic
1137745829 16:50819338-50819360 CTGGCCTCACAGCTTGAGCTGGG + Intergenic
1137810719 16:51350144-51350166 TTGGCCTGACTGCTTGAGCTAGG - Intergenic
1140161428 16:72498688-72498710 TTCCCCTAACCTCTTGAGTATGG - Intergenic
1142975729 17:3642945-3642967 TTGCCCACACAGCTTGAAAATGG - Intronic
1144379095 17:14675249-14675271 TTGGCTTTACAGCTTGAACAAGG - Intergenic
1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG + Intronic
1151381201 17:73726981-73727003 TTGCCCCAATTGCCTGAGCAGGG - Intergenic
1151682299 17:75628583-75628605 TTTCCCTGACCCCTTGAGCAGGG + Intronic
1152502878 17:80724838-80724860 TTGCCTTTTCAGCTGGAGCACGG + Intronic
1156897078 18:42258034-42258056 TTTGCCTAACAGCTTCAGAAAGG + Intergenic
1157107868 18:44791865-44791887 TTGCCCTAACTTCTTGGGGAGGG + Intronic
1158247943 18:55452741-55452763 TTGTCCTAAGCCCTTGAGCAAGG - Intronic
1158416260 18:57251983-57252005 CTGCCCTAACAGCTAAAGTAGGG - Intergenic
1163764060 19:19152762-19152784 TTGCCCAGACCGCTTGGGCAGGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166503939 19:43360003-43360025 TTGCTCTCACAGCTAAAGCAAGG + Intronic
1166506515 19:43374755-43374777 TTGCTCTCACAGCTGAAGCAAGG - Intergenic
926326884 2:11792671-11792693 TTGTCCTCACAGCCTGGGCATGG - Intronic
926902907 2:17775833-17775855 TTGCCAAAAAAGCTTGAGCTAGG + Intronic
927259398 2:21071547-21071569 TTGCCCTAACAGCATTATCTTGG - Intergenic
933400173 2:81786233-81786255 TGGCCCTAAGAGCTTGGCCACGG - Intergenic
933885014 2:86711306-86711328 TTCCCCCAGCAGATTGAGCAAGG - Intronic
933925160 2:87085378-87085400 TTCCCCCAGCAGATTGAGCAAGG + Intergenic
938622290 2:133068571-133068593 TCCCTCTAACAGCTTGAACAGGG - Intronic
943337778 2:186639658-186639680 ATGCAATAACAGATTGAGCATGG - Intronic
947731644 2:232434685-232434707 TTGCCCTGACAGCCCTAGCATGG - Intergenic
1175373800 20:58510916-58510938 TTGCCATTTCAGCTTGAGCTTGG - Intronic
1182086014 22:27561650-27561672 TTGGCCTGACTGCTTGAGCTGGG + Intergenic
1182438369 22:30345992-30346014 CTGCCCTCACACCCTGAGCAAGG + Intronic
950506296 3:13396950-13396972 TGGCCCTAAGAGCCAGAGCAGGG + Intronic
953293007 3:41685206-41685228 TTGCCCTAAAAGGTTAGGCAAGG + Intronic
953475655 3:43203717-43203739 TTTCTCTTACAGCTTGGGCAGGG - Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
963912580 3:150827209-150827231 GTGCCCTTACAGCTTCAGCAGGG + Intergenic
967918698 3:194598553-194598575 TTGCCTTAACAGCCTGAGTCAGG - Intronic
968353839 3:198084603-198084625 TTTCCCTAACATCTAGAACAAGG + Intergenic
970671665 4:18403687-18403709 TTGCCATTACAACTTTAGCAGGG + Intergenic
971697049 4:29919086-29919108 TTGGCCTGACTGCTTGAGCTAGG + Intergenic
975760062 4:77611174-77611196 TTGCCCCATCAGCTTCTGCAAGG - Exonic
991299053 5:65110621-65110643 TTGTCATAACAGCATAAGCAAGG + Intergenic
992984466 5:82213398-82213420 TTGCCCAAATAGCTAAAGCAAGG - Intronic
993031134 5:82707068-82707090 TTTCCCTGACAGCTTGACCTAGG - Intergenic
993308863 5:86303156-86303178 TTGCCCTTTCATCTAGAGCAAGG - Intergenic
997590465 5:135069052-135069074 TTCCCCTGACAGCCTGAGCAGGG - Intronic
999336795 5:150726360-150726382 ATACTCTAACAGCTTGAACAGGG + Intronic
1000165118 5:158640808-158640830 TTGCCCTGACTGCTAGATCAGGG + Intergenic
1000600536 5:163269416-163269438 TTGCCCTCATACCTGGAGCATGG + Intergenic
1002420591 5:179146192-179146214 TTTCCCTAACAGCTTTAATAAGG - Intronic
1002938121 6:1691684-1691706 TTGCCCTAACAGCTTTATTAAGG + Intronic
1005128396 6:22474469-22474491 TTGCCCTAAGAGCTTCAAGAAGG - Intergenic
1007268197 6:40612930-40612952 TTGACCTTACAGCTTTATCAAGG + Intergenic
1008368064 6:50705797-50705819 TTGCCTTAACATCCTGTGCATGG - Intergenic
1010722140 6:79295338-79295360 TTCCCCTAAGAACTGGAGCAAGG - Intergenic
1017310033 6:152965740-152965762 TTCCCCTAACATCTGGAACAAGG + Intergenic
1019888426 7:3925415-3925437 TTGCCCTAACAGCTTGAGCAGGG - Intronic
1032986358 7:137342327-137342349 TTGCTTTAGCAGCTTGAGAAAGG - Intronic
1188758984 X:34002047-34002069 TTGCACTTACAGCTTGAAGAGGG + Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1196760276 X:119194639-119194661 TTGCACTTACAGCTGGACCATGG + Intergenic
1199860652 X:151798083-151798105 TTGACCTAACAGCACGAGCAAGG - Intergenic
1202013681 Y:20377305-20377327 TTGCCCTAACAGCTTTTCTAGGG + Intergenic