ID: 1019889243

View in Genome Browser
Species Human (GRCh38)
Location 7:3932847-3932869
Sequence TGGGTGTTGGCTTCTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889243_1019889254 12 Left 1019889243 7:3932847-3932869 CCCCCAAAAGAAGCCAACACCCA 0: 1
1: 0
2: 1
3: 25
4: 317
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889243_1019889252 7 Left 1019889243 7:3932847-3932869 CCCCCAAAAGAAGCCAACACCCA 0: 1
1: 0
2: 1
3: 25
4: 317
Right 1019889252 7:3932877-3932899 CTCACCTGTGTGTTCAGATAGGG 0: 1
1: 0
2: 3
3: 20
4: 131
1019889243_1019889251 6 Left 1019889243 7:3932847-3932869 CCCCCAAAAGAAGCCAACACCCA 0: 1
1: 0
2: 1
3: 25
4: 317
Right 1019889251 7:3932876-3932898 TCTCACCTGTGTGTTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889243 Original CRISPR TGGGTGTTGGCTTCTTTTGG GGG (reversed) Intronic
901448285 1:9321115-9321137 TGGTTGTTGTTTTCTTTTCGGGG - Intronic
901696864 1:11014027-11014049 TGGATCTTAGCCTCTTTTGGTGG + Intronic
901776852 1:11566001-11566023 ACCGTGTTGGCTTCTTATGGAGG - Intergenic
901901821 1:12371171-12371193 TAGGTTTTGGTTTCTTTTCGGGG - Intronic
903064860 1:20693703-20693725 TTGGCTTTTGCTTCTTTTGGGGG + Intronic
903410414 1:23138522-23138544 TGAGTATGGGTTTCTTTTGGGGG + Intronic
906023513 1:42652905-42652927 TGGGTATGGGCTTTTTTGGGGGG + Intronic
907421349 1:54349528-54349550 TTGATTTTGGCTTCATTTGGGGG - Intronic
907886660 1:58598266-58598288 TGGCTGTTTGCTGGTTTTGGTGG + Intergenic
909428029 1:75550416-75550438 TGGATGAGGGTTTCTTTTGGGGG + Intronic
909936397 1:81556036-81556058 TTGATGCTGACTTCTTTTGGGGG - Intronic
909985964 1:82160841-82160863 TGGGGGTTGGCTTTTTTAGCTGG + Intergenic
911431315 1:97791288-97791310 TGGGTGTTCCTGTCTTTTGGAGG - Intronic
912433567 1:109642929-109642951 TGGGTATGGGTGTCTTTTGGGGG + Intergenic
913071682 1:115304641-115304663 AGGGTGTTCCCTTCTTTTGGAGG - Intronic
915643266 1:157246570-157246592 TGGGTATGGGGTTCTTTTGGGGG - Intergenic
916289382 1:163147722-163147744 TGTGTGTTAGCTTCTATGGGAGG - Intronic
917512508 1:175680060-175680082 TGGTTGTTGGCTTCAGCTGGGGG - Intronic
919659664 1:200231452-200231474 AGGGTTTTGGATGCTTTTGGAGG - Intergenic
921499458 1:215883347-215883369 TGGATGTTAACTTTTTTTGGTGG + Intronic
922714131 1:227857713-227857735 TGGGTACAGGTTTCTTTTGGGGG + Intergenic
922854936 1:228767046-228767068 AGGCTGTTGGCTTCTTCTGAAGG + Intergenic
924165987 1:241284127-241284149 TTGGTGTTGGCATCTATTGATGG + Intronic
924212276 1:241782797-241782819 TGGCTGTTTTGTTCTTTTGGGGG - Intronic
924310119 1:242732124-242732146 TTGGTGTTGGCATCTATTGATGG - Intergenic
924799582 1:247317877-247317899 TGAGGGTTGGCATCTGTTGGTGG - Intronic
1062990758 10:1813487-1813509 TAGGTCTTGGTTTGTTTTGGTGG - Intergenic
1064168420 10:13006608-13006630 TGGGTGATGGCTTTTATTGTTGG - Intronic
1064284110 10:13977618-13977640 TGGGTGTGGTTTTCTTTTGGGGG - Intronic
1064321798 10:14311717-14311739 TGGGGGTTGGCTTGATTTTGTGG - Intronic
1066039601 10:31534408-31534430 TGGGTATGAGTTTCTTTTGGGGG + Intergenic
1067207582 10:44233178-44233200 TGGGTGTTTGCTCCTTTTTCAGG + Intergenic
1067340357 10:45396601-45396623 TGGGTCTGGGCTTCTATTTGTGG - Intronic
1067611633 10:47722825-47722847 AGGCTGTTGCCTTATTTTGGAGG + Intergenic
1070598628 10:77850173-77850195 TGGGTATTGGTTTCTTTTTGGGG - Intronic
1070601300 10:77868287-77868309 TGGATGTTAGGGTCTTTTGGTGG - Intronic
1071537301 10:86444698-86444720 TGGGTATTGGGTTCCTTTAGTGG + Intronic
1071627054 10:87183065-87183087 AGGCTGTTGCCTTATTTTGGAGG + Intronic
1073654492 10:105398373-105398395 TGGCTGTGGCCTTCTTTTGGCGG - Intergenic
1076108546 10:127844182-127844204 CAGGTGTTAGCTTCTTTTGCAGG + Intergenic
1078424874 11:11241211-11241233 TGTGTACAGGCTTCTTTTGGGGG - Intergenic
1078462072 11:11521803-11521825 TGCGTGTTGGCTTCCTTTCCTGG - Intronic
1078525720 11:12099698-12099720 TGGGTGTGGGTTTCCTTTTGGGG + Intronic
1079113674 11:17624893-17624915 TAGGTATTGGATTCTTTTCGTGG + Intronic
1079276566 11:19043315-19043337 TGGTTGTTTGCATATTTTGGGGG - Intergenic
1079774575 11:24508266-24508288 TTTGTGTTGGCTTCATTTGTGGG + Intronic
1080021873 11:27570381-27570403 TTTGTGTGGACTTCTTTTGGGGG - Intergenic
1080225407 11:29954666-29954688 TAGGTATTGTCTTCTTTTTGTGG - Intergenic
1080947383 11:36989367-36989389 TGGGTCTTGGCTCCTTTTCATGG + Intergenic
1084230328 11:67747757-67747779 TGGTTGTTGGTTTCTTCTGTGGG - Intergenic
1084239908 11:67811985-67812007 TTGCTGTTGCCTTCTTTTGTGGG - Intergenic
1085198905 11:74689562-74689584 TGGGTGCTGGATTCCTCTGGAGG + Intergenic
1087083680 11:94196261-94196283 TGGTTGTCGGCTTGTTCTGGGGG - Intergenic
1088055151 11:105565795-105565817 TGGGTACAGGCTTCTTTTTGGGG + Intergenic
1088898958 11:114100472-114100494 TGGGGGTTGACTTATTTTGAGGG + Intronic
1089411742 11:118249162-118249184 AGGGTGTTGACTCCTTTTTGGGG + Intronic
1090339480 11:126003878-126003900 TGAGTGAGGGCTTCCTTTGGAGG - Intronic
1090697038 11:129256557-129256579 TGGATGTTGGTTACTTCTGGAGG - Intronic
1091928070 12:4371584-4371606 AGGCTGCTGGCCTCTTTTGGAGG - Intronic
1092751061 12:11719652-11719674 TGGGCTGTGGCGTCTTTTGGGGG + Intronic
1095432440 12:42148439-42148461 AGGCTGTTTGCTTTTTTTGGGGG - Intergenic
1095635780 12:44431707-44431729 AGGCTGTGGACTTCTTTTGGGGG + Intergenic
1095906305 12:47381791-47381813 TGGGTCTTTGCTTCTTTTCTGGG - Intergenic
1098591050 12:72213219-72213241 TGGGTATTGGTTGCTTTTAGCGG + Intronic
1099100557 12:78434860-78434882 TTGTTGTTGGTTTGTTTTGGTGG + Intergenic
1101546132 12:105714790-105714812 TTGGTGTTGGCTTCTTAGAGTGG - Intergenic
1102416393 12:112766624-112766646 TGGGTGTTGTCCTCATTAGGAGG + Intronic
1102591919 12:113962811-113962833 AGGATGTGGGCATCTTTTGGGGG - Intronic
1103204677 12:119119322-119119344 TGGGTTTTGGTTTCTTTTCTGGG - Intronic
1104442447 12:128805151-128805173 TGAATGTTGGATTTTTTTGGGGG - Intronic
1104835657 12:131788507-131788529 TTGGTTTTGTTTTCTTTTGGGGG + Intronic
1105333866 13:19445392-19445414 TGTGTGATGGCATCTTATGGTGG - Intronic
1105861068 13:24413978-24414000 TGTGTGATGGCATCTTATGGTGG + Intergenic
1105882351 13:24615843-24615865 TGTGTTTTGGCATCTGTTGGTGG - Intergenic
1105922515 13:24977923-24977945 TGTGTGATGGCATCTTATGGTGG - Intergenic
1108204745 13:48076649-48076671 AGGCTCTTGGCTTCTGTTGGAGG - Exonic
1108483132 13:50895574-50895596 AGGGTGTGAGCTTCTTTTAGTGG + Intergenic
1110482981 13:76004264-76004286 TGGATGTAGGGTTCCTTTGGAGG - Intergenic
1110510998 13:76350285-76350307 TGTGTGTTGGGGTCTGTTGGGGG - Intergenic
1111497273 13:89068639-89068661 TGTGTGTTAGCTTCAGTTGGAGG - Intergenic
1112973067 13:105284638-105284660 GGGGTGTTGGTTACTTTTGCAGG - Intergenic
1113788057 13:113013255-113013277 TCGGCGATGGCTTCTTTTGTGGG - Intronic
1114873196 14:26682897-26682919 TGGGTATTTTATTCTTTTGGGGG + Intergenic
1116107470 14:40528024-40528046 TGGGTGTTGGATTACTTTGAGGG + Intergenic
1117650815 14:57903047-57903069 TGGAGCTTGCCTTCTTTTGGGGG - Intronic
1117821146 14:59650661-59650683 TGGGTGTTTTATTCTTTTTGTGG - Intronic
1118255885 14:64205559-64205581 TGGCTCTTAGCTACTTTTGGGGG - Intronic
1119630561 14:76228284-76228306 TGAATGTTGGATTCCTTTGGGGG + Intronic
1119837914 14:77767524-77767546 TGGGTATGAGTTTCTTTTGGGGG + Intronic
1120261603 14:82192021-82192043 AGGATGTTGACATCTTTTGGGGG - Intergenic
1123463313 15:20494314-20494336 TGGGTGTTGGCATCTTCTCCAGG - Intergenic
1123654746 15:22506097-22506119 TGGGTGTTGGCATCTTCTCCAGG + Intergenic
1124271573 15:28286748-28286770 TGGGTGTTGTAATCTTTTAGGGG - Intronic
1124274157 15:28311721-28311743 TGGGTGTTGGCATCTTCTCCAGG - Intronic
1124308658 15:28601299-28601321 TGGGTGTTGGCATCTTCTCCAGG + Intergenic
1124873368 15:33566148-33566170 TGGTAGCTGGCTTCTCTTGGAGG - Intronic
1126659921 15:51022942-51022964 TGGTGGTGGGCTTTTTTTGGTGG + Intergenic
1128959379 15:71985356-71985378 TGGATGATGTCTTCTTCTGGTGG + Intronic
1129793926 15:78361718-78361740 TGTGTGTTGGCTTCGTTTTCAGG - Intergenic
1129903513 15:79169893-79169915 TGGGTGTTTGCAGCTTTTGGCGG + Intergenic
1130569314 15:85026276-85026298 TGGGGGTTGGGATCATTTGGAGG + Intronic
1133897157 16:9940896-9940918 TCTGTGTTGTCTTCTGTTGGTGG - Intronic
1134235898 16:12466253-12466275 TGGGTTTTGTTTTGTTTTGGTGG - Intronic
1135576758 16:23591962-23591984 AGAGTGTAAGCTTCTTTTGGGGG - Intronic
1135952914 16:26931859-26931881 GGAGTGTTGCCTCCTTTTGGTGG + Intergenic
1137304911 16:47189326-47189348 TGGGTGTGGGGTTTTTTTTGTGG - Intronic
1137502146 16:49019768-49019790 TGGGTCTTGGCTCCTGATGGAGG + Intergenic
1139713992 16:68798127-68798149 GGGGTCTTAGCTTCTTTTGTTGG + Intronic
1140383460 16:74512067-74512089 TGGGTGTGGGCTTCTGTTTGGGG - Intronic
1140955714 16:79863141-79863163 TAGGCGTTGGAATCTTTTGGTGG + Intergenic
1141033833 16:80611464-80611486 TGGGTCTGGGCTTCCTTTGACGG - Intronic
1141093257 16:81145010-81145032 TGGGTTTGGGCTGCTTATGGAGG - Intergenic
1141277843 16:82604270-82604292 TGTTTGATGGCTACTTTTGGGGG + Intergenic
1141839230 16:86564022-86564044 TGGGTGTTGGCGTCATCTTGAGG - Intergenic
1143118196 17:4592286-4592308 TGGGGGTGGGCAGCTTTTGGGGG + Intronic
1143667173 17:8369877-8369899 TGGGTACTGGGTTCTTCTGGTGG + Exonic
1144778869 17:17798084-17798106 TGAGTTTTGGCTTCTTTTTGGGG - Exonic
1145959586 17:28879681-28879703 TGGGTGTTGGGCCCTTCTGGTGG - Exonic
1146859850 17:36287309-36287331 TTGGTTTTGGGTTTTTTTGGGGG + Intronic
1147090175 17:38091397-38091419 TTGGTTTTGGGTTTTTTTGGGGG + Intergenic
1147107038 17:38229124-38229146 TTGGTTTTGGGTTTTTTTGGGGG - Intergenic
1147669923 17:42171041-42171063 TGAGTGTGGACTTCATTTGGAGG + Intronic
1147695020 17:42345330-42345352 GGTCTGTTGGATTCTTTTGGTGG + Intronic
1151961335 17:77407539-77407561 TGGGTGTTGGCTTCAGTGTGGGG + Intronic
1152052951 17:77996673-77996695 TTGGTGTTGGCTTCATTTTTTGG + Intergenic
1152064932 17:78106148-78106170 TGGGTTGTGACTGCTTTTGGGGG + Exonic
1152885104 17:82845030-82845052 GGGGTGGTGGCTGCTCTTGGGGG + Intronic
1153156068 18:2150395-2150417 TGTTTGTTTGCTTATTTTGGGGG - Intergenic
1153544029 18:6187264-6187286 TGAGTTTTGACTTTTTTTGGTGG + Intronic
1154348847 18:13566283-13566305 TGGGTGTTGGCTTCTCCTCCAGG - Intronic
1156410541 18:36824001-36824023 TAGGTATGGGTTTCTTTTGGGGG - Intronic
1160157555 18:76445062-76445084 TGGGTTTTGGCTCCTCTGGGTGG - Intronic
1160206046 18:76833321-76833343 TTGTTGTGGGTTTCTTTTGGGGG + Intronic
1161147834 19:2690024-2690046 TTGTTTTTTGCTTCTTTTGGCGG + Intronic
1161633672 19:5373459-5373481 TGGGTGTGGGCTTCTTCTCTGGG + Intergenic
1162014967 19:7840582-7840604 TGGGTGTAGGTTTCTTTTTGGGG - Intronic
1162644405 19:12038235-12038257 TGGGTGTGGGCTGGGTTTGGTGG + Intronic
1165105377 19:33466533-33466555 TGGTTGTTCGCTTGTGTTGGTGG - Intronic
1166452704 19:42915654-42915676 TGGGTTGTGGCTTCTTTGGCAGG - Intronic
1167954891 19:53056849-53056871 TGTGTGTGGGCTTCTCTGGGAGG - Intergenic
1168645592 19:58057058-58057080 GGGGTGTTGGAGTCTTTGGGGGG - Intergenic
925549656 2:5058365-5058387 TGGGTGTTGGCGTGTGTGGGTGG - Intergenic
925852655 2:8097954-8097976 AGGGTATTGGTTTATTTTGGGGG + Intergenic
928325329 2:30315088-30315110 TGGGTGTTTGCTTTTTTTTTTGG - Intronic
930609344 2:53523961-53523983 TTGGAGGTGGGTTCTTTTGGGGG - Intergenic
932294288 2:70611148-70611170 GGGGTCTTGTCTTCTTCTGGTGG + Intronic
933561891 2:83897966-83897988 AGGGTGTGAGCTTCTTTAGGAGG - Intergenic
934026931 2:88008945-88008967 TGGGTGGTGGTATCTTTTGATGG + Intergenic
934717792 2:96553376-96553398 TGGGTGCAGGCTGCTTGTGGAGG - Intergenic
935262443 2:101367002-101367024 CGGATTTTGGCGTCTTTTGGTGG + Intronic
936757831 2:115736012-115736034 TGTGTTTTGTCTTTTTTTGGGGG + Intronic
936775559 2:115968380-115968402 TGGGTGTTGGATTTTTTTGTTGG + Intergenic
937335186 2:121058271-121058293 TGGGTGCTGGCTTCCTTAGGTGG + Intergenic
937432882 2:121854421-121854443 TGGGTACTTGCTTATTTTGGTGG + Intergenic
937530856 2:122825402-122825424 TGTTTCTTTGCTTCTTTTGGGGG - Intergenic
939756234 2:146115775-146115797 GGTTTTTTGGCTTCTTTTGGTGG - Intergenic
940704316 2:157084566-157084588 TTGGTTTTGGCTCTTTTTGGGGG - Intergenic
941999766 2:171634232-171634254 TGAGTGGTGGCTTCTTTTATGGG - Intergenic
942973694 2:181988636-181988658 TTGGTGTTGGATTTTTTTGCAGG + Intronic
943199944 2:184809673-184809695 TGAGTGTTGGCTTTTTAAGGTGG + Intronic
943931923 2:193865876-193865898 AGGGTATGGGTTTCTTTTGGAGG - Intergenic
943972581 2:194429590-194429612 TGGGGGTGGGTTTCTTTTTGTGG - Intergenic
944242924 2:197502676-197502698 TGGGTGCTGGCTACTGTTGCAGG + Intronic
944956004 2:204809975-204809997 TAGGTATTGTATTCTTTTGGTGG + Intronic
945262618 2:207858918-207858940 TGGGTATAGGTTTCTTTTTGGGG - Intronic
945943553 2:215973014-215973036 TGAGTGTTGGGGTCCTTTGGGGG + Intronic
948253007 2:236545349-236545371 TGGGTGTTGTCTTCTTAGGCAGG - Intergenic
948377136 2:237528718-237528740 TGGGTATGGGATTTTTTTGGGGG - Intronic
1169934302 20:10866327-10866349 TGGGTGAGGGCTGCTTTTGAGGG + Intergenic
1170020601 20:11833256-11833278 AGGGTGTTTGCTACTTTTAGAGG + Intergenic
1172557048 20:35851531-35851553 TGGCTGTTTTCTTCTATTGGGGG + Intronic
1172633142 20:36392358-36392380 TGTTTGTTTGCTTGTTTTGGGGG + Intronic
1172849259 20:37948888-37948910 TGGGTGTGAGTTTCTTTTGGGGG + Intergenic
1173463757 20:43264732-43264754 TGAGTATTGGCCACTTTTGGGGG - Intergenic
1174182453 20:48683345-48683367 TGGGTCTTGCCATCTTCTGGTGG + Intronic
1174879267 20:54260488-54260510 TGGGTTTTGTTATCTTTTGGGGG - Intergenic
1175462537 20:59163175-59163197 TGGGTCTAGGAGTCTTTTGGTGG + Intergenic
1176739187 21:10583281-10583303 TGTGTGATGGCATCTTATGGTGG + Intronic
1176936617 21:14875234-14875256 TCAGTGTTGGCTGCTTCTGGAGG + Intergenic
1178131369 21:29575863-29575885 TGTTTGTTTGTTTCTTTTGGGGG - Intronic
1179989084 21:44937035-44937057 TGGGTCTTTGCTTCCTTAGGAGG + Intronic
1182434486 22:30321620-30321642 TGGGTGTTGGCTTCCTGTTATGG - Intronic
1184423012 22:44392696-44392718 GGGGTGTTGGCTGCTTTGGCTGG - Intergenic
1184805580 22:46793060-46793082 TGTGTGTTGTCCTATTTTGGGGG + Intronic
1185265573 22:49900937-49900959 TGGGTCTTGGCTCCCTTTGGTGG - Exonic
950223885 3:11217836-11217858 TGGGGCTTGGCTTCTCTAGGTGG - Intronic
950271707 3:11621289-11621311 TGGGTATGGGTTTCTTTTCGGGG - Intronic
950783037 3:15408928-15408950 TGGCTGTGGGATTCATTTGGCGG + Intronic
951274201 3:20665314-20665336 TAGGTATTGTATTCTTTTGGTGG + Intergenic
952753906 3:36849340-36849362 AGGATGTTGCCTTCTTTTTGGGG - Intronic
953202073 3:40786778-40786800 TGGTTGCTGGCTGCTCTTGGGGG - Intergenic
953202527 3:40790246-40790268 TGGTTGATGGCTGCTCTTGGGGG + Intergenic
953204347 3:40809546-40809568 TGGGTCTTGGCTTCCCTTTGGGG + Intergenic
953479865 3:43241916-43241938 TGGGTATAGGATTCTTTTTGTGG + Intergenic
953798855 3:46005997-46006019 TGGGTCTTGGACTCTTTAGGGGG + Intergenic
955306844 3:57841791-57841813 TAGTTGTTAGCTTATTTTGGTGG + Intronic
955927030 3:64017176-64017198 TGGGTGTCGGTTTCCTTTTGGGG + Intronic
956494485 3:69809727-69809749 TTGTTGTTTGCTTCTTTTGTGGG + Intronic
956680400 3:71774172-71774194 TGTGGGGTGGCCTCTTTTGGTGG - Intronic
956764679 3:72474437-72474459 TGGGTGTGGGTTTCTTTATGGGG - Intergenic
957046897 3:75382788-75382810 TGGTTGTTGGTTTCTTCTGTGGG - Intergenic
957530441 3:81434155-81434177 TGGGTGTTTGCTTCATTTCTTGG + Intergenic
957664836 3:83214255-83214277 TGGATGCTGGCATGTTTTGGAGG + Intergenic
957817230 3:85317116-85317138 GTGGTGTTTGCTTTTTTTGGGGG + Intronic
958745203 3:98125952-98125974 TCAGTGTTGGCTTCTTTTTCTGG + Intergenic
958751810 3:98200859-98200881 TCAGTGTTGGCTTCTTTTGCTGG + Intergenic
961299003 3:125909952-125909974 TTGCTGTTGCCTTCTTTTGTGGG + Intergenic
962470194 3:135700437-135700459 TGGGTATTTGATTCTTTTTGTGG - Intergenic
962571419 3:136717166-136717188 TGTGTGTAGATTTCTTTTGGTGG - Intronic
963285792 3:143433281-143433303 TGGTTGCTGGGTTCTTTGGGGGG + Intronic
963595471 3:147319336-147319358 TGTGTGTGGCTTTCTTTTGGTGG - Intergenic
963628387 3:147702633-147702655 TGGACCTTGGCTCCTTTTGGTGG - Intergenic
964477353 3:157109096-157109118 TGGGTATTGCCTTCATTTAGTGG - Intergenic
964988020 3:162769356-162769378 TGCCAGTTGGCTTCTTTTGTAGG + Intergenic
965615370 3:170586561-170586583 TGGGTCTTGTCTTCTTTAGGAGG - Intronic
965718577 3:171634896-171634918 TGAGTGTGGGGTTTTTTTGGGGG - Intronic
967385692 3:188908691-188908713 TGGTTGGTGGCTTGTGTTGGGGG + Intergenic
968215952 3:196890888-196890910 TGGATGGTTACTTCTTTTGGAGG + Intronic
968238181 3:197050391-197050413 TTGTTGTTGGGTTTTTTTGGGGG - Intronic
968595489 4:1480167-1480189 TGGGGATTGGCATCTTTGGGAGG - Intergenic
968991192 4:3913903-3913925 TGGTTGTTGGTTTCTTCTGTGGG - Intergenic
969151058 4:5168893-5168915 TGGGTGATGGCAGGTTTTGGGGG - Intronic
969495389 4:7523393-7523415 TGCTTGTTGGATTCCTTTGGAGG - Intronic
969824159 4:9743630-9743652 TGGTTGTTGGTTTCTTCTGTGGG + Intergenic
969906909 4:10405655-10405677 TGGGTTTTGGCGGGTTTTGGCGG + Intergenic
970606652 4:17687805-17687827 AAGGTGTTGGCTTATTTTGGAGG - Intronic
973097267 4:46217859-46217881 TGGGAGGTGGGATCTTTTGGAGG - Intergenic
973288591 4:48447152-48447174 TGAGTATGGGTTTCTTTTGGGGG - Intergenic
974000053 4:56503693-56503715 TGGGTGTTGGCATTTTATGGAGG + Intergenic
974938949 4:68440687-68440709 TGCTTGTTTGCTTTTTTTGGGGG - Intergenic
975283605 4:72592113-72592135 TGGTGGTAGGCTTTTTTTGGGGG - Intergenic
975699642 4:77050954-77050976 TGGGTTTTGTTATCTTTTGGGGG - Intronic
975894566 4:79073292-79073314 TGGGTATTTTATTCTTTTGGTGG - Intergenic
976258400 4:83122523-83122545 GGAGTCTTGGCTTCTTTTAGTGG + Intronic
979362328 4:119779518-119779540 TGGGTATTTTCTTCTTTTTGTGG + Intergenic
981421471 4:144555333-144555355 TGTGTGTTGCTTTCTTTTGTGGG - Intergenic
982238111 4:153271602-153271624 TGGGTTTTGGTTTGTTTTAGTGG + Intronic
983256538 4:165406711-165406733 TGGGTATGGGGTTCTTTTTGAGG - Intronic
983484746 4:168320145-168320167 AGGATTTTGGCCTCTTTTGGAGG - Intergenic
983835734 4:172381387-172381409 TGGGTGTGGGGTTCCTTTTGGGG - Intronic
984239827 4:177204866-177204888 TTTGTGTTGGCTTTTTATGGGGG - Intergenic
985575652 5:672342-672364 TGGGTGGTGGCTTGGCTTGGGGG - Intronic
985905923 5:2836531-2836553 TGGTTGTTGGGTTTTTTTGTTGG - Intergenic
986036913 5:3949516-3949538 TGGGTGTTGGTTTCTGCTGCTGG + Intergenic
988014723 5:25539635-25539657 TGGGGGTTGGTTTCTTCTAGAGG - Intergenic
988486326 5:31670984-31671006 TGGGTGCAGGTTGCTTTTGGGGG + Intronic
991566139 5:68006703-68006725 TCGGGGTTGGTTTCTTCTGGAGG - Intergenic
991630036 5:68647417-68647439 AGGGTGTTGGCTTCTAGAGGTGG - Intergenic
991941385 5:71855827-71855849 TGGGTATGGGCTTTTTTTTGTGG - Intergenic
993113457 5:83688562-83688584 TGGATGTTGACCTCTTTTGTGGG + Intronic
994858771 5:105160810-105160832 TGGGTCTGGGCTTTTTTTAGTGG + Intergenic
995328745 5:110922348-110922370 GGGGTCTTGGCTTCTTTTATTGG + Intergenic
996097638 5:119415547-119415569 AAGATGGTGGCTTCTTTTGGGGG + Intergenic
996418217 5:123233161-123233183 TGGATGTAGACATCTTTTGGTGG - Intergenic
996704388 5:126482199-126482221 TGGGTATGGGCTTTCTTTGGGGG + Intronic
997078240 5:130706648-130706670 AGGGTCTTGGCTTCCTTTGGAGG - Intergenic
997236387 5:132274581-132274603 TGGGTGGTAGTTTCTGTTGGGGG - Intronic
997459823 5:134044338-134044360 CAGGTGTTGGCTGCTGTTGGAGG - Intergenic
998560847 5:143170305-143170327 TGGGTGGTGGCATCTTTTGGTGG + Intronic
998702434 5:144718245-144718267 TGTGTGTTGTTTTATTTTGGTGG - Intergenic
999011523 5:148046706-148046728 TGGCTGTGGGCTTCTCTTTGTGG - Intronic
999535361 5:152510831-152510853 ATGGTGCTGGCATCTTTTGGGGG - Intergenic
1000215644 5:159153423-159153445 TGGGTGTTTGGATCTTTTTGAGG + Intergenic
1002316055 5:178344161-178344183 TGGATTTTGGTATCTTTTGGGGG - Intronic
1002334320 5:178467513-178467535 TGTGTGTTGTCTTGTTTAGGGGG + Intronic
1002676947 5:180924574-180924596 TGGGTGTTGGGTTCTCTAGTTGG - Intronic
1002974226 6:2058486-2058508 AGGGTTTTGGCTTGTTTTGGGGG - Intronic
1004310453 6:14540571-14540593 AGGGTGAAGGCTTGTTTTGGAGG + Intergenic
1006305078 6:33213816-33213838 TGGGTGTTGTCTGCTTCTGCAGG - Intergenic
1006814878 6:36843364-36843386 TGGCTGAGGGCTGCTTTTGGAGG + Intergenic
1007867515 6:44989176-44989198 AGGGTGATGGGTTATTTTGGTGG - Intronic
1008931581 6:56945923-56945945 TGGGTATAGGTTTATTTTGGGGG + Intronic
1009443954 6:63716975-63716997 GGGGTGTAGACATCTTTTGGGGG + Intronic
1011575684 6:88795698-88795720 TGTTTGTTTGCTTTTTTTGGTGG - Intronic
1012496055 6:99834683-99834705 TTGGTGGTGGCTACTTTTTGGGG + Intergenic
1013348078 6:109281586-109281608 TGGGTGTTACCTTCTTTTTCTGG + Intergenic
1013393590 6:109712287-109712309 TGAATGTTGGCTTCTTTAGATGG + Intronic
1016094961 6:140024310-140024332 TGGGTCTTGGCTTTTCTTTGTGG + Intergenic
1016361249 6:143269499-143269521 TGTGTGTATTCTTCTTTTGGTGG - Intronic
1016422366 6:143898831-143898853 TGGGAGCTGACTTCTTTTGCAGG + Intronic
1017191973 6:151663926-151663948 TTGGTATCGGCTTCCTTTGGTGG + Intronic
1017457757 6:154617675-154617697 TAGGTGTTGGCTGTTTTTGAAGG - Intergenic
1017467682 6:154709923-154709945 TGGGAGTTGGGTACTTTTAGTGG - Intergenic
1019167587 6:170108785-170108807 TGTGTGGTGGCTCCTCTTGGTGG - Intergenic
1019889243 7:3932847-3932869 TGGGTGTTGGCTTCTTTTGGGGG - Intronic
1020314028 7:6891790-6891812 TGGTTGTTGGTTTCTTCTGTGGG - Intergenic
1020727796 7:11838055-11838077 TGGTTGTTTGGTTGTTTTGGTGG + Intergenic
1021098418 7:16559730-16559752 AGGGTGTGGGGTTATTTTGGGGG + Intronic
1022232578 7:28428485-28428507 TGGATTTTGGCTTATTTTGAAGG + Intronic
1024574600 7:50753653-50753675 TGTGTGGTGGCTCCATTTGGTGG - Intronic
1025717290 7:63972328-63972350 TGTGTATTTGCTTTTTTTGGTGG - Intergenic
1026614353 7:71888277-71888299 TGGGCGTGGGTTTATTTTGGGGG + Intronic
1027861839 7:83593887-83593909 TGGAAGTTGGCTTCTTTTGATGG + Intronic
1028182889 7:87747274-87747296 TGGCTCTTGGCTTCTACTGGGGG + Intronic
1028560299 7:92168027-92168049 TTGTTTTTGGCTTCTGTTGGTGG - Intronic
1028874416 7:95804846-95804868 TGGGTGTTGGGGTGTTGTGGGGG + Intronic
1029132818 7:98346008-98346030 TGGGTGAGGGTTTCTTTTTGCGG + Intronic
1031669168 7:124521402-124521424 TGGGTATTTGATTCTTTTTGTGG + Intergenic
1032363735 7:131279914-131279936 TGGGTATAGGGGTCTTTTGGGGG - Intronic
1034138389 7:148793425-148793447 TGGGTGCAGGTTTCTTTTTGGGG - Intronic
1036693400 8:10959090-10959112 TGGGTGTTGGCTCGCTTTGGGGG + Intronic
1037601194 8:20395501-20395523 TGGGGATTGGCTCCTTTTGAAGG + Intergenic
1037855946 8:22370728-22370750 GGGGTGTTAGTTTCTTCTGGAGG + Intronic
1038317381 8:26498685-26498707 TAGGTGTTGTATTCTTTTTGTGG - Intronic
1039092749 8:33849764-33849786 TTGTTGTTGGCTTCTGTTGTTGG - Intergenic
1039357820 8:36840765-36840787 TGGCTGTTGGTTACTTTAGGTGG + Intronic
1039448071 8:37648452-37648474 TCGTTGTTGGCTGCTTCTGGGGG + Intergenic
1042227726 8:66527436-66527458 TGGGTGTTGTCTGCTTTTCCTGG + Intergenic
1043424951 8:80139364-80139386 TGGATGTGGGTTTCTTTTTGGGG - Intronic
1044665307 8:94628643-94628665 TGTGTGGTGGGTTTTTTTGGGGG + Intergenic
1047887886 8:129272835-129272857 TGGGTGTTGGCTTGCTTTGCAGG - Intergenic
1048919686 8:139217001-139217023 GGGGTGTTGGCTTCGCTTAGAGG - Intergenic
1049198284 8:141327286-141327308 TTGGTGTTGTCTTGTTTTGTTGG - Intergenic
1051331301 9:16027352-16027374 TGGGTGTTCCTTTCTTTTGTTGG - Intronic
1052404751 9:28045166-28045188 TGTGTGTGGGTTTTTTTTGGAGG - Intronic
1052773269 9:32708758-32708780 TGGGTTTTTTTTTCTTTTGGTGG - Intergenic
1056321999 9:85443942-85443964 TGGGTATGAGCCTCTTTTGGCGG - Intergenic
1056534389 9:87515501-87515523 TGGGGATAGGCTTGTTTTGGGGG + Intronic
1056593634 9:87986516-87986538 TGGGTGTGGGCTGTTTTTGGAGG - Intergenic
1056640323 9:88364729-88364751 TGGTTGTTTGTTTGTTTTGGAGG - Intergenic
1056894710 9:90533528-90533550 TAGGTTAAGGCTTCTTTTGGTGG - Intergenic
1057320513 9:94008210-94008232 TCAGTGTTGGCTTCTGTTGATGG - Intergenic
1057501401 9:95599401-95599423 TGGGGTTTGGCTCCTCTTGGTGG - Intergenic
1057821004 9:98330866-98330888 TGGATATGGGTTTCTTTTGGGGG - Intronic
1059683047 9:116605064-116605086 TGTGTGTCGGCTTCCCTTGGTGG - Intronic
1059905342 9:118977991-118978013 TGGGTATGGGTTTCTTTTGGGGG - Intergenic
1059947432 9:119425290-119425312 TAGGTATGGGCTTCCTTTGGGGG - Intergenic
1060480998 9:124016853-124016875 TCGGTTTTGTCTTTTTTTGGGGG - Intronic
1185865732 X:3622380-3622402 TGGGTATTGGATTGTTTTGGGGG - Intronic
1186863996 X:13701173-13701195 TGGGTATGGGGTTTTTTTGGGGG - Intronic
1187518360 X:19991826-19991848 TGGATGTTGGATTCATTGGGAGG - Intergenic
1187684068 X:21798963-21798985 TAGGTATAGGCTGCTTTTGGAGG + Intergenic
1189933177 X:46036587-46036609 TGGGTACTGGTTTCTTTTTGGGG - Intergenic
1192102952 X:68284661-68284683 GGGGTTTGGGTTTCTTTTGGGGG - Intronic
1192334690 X:70207907-70207929 TGGGTGGGGGTTTCTTTCGGGGG + Intergenic
1192413664 X:70958023-70958045 TGGGTATAGGTTTCTTTTTGAGG + Intergenic
1193728551 X:85074159-85074181 TGGGTGTTGGCTTGTAATGAGGG + Intronic
1194645453 X:96453625-96453647 TGGGAATTGGGTCCTTTTGGGGG - Intergenic
1195153501 X:102097845-102097867 TGGGTGCTGGCTTCTTTCTCTGG - Intergenic
1195835167 X:109106561-109106583 TGGTTTTAGGCTTCATTTGGGGG + Intergenic
1195874139 X:109520698-109520720 TAGGAGTTGGGTTCCTTTGGAGG - Intergenic
1196130057 X:112145862-112145884 TGCTTGTTGGCTTTTTTTGAGGG - Intergenic
1198829005 X:140729031-140729053 TGTGTGATGGCTTGTTTTGTGGG - Intergenic
1200798070 Y:7359970-7359992 TAGGTATTGGATTGTTTTGGGGG + Intergenic