ID: 1019889244

View in Genome Browser
Species Human (GRCh38)
Location 7:3932848-3932870
Sequence GTGGGTGTTGGCTTCTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889244_1019889251 5 Left 1019889244 7:3932848-3932870 CCCCAAAAGAAGCCAACACCCAC 0: 1
1: 0
2: 0
3: 30
4: 222
Right 1019889251 7:3932876-3932898 TCTCACCTGTGTGTTCAGATAGG No data
1019889244_1019889252 6 Left 1019889244 7:3932848-3932870 CCCCAAAAGAAGCCAACACCCAC 0: 1
1: 0
2: 0
3: 30
4: 222
Right 1019889252 7:3932877-3932899 CTCACCTGTGTGTTCAGATAGGG 0: 1
1: 0
2: 3
3: 20
4: 131
1019889244_1019889254 11 Left 1019889244 7:3932848-3932870 CCCCAAAAGAAGCCAACACCCAC 0: 1
1: 0
2: 0
3: 30
4: 222
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889244 Original CRISPR GTGGGTGTTGGCTTCTTTTG GGG (reversed) Intronic
901879451 1:12185381-12185403 GTGGGTGTTGGCTTCATGACAGG + Intronic
902196278 1:14800906-14800928 GTGGGTAGGGGTTTCTTTTGGGG + Intronic
905456493 1:38091755-38091777 GTTGGTGATGGAGTCTTTTGTGG + Intergenic
905516506 1:38565742-38565764 GAGGTTGTTGGCTTGATTTGAGG + Intergenic
905997135 1:42391013-42391035 GTGGATGGTAGCTTCTTGTGGGG + Intronic
908264759 1:62367412-62367434 GTGGGTGTTGGGGTCATTTGGGG - Intergenic
909858227 1:80569053-80569075 TTGGGCATTGTCTTCTTTTGAGG - Intergenic
909936398 1:81556037-81556059 GTTGATGCTGACTTCTTTTGGGG - Intronic
910517198 1:88075182-88075204 GTGGATGTTGGCTGCTCCTGGGG + Intergenic
914349301 1:146826580-146826602 GTAGGAGTAGGCTTCTGTTGGGG - Intergenic
915643267 1:157246571-157246593 ATGGGTATGGGGTTCTTTTGGGG - Intergenic
915657359 1:157372442-157372464 GGGGCTGATGGCTTCTATTGAGG - Intergenic
915671633 1:157493971-157493993 GGGGCTGATGGCTTCTATTGAGG + Intergenic
915905764 1:159875828-159875850 GTGACTGTTGACTGCTTTTGGGG + Intronic
915970496 1:160351806-160351828 GTGAGTGTTGGCTTCTGATCAGG + Intronic
917512509 1:175680061-175680083 GTGGTTGTTGGCTTCAGCTGGGG - Intronic
918237386 1:182593529-182593551 GGGGGTGTTGGTTACTTTTATGG + Intergenic
919283543 1:195522698-195522720 GTGGGTATTTTCTTTTTTTGTGG - Intergenic
919805306 1:201377805-201377827 GGGGGTGTTGGCTGCTATTTTGG + Intronic
919806402 1:201383294-201383316 GTGGGTGGGGGCTTCTCCTGAGG - Intronic
923573609 1:235139006-235139028 GTGGGTGTTGTGTTCTTTCCAGG + Intronic
1064284111 10:13977619-13977641 ATGGGTGTGGTTTTCTTTTGGGG - Intronic
1064516183 10:16151244-16151266 ATGGGTGTGAGTTTCTTTTGGGG + Intergenic
1065866210 10:29917552-29917574 CTGGGAGTTGGTTTCATTTGTGG + Intergenic
1067778483 10:49179792-49179814 GTGGGAGCTGGCTTTTCTTGGGG - Intronic
1070598629 10:77850174-77850196 ATGGGTATTGGTTTCTTTTTGGG - Intronic
1071376488 10:85010714-85010736 GTGGGTGTTGTCCTGTGTTGAGG - Intergenic
1077761759 11:5107829-5107851 GATGGTGTGGGCATCTTTTGAGG - Intergenic
1078432415 11:11298178-11298200 GTGAGGGGTGGCTTCTTTGGAGG - Intronic
1079091145 11:17481084-17481106 CTGGGTGTTGGCTGTTTTAGAGG - Intergenic
1079774574 11:24508265-24508287 TTTTGTGTTGGCTTCATTTGTGG + Intronic
1080676282 11:34430577-34430599 GTGGCTTCTGGCTTCTTTTGAGG + Intergenic
1083172165 11:60929467-60929489 GTGGGTGGGGGCTGCTTTGGGGG - Intronic
1083927211 11:65815195-65815217 GGGGGTGATGGCTCCATTTGAGG + Intergenic
1084230329 11:67747758-67747780 GTGGTTGTTGGTTTCTTCTGTGG - Intergenic
1084239909 11:67811986-67812008 TTTGCTGTTGCCTTCTTTTGTGG - Intergenic
1088898957 11:114100471-114100493 ATGGGGGTTGACTTATTTTGAGG + Intronic
1090037161 11:123259140-123259162 GTGGGTTTTGTCTGGTTTTGAGG - Intergenic
1092086320 12:5765481-5765503 GTCGGTATTGGTATCTTTTGTGG + Intronic
1092141790 12:6189098-6189120 GTGGCTGCTGGCTTCTGTTCTGG - Intergenic
1092491794 12:8952144-8952166 GTGGGTGTAGGTTTATTGTGGGG - Intronic
1095906306 12:47381792-47381814 TTGGGTCTTTGCTTCTTTTCTGG - Intergenic
1098819632 12:75210366-75210388 GTTAGGGTTGGCTTCTTCTGAGG + Intergenic
1101163946 12:102008816-102008838 GTTGGTCTTGCCTTCTCTTGTGG - Intronic
1101986477 12:109451236-109451258 GTGGGTGTCGACTTCCTATGTGG - Exonic
1102003272 12:109572072-109572094 ATAGGTGTTGGCTACCTTTGGGG - Intronic
1103204678 12:119119323-119119345 CTGGGTTTTGGTTTCTTTTCTGG - Intronic
1103523819 12:121553811-121553833 ATGGGTGTGGGGTTCTTCTGGGG + Intronic
1105019165 12:132805022-132805044 GTGGTTGTTGGGATCTTTTCAGG - Exonic
1105339371 13:19505624-19505646 GTGGGTTTGGGTTTCGTTTGGGG + Intronic
1108670133 13:52678307-52678329 GTGTGTGTTGTTTTGTTTTGAGG + Intronic
1109185039 13:59258410-59258432 GTGTGAGTTGGCTTGTTATGTGG - Intergenic
1110332439 13:74288188-74288210 TTGTCTGTTTGCTTCTTTTGCGG - Intergenic
1111048673 13:82849026-82849048 GTGGGATTTGGCTTCTGTAGTGG + Intergenic
1112556145 13:100470246-100470268 GTGTGTTTTGGGTTTTTTTGGGG + Intronic
1113321100 13:109233166-109233188 GTAGTTGTTGGGTTTTTTTGGGG + Intergenic
1113788058 13:113013256-113013278 CTCGGCGATGGCTTCTTTTGTGG - Intronic
1114074425 14:19148838-19148860 GCAGGTGTTGGCTTCTTTTCTGG + Intergenic
1114087843 14:19251137-19251159 GCAGGTGTTGGCTTCTTTTCTGG - Intergenic
1114835586 14:26199471-26199493 GTGGGGGTTGTTTTCTTTTCTGG - Intergenic
1116107469 14:40528023-40528045 GTGGGTGTTGGATTACTTTGAGG + Intergenic
1116214782 14:42000152-42000174 ATGGATGTTGGTTTCTTTTAGGG - Intergenic
1117850960 14:59968859-59968881 GTGGGTGGTGGCTACTCTTTTGG - Intronic
1118349490 14:64963491-64963513 GTGGGTCTTGGCTGCCTCTGTGG - Intronic
1118759192 14:68868832-68868854 GTTGCTGATGGCTTCTGTTGGGG - Intergenic
1119907215 14:78316815-78316837 CTTGGTGTTGGCTTCATTTTTGG + Intronic
1120492022 14:85190262-85190284 GTGGGTGGTGGATGCTTTTATGG - Intergenic
1122231453 14:100308044-100308066 TTGGGTCTGGGCTTCTCTTGGGG - Intergenic
1124485935 15:30116286-30116308 GTGGGTGTTGGTTCCTTTACTGG + Intergenic
1124517640 15:30380983-30381005 GTGGGTGTTGGTTCCTTTACTGG - Intronic
1124541012 15:30585272-30585294 GTGGGTGTTGGTTCCTTTACTGG + Intergenic
1124547716 15:30647056-30647078 GTGGGTGTTGGTTCCTTTACTGG + Intronic
1124757647 15:32422312-32422334 GTGGGTGTTGGTTCCTTTACTGG - Intergenic
1130113327 15:80984619-80984641 GTGGTTGAAGGTTTCTTTTGGGG + Intronic
1130134244 15:81168683-81168705 GTGAGTGTTTGTTTGTTTTGTGG + Intronic
1131854026 15:96572988-96573010 TTGGGAGTTGGGTTCTATTGGGG + Intergenic
1131940268 15:97556789-97556811 ATGGATTTTGGCTTCTGTTGAGG + Intergenic
1132322562 15:100936663-100936685 GTGGGTGCTGGCTGCTTCTATGG + Intronic
1133382339 16:5341744-5341766 GTGGATGGTGGCCCCTTTTGTGG + Intergenic
1133767088 16:8845529-8845551 GAGGGTGTTTGGCTCTTTTGAGG + Intronic
1133840518 16:9404139-9404161 TTGTGTGTTTGATTCTTTTGTGG + Intergenic
1134118150 16:11564906-11564928 ATGGGTATGGGGTTCTTTTGGGG + Intronic
1134163686 16:11913851-11913873 GTGGTTGATGTTTTCTTTTGAGG - Intronic
1136000139 16:27286266-27286288 CTGGGAGGTGGCTTCATTTGGGG + Intronic
1136594627 16:31239595-31239617 GGAGGTGTTGGCTTCTTCTGAGG + Intergenic
1137344345 16:47641104-47641126 GTGGGTGGTGTGTTTTTTTGTGG + Intronic
1139984735 16:70888974-70888996 GTAGGAGTAGGCTTCTGTTGGGG + Intronic
1140383461 16:74512068-74512090 ATGGGTGTGGGCTTCTGTTTGGG - Intronic
1140862800 16:79033813-79033835 GTGTGTGATGTGTTCTTTTGTGG + Intronic
1141445597 16:84055856-84055878 TTGGCTCTTGGCTTCTTTTGTGG - Intronic
1141980651 16:87547960-87547982 GTGGGTAGTGGCATGTTTTGTGG + Intergenic
1143621751 17:8084792-8084814 GTGTCTGTTGGCTTCCCTTGAGG - Intronic
1143653027 17:8275977-8275999 CTGGGTCTTGGCATCTTGTGGGG + Intergenic
1144366418 17:14549190-14549212 GTGGGATGTGGCTTCTGTTGTGG + Intergenic
1144778870 17:17798085-17798107 TTGAGTTTTGGCTTCTTTTTGGG - Exonic
1145296668 17:21598395-21598417 GTGGCTGTTGGTTTATATTGAGG - Intergenic
1145367111 17:22273683-22273705 GTGGCTGTTGGTTTATATTGAGG + Intergenic
1146089604 17:29863115-29863137 GTGGCTTTTGGCATCTTTAGGGG + Intronic
1148141176 17:45329985-45330007 GTGGTTGTTGGCTTTCTCTGCGG + Intergenic
1150748061 17:67832679-67832701 GACGGTGCGGGCTTCTTTTGCGG - Intronic
1150861182 17:68802511-68802533 GTTGTTGTTGGTTTGTTTTGGGG - Intergenic
1151656183 17:75497085-75497107 GTGGCTCTTGGCTTCTTTCCTGG + Intronic
1151920966 17:77155301-77155323 GTGTGTGTTTGTTTCTGTTGGGG - Intronic
1151961334 17:77407538-77407560 GTGGGTGTTGGCTTCAGTGTGGG + Intronic
1152064931 17:78106147-78106169 GTGGGTTGTGACTGCTTTTGGGG + Exonic
1153507999 18:5822797-5822819 GAAGGTGATGGCTTGTTTTGGGG - Intergenic
1155504859 18:26523369-26523391 GTGGGATTTGGCTTATTTTGAGG + Intronic
1156649921 18:39213416-39213438 TTGGGTGTGGGCATCTTTTATGG - Intergenic
1158509280 18:58076132-58076154 GTTGCTGTTTGCTTTTTTTGTGG + Intronic
1159653011 18:70999886-70999908 GTGGCTGTTGCCTGCCTTTGAGG - Intergenic
1159939136 18:74392714-74392736 GTGGGTGTAGGGTTCTCGTGGGG - Intergenic
1160354621 18:78216460-78216482 GTCCCTGCTGGCTTCTTTTGAGG + Intergenic
1160879020 19:1311177-1311199 ATGGGTGCTGGCTTCTTCAGAGG - Intergenic
1161633671 19:5373458-5373480 GTGGGTGTGGGCTTCTTCTCTGG + Intergenic
1161871053 19:6870267-6870289 GTGGGTGCTGTTTTATTTTGGGG + Intergenic
1162014968 19:7840583-7840605 ATGGGTGTAGGTTTCTTTTTGGG - Intronic
1163812162 19:19440106-19440128 GTAGGTGATGTCTTCATTTGTGG + Intronic
1164506898 19:28868396-28868418 GTGGGTGATGGGATCATTTGTGG + Intergenic
1166574232 19:43822189-43822211 GTGGGTATTGGTGTCTTTTTGGG + Intronic
1168387350 19:55975433-55975455 GTGGGTTTTTATTTCTTTTGTGG - Intronic
1168645593 19:58057059-58057081 GGGGGTGTTGGAGTCTTTGGGGG - Intergenic
1168723606 19:58569086-58569108 GTGGTGGGTGGCTTTTTTTGAGG + Intronic
928130031 2:28642656-28642678 CTGGGTGTTGACCTCTTTAGAGG + Intronic
929680039 2:43984731-43984753 GTGGGTGTGATCTTCTTGTGGGG - Intronic
929769159 2:44877635-44877657 GTGGGTGCTGGCTGGTGTTGGGG - Intergenic
929925936 2:46208829-46208851 GTTGTTGTTGGTTTCTTTTTTGG + Intergenic
932662047 2:73663438-73663460 GTGGCTGTTGGCTGCTTTGGTGG + Intergenic
932702051 2:73998788-73998810 GGGGGTGTTGGGTTTTTTTTTGG + Intronic
938035221 2:128029119-128029141 GTAGGTGTTGGCAACTTTTGGGG - Intergenic
938451204 2:131422939-131422961 GTGTGTGTTGGCATCTTTTTTGG + Intergenic
938743461 2:134254458-134254480 GTGACTTTTGGCTTCATTTGGGG + Exonic
940942293 2:159575513-159575535 TTGGGTGTTGACTTCTTTGGAGG - Intronic
941732602 2:168934886-168934908 GTGGGGCTTGCCCTCTTTTGTGG + Intronic
941818475 2:169822234-169822256 GTGGGTATTAGCTTCCTTTATGG - Intronic
941999767 2:171634233-171634255 CTGAGTGGTGGCTTCTTTTATGG - Intergenic
942905694 2:181178085-181178107 GTTGATGCTGGCTTCTGTTGAGG + Intergenic
948681497 2:239638134-239638156 GTGGGTCTTGGCTTCCTTACTGG + Intergenic
1169715987 20:8618720-8618742 GTGTGTGTGTGCTTCTTTTGAGG - Intronic
1169934301 20:10866326-10866348 CTGGGTGAGGGCTGCTTTTGAGG + Intergenic
1171998738 20:31754586-31754608 GTGGGTGTTTTTTTCTTCTGAGG + Intronic
1172849258 20:37948887-37948909 ATGGGTGTGAGTTTCTTTTGGGG + Intergenic
1173810553 20:45952640-45952662 GTGGGTGCCAGCTTCTTTTAGGG + Exonic
1175889454 20:62309892-62309914 GGGTGGGGTGGCTTCTTTTGGGG - Intronic
1178429340 21:32505274-32505296 GTGGTTGATGGTTTCTTCTGTGG + Intronic
1178504410 21:33151399-33151421 GTGGGTGTTTTGTTGTTTTGTGG + Intergenic
1178687993 21:34726471-34726493 GTGTGTCTTCTCTTCTTTTGAGG - Intergenic
1180290070 22:10841778-10841800 GCAGGTGTTGGCTTCTTTTCCGG + Intergenic
1180492868 22:15871200-15871222 GCAGGTGTTGGCTTCTTTTCCGG + Intergenic
1180957450 22:19747326-19747348 TTGGGTCTGGGCTTCTTCTGTGG - Intergenic
1183053786 22:35288261-35288283 GTGGGTGGGGACTTCTTCTGGGG - Exonic
950868365 3:16207848-16207870 GTGGCTCTTAACTTCTTTTGGGG - Intronic
951689290 3:25378805-25378827 GTGTGTCTTGGTTTCTTATGAGG + Intronic
952893752 3:38062746-38062768 ATCGGTGCTGGCTTCTTTGGAGG - Exonic
953672506 3:44975308-44975330 GTTGGGGTTGGCTTTTTTTCGGG + Intronic
955286559 3:57647281-57647303 GTTGTTGTTTGTTTCTTTTGTGG - Intronic
955483283 3:59410953-59410975 CTGTGTGTTGGCTTCATTTTAGG - Intergenic
956494484 3:69809726-69809748 GTTGTTGTTTGCTTCTTTTGTGG + Intronic
956606031 3:71073971-71073993 GTGATTGGTGGCTTCTTTAGAGG - Intronic
957046898 3:75382789-75382811 GTGGTTGTTGGTTTCTTCTGTGG - Intergenic
958260551 3:91375608-91375630 GTGACTGTTGGTTTCTTTGGTGG + Intergenic
959339119 3:105105663-105105685 GTTGTTGTTGGGTTTTTTTGGGG + Intergenic
960259790 3:115553903-115553925 GTGGGTGTTGGTGTCATTTCAGG + Intergenic
960815449 3:121667177-121667199 GTAGGTGTTGGGTTCTCTAGAGG - Intronic
961299002 3:125909951-125909973 TTTGCTGTTGCCTTCTTTTGTGG + Intergenic
961878966 3:130046857-130046879 GTGGTTGCTGGTTTCTTCTGTGG - Intergenic
966743345 3:183253897-183253919 GGGAGTGTTGGCTTCCTTTCCGG + Intronic
966996821 3:185290573-185290595 GTGGGTGTTGCTTTCTGTTCTGG + Intronic
968991193 4:3913904-3913926 GTGGTTGTTGGTTTCTTCTGTGG - Intergenic
969516185 4:7649377-7649399 GAGGGTGTGGGCTTTTTTGGAGG + Intronic
969824158 4:9743629-9743651 GTGGTTGTTGGTTTCTTCTGTGG + Intergenic
970291129 4:14573452-14573474 GTGAGTGTTGGCTCCTTGTGAGG - Intergenic
970564982 4:17323278-17323300 CCGGGTGTTGTCTTGTTTTGGGG - Intergenic
972497690 4:39649082-39649104 GAGGGTGCCTGCTTCTTTTGTGG + Intergenic
973719353 4:53707574-53707596 GTGCCTGTTGGTTTCTTCTGAGG + Intronic
974751423 4:66146172-66146194 GTGTGTGTGAGTTTCTTTTGTGG + Intergenic
975632975 4:76420903-76420925 GTGGGAGTGGGGTTCTTCTGAGG - Intronic
976587138 4:86811622-86811644 GTGGGTGATGGTTTCCTTTCAGG - Intronic
980671246 4:136009373-136009395 ATGGGTGCTGGCTTCCTGTGAGG - Intergenic
981421472 4:144555334-144555356 GTGTGTGTTGCTTTCTTTTGTGG - Intergenic
986144216 5:5062119-5062141 ATGGGTGTTTTCTTCTTTGGCGG - Intergenic
990167229 5:53008189-53008211 GTTGGTGTTGGTTTCTACTGAGG + Intronic
992143149 5:73819508-73819530 GTGGGTGATGTCTTCTTTCTTGG + Intronic
992321664 5:75619209-75619231 GTGGGTTTTGCAGTCTTTTGTGG - Intronic
993113456 5:83688561-83688583 ATGGATGTTGACCTCTTTTGTGG + Intronic
993593485 5:89824968-89824990 GGGGGTGTTGTCTTCTCATGTGG - Intergenic
995137841 5:108699753-108699775 GTGGGTGTTTTCTTTTTATGAGG + Intergenic
995607422 5:113871992-113872014 CTGGGATTTGGCTGCTTTTGAGG + Intergenic
996143434 5:119943692-119943714 GTTGGGGTTGGTTTCTTTAGAGG + Intergenic
997603650 5:135157191-135157213 GTGGGTATTGGCTCCTGATGGGG + Intronic
999535362 5:152510832-152510854 GATGGTGCTGGCATCTTTTGGGG - Intergenic
1002698745 5:181107904-181107926 GTGGGTGTTTGCTGCTTTGTGGG + Intergenic
1002974227 6:2058487-2058509 GAGGGTTTTGGCTTGTTTTGGGG - Intronic
1004306842 6:14508923-14508945 GTGAGGGTTGGTTTCTTCTGAGG - Intergenic
1006303442 6:33206093-33206115 GTGGGTGAAAGCTTCTTTTATGG - Intronic
1007246492 6:40467013-40467035 GGCAGGGTTGGCTTCTTTTGAGG - Intronic
1007514337 6:42399479-42399501 TTGGGTGTTGGCTTCCATTCAGG - Intronic
1007819751 6:44552493-44552515 CTGGGTATTGGCTTAATTTGGGG + Intergenic
1009183206 6:60543593-60543615 GTGACTGTTGGTTTCTTTGGTGG - Intergenic
1009645063 6:66391008-66391030 GAGGGTGTTGGCCTCTCCTGAGG + Intergenic
1012496054 6:99834682-99834704 GTTGGTGGTGGCTACTTTTTGGG + Intergenic
1012760320 6:103293562-103293584 TTGTTTGTTGCCTTCTTTTGAGG - Intergenic
1014745355 6:125193910-125193932 GTGGGTTTTTGCTTTTCTTGAGG + Intronic
1017333897 6:153232508-153232530 TTAGGTGTAGGTTTCTTTTGAGG - Intergenic
1017748363 6:157467281-157467303 GTGGGTATGGGTTTCTTTTTAGG - Intronic
1017794001 6:157824527-157824549 ATAGGTGTTTGCTTTTTTTGTGG + Intronic
1017829209 6:158110011-158110033 ATGGGTATGGGGTTCTTTTGGGG + Exonic
1019889244 7:3932848-3932870 GTGGGTGTTGGCTTCTTTTGGGG - Intronic
1020223642 7:6261756-6261778 CTGCCTGTTGGCTTCATTTGAGG - Intronic
1020314029 7:6891791-6891813 GTGGTTGTTGGTTTCTTCTGTGG - Intergenic
1023061671 7:36333388-36333410 ATGGGTATGGGTTTCTTTTGAGG + Intronic
1024570138 7:50716388-50716410 TTGGGTGTTGGCTACTTCTTGGG - Intronic
1026967202 7:74447858-74447880 GTGGGTTTGGCCTGCTTTTGCGG + Intergenic
1028973819 7:96890085-96890107 CAAGGTGTTGGCTTCTTCTGAGG + Intergenic
1034067114 7:148147659-148147681 GCGGGTGTGGCCTTCTGTTGGGG - Exonic
1035724322 8:1815075-1815097 GTGGGTGTTGGCATCTATGCTGG + Intergenic
1036693399 8:10959089-10959111 TTGGGTGTTGGCTCGCTTTGGGG + Intronic
1037579116 8:20234329-20234351 GTTGGTCTTGACTTCTCTTGTGG + Intergenic
1038498406 8:28023647-28023669 GTAGGTTTGGGTTTCTTTTGAGG - Intronic
1039295633 8:36149477-36149499 GTGGGAGAAGGCTTCTTTAGTGG + Intergenic
1039532415 8:38275437-38275459 GTTGGTTTGGGATTCTTTTGTGG - Exonic
1040357904 8:46637498-46637520 GTGAGTGTTGTATTCTTTTGTGG - Intergenic
1041758488 8:61339020-61339042 GTGTGTGTGTGCTTCTTTTGAGG + Intronic
1041845534 8:62323576-62323598 GTGGATTTTGCCATCTTTTGTGG + Intronic
1044665306 8:94628642-94628664 GTGTGTGGTGGGTTTTTTTGGGG + Intergenic
1049068624 8:140339149-140339171 GGTGGTGCTGGCTTGTTTTGAGG - Intronic
1050840946 9:10148219-10148241 GTGAGTGTTGCCTTCTTTCCCGG - Intronic
1051672540 9:19525962-19525984 GTGGGTATGGGTTTCTTCTGGGG - Intronic
1052938051 9:34109807-34109829 GTGGGTGTGGGCAGCTTTAGGGG + Intronic
1053439383 9:38103735-38103757 ATGGGTGTGGGTTTCCTTTGGGG + Intergenic
1053883281 9:42617075-42617097 TGGGGTGTGGGTTTCTTTTGGGG + Intergenic
1053889388 9:42677224-42677246 TGGGGTGTGGGTTTCTTTTGGGG - Intergenic
1054807881 9:69410886-69410908 GAGGGTGGTGGCTTGTTCTGAGG - Intergenic
1055349862 9:75375610-75375632 GTGTGTGTTGGCTTTATTTGAGG - Intergenic
1055582363 9:77720469-77720491 GTGTCTGTTGGCATCTTTTTTGG + Exonic
1057327524 9:94079463-94079485 TTGGGTGGTGGCTGTTTTTGAGG + Intronic
1058480718 9:105391831-105391853 GTGGTTTTTGTCTTCTTCTGTGG + Exonic
1059068856 9:111113949-111113971 GGGGGTTTAGGATTCTTTTGTGG - Intergenic
1059905343 9:118977992-118978014 ATGGGTATGGGTTTCTTTTGGGG - Intergenic
1059943093 9:119377018-119377040 CTGGGTGTTTGCTTCCTTTTAGG - Intergenic
1062321402 9:135992178-135992200 GTGGGTGTTCTGTTCTTTTCTGG - Intergenic
1185865733 X:3622381-3622403 ATGGGTATTGGATTGTTTTGGGG - Intronic
1187724874 X:22192063-22192085 GTTGGTGGTGGCTTGTCTTGGGG + Intronic
1191615792 X:63168212-63168234 GTTGTTGTTGTTTTCTTTTGAGG - Intergenic
1191620506 X:63210711-63210733 GTTGTTGTTGTTTTCTTTTGAGG + Intergenic
1191806421 X:65139555-65139577 TTGGGTGTTGGCACCTTTTGTGG + Intergenic
1191991168 X:67038645-67038667 CTGGGTGTTGCATTCTATTGTGG + Intergenic
1193728550 X:85074158-85074180 GTGGGTGTTGGCTTGTAATGAGG + Intronic
1194081202 X:89467392-89467414 GTGGGTCTTAGCCTATTTTGTGG + Intergenic
1194368517 X:93039402-93039424 TTGGTTGTGGGCTTTTTTTGTGG + Intergenic
1196130058 X:112145863-112145885 TTGCTTGTTGGCTTTTTTTGAGG - Intergenic
1198829006 X:140729032-140729054 TTGTGTGATGGCTTGTTTTGTGG - Intergenic
1200433874 Y:3123589-3123611 GTGGGTCTTAGCCTATTTTGTGG + Intergenic
1200676720 Y:6155679-6155701 TTGGTTGTGGGCTTTTTTTGTGG + Intergenic