ID: 1019889245

View in Genome Browser
Species Human (GRCh38)
Location 7:3932849-3932871
Sequence GGTGGGTGTTGGCTTCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889245_1019889251 4 Left 1019889245 7:3932849-3932871 CCCAAAAGAAGCCAACACCCACC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1019889251 7:3932876-3932898 TCTCACCTGTGTGTTCAGATAGG No data
1019889245_1019889252 5 Left 1019889245 7:3932849-3932871 CCCAAAAGAAGCCAACACCCACC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1019889252 7:3932877-3932899 CTCACCTGTGTGTTCAGATAGGG 0: 1
1: 0
2: 3
3: 20
4: 131
1019889245_1019889254 10 Left 1019889245 7:3932849-3932871 CCCAAAAGAAGCCAACACCCACC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889245 Original CRISPR GGTGGGTGTTGGCTTCTTTT GGG (reversed) Intronic
900901028 1:5515979-5516001 GGTGGGGGTGGGCTTCTGTTTGG - Intergenic
901028098 1:6289911-6289933 TTTGGGTGTGGGCATCTTTTGGG - Intronic
901222146 1:7589282-7589304 GGTGGGTGTTGCCCTCTTCCTGG + Intronic
903373377 1:22850973-22850995 TGTGGGTTTTTGTTTCTTTTTGG + Intronic
903905204 1:26680795-26680817 GGTGTGTGTTGTCTTTTATTTGG - Intergenic
903993719 1:27291575-27291597 GGTGGGAGTTTGCTGCTGTTTGG + Intronic
904266305 1:29320245-29320267 GGTGGGGGAGGGCTTCTTTGAGG + Intronic
906215727 1:44037206-44037228 GTTGGGTGTTGGCTTTTTTGTGG + Intergenic
908264760 1:62367413-62367435 GGTGGGTGTTGGGGTCATTTGGG - Intergenic
909483776 1:76152280-76152302 GGTGGCTGTCAGCTTCTTCTAGG - Intronic
909936399 1:81556038-81556060 GGTTGATGCTGACTTCTTTTGGG - Intronic
910517197 1:88075181-88075203 GGTGGATGTTGGCTGCTCCTGGG + Intergenic
915311315 1:155007233-155007255 GCAGGGTGTGGGCATCTTTTGGG - Intronic
915452990 1:156019913-156019935 GGTGGGTAGTGGTTTCTCTTTGG - Intronic
916287606 1:163127753-163127775 TGTGTGTGTAGGCTTGTTTTAGG - Intronic
917512510 1:175680062-175680084 GGTGGTTGTTGGCTTCAGCTGGG - Intronic
918597265 1:186307506-186307528 GGTGGGTGCAGGCTTCTTGGTGG - Exonic
919270843 1:195342283-195342305 GGTGTTTGTTTGCTTGTTTTAGG + Intergenic
920248520 1:204606266-204606288 GGAGGGAGTGGGCTTGTTTTTGG - Intergenic
920781811 1:209000080-209000102 GGTTGTTGTAGACTTCTTTTGGG - Intergenic
922767355 1:228162989-228163011 TGTTGGTGGTGGCTTCTTTGGGG + Intergenic
924029545 1:239872455-239872477 GGTGGGTGTTTAGTTCTCTTTGG - Intronic
1064619120 10:17196730-17196752 GGTGAGTTCTGGCTTCTATTTGG - Intronic
1064621403 10:17221416-17221438 GGTGGGTATTAGATTCTTGTAGG + Intergenic
1068928437 10:62564031-62564053 GCTGGCTGCTGGCTTCTTATTGG - Intronic
1069207966 10:65716786-65716808 GATGTGTGTTGGTTGCTTTTAGG - Intergenic
1070598630 10:77850175-77850197 GATGGGTATTGGTTTCTTTTTGG - Intronic
1075841527 10:125508692-125508714 TGTGGGTGTTGGCTGCCATTTGG + Intergenic
1076399624 10:130173063-130173085 AGTGGGGGCTGGCTTGTTTTTGG + Intronic
1079832909 11:25292460-25292482 GGTGGGTGATGAATCCTTTTCGG + Intergenic
1083172166 11:60929468-60929490 GGTGGGTGGGGGCTGCTTTGGGG - Intronic
1084755337 11:71234921-71234943 GGTGGGTGTTTTGTTCTTTCTGG - Intronic
1087017034 11:93564043-93564065 GGTGGGTGGTGGCTTGGTGTGGG - Intergenic
1087740599 11:101882824-101882846 CCTTGGTGTTGACTTCTTTTGGG - Intergenic
1087817765 11:102678180-102678202 GGTGGGTGTTGGCCTTTTCTGGG + Intergenic
1089191874 11:116659559-116659581 AGAGCGTGTTGGCTTCTTTGGGG - Intergenic
1092130914 12:6112611-6112633 GGGGAGTGTGGGCTTCTTCTTGG + Intronic
1093872254 12:24306574-24306596 GCTGGATGTGGGCTTCTTTGTGG - Intergenic
1095785866 12:46108515-46108537 TGTGGGGCTTGGCTGCTTTTTGG + Intergenic
1097593550 12:61600601-61600623 GATGGGTGTTTGCTTTTGTTTGG + Intergenic
1097908692 12:64946567-64946589 GGTGGGGCTTGGGTTCTTCTGGG + Intergenic
1100847638 12:98676978-98677000 GGTGGGTGTTTCCTTCAGTTAGG + Intronic
1101039506 12:100740105-100740127 GGTAAGTGTTGGCTTCCTGTTGG + Intronic
1107713965 13:43180339-43180361 GGTTGCTGTTGGCTTGTTGTGGG - Intergenic
1109845332 13:67981731-67981753 GCTGGGTGTTTGCTTTATTTGGG + Intergenic
1110556991 13:76870739-76870761 TTTTGGTGTTGGCTTCTTTTGGG - Intergenic
1113511314 13:110856905-110856927 GGTTGGTATTGGCTTCTGGTGGG + Intergenic
1114504251 14:23196851-23196873 GGTGGGTGGGGGCTTCTTTGAGG - Intronic
1114666901 14:24383201-24383223 AGTGGGTGTTGGCTGCTGGTGGG + Intergenic
1114929222 14:27446947-27446969 GGGGGGTGCTGGCTTATTTCAGG + Intergenic
1116214783 14:42000153-42000175 AATGGATGTTGGTTTCTTTTAGG - Intergenic
1116392692 14:44412790-44412812 GATTGGTGTAGGCTTCTATTTGG - Intergenic
1121414236 14:93767935-93767957 GGTAGGTATGGGTTTCTTTTAGG + Intronic
1125215593 15:37269787-37269809 AGTAGGAATTGGCTTCTTTTTGG + Intergenic
1127534108 15:59874051-59874073 GGTGGGTGTTTTCTTCTTAAGGG - Intergenic
1128280122 15:66387352-66387374 GATGGGCGTCGGCTTCTTCTTGG - Exonic
1131033963 15:89208988-89209010 GGTAAGTGCTGGCTTCTTCTGGG - Intergenic
1133587442 16:7209560-7209582 GGTGAGGGTTGGCCTCTTTGAGG - Intronic
1136075884 16:27817022-27817044 GCTGGGTGTTTGCTCTTTTTAGG + Intronic
1137787776 16:51151985-51152007 GGTGGGGGTGGGCTGCTTTCTGG - Intergenic
1137918034 16:52454355-52454377 AGTGGGAGATGGCATCTTTTTGG - Intronic
1140085627 16:71793605-71793627 AGTGGGAGTTGGCTACTTTTTGG - Intronic
1140195143 16:72849111-72849133 GGCGGGCGTTGGCCTCTTCTGGG - Intronic
1140383462 16:74512069-74512091 AATGGGTGTGGGCTTCTGTTTGG - Intronic
1141933429 16:87219914-87219936 GGTGGTTGGTGGCTTGTTGTTGG + Intronic
1141948472 16:87325654-87325676 GGTGGGTGTTTCCTTCTCTAAGG - Intronic
1143830574 17:9647253-9647275 GGTGGGGGTTGGCATCTCATGGG - Intronic
1144778871 17:17798086-17798108 CTTGAGTTTTGGCTTCTTTTTGG - Exonic
1147293484 17:39462004-39462026 GGTGGGTGGGGGTTGCTTTTTGG + Intronic
1148356216 17:46977655-46977677 GGTGGGGGTTGGCGGCTTTGTGG - Intronic
1150718460 17:67593365-67593387 GGTGGGTAGTGGCTGTTTTTTGG + Intronic
1151920967 17:77155302-77155324 GGTGTGTGTTTGTTTCTGTTGGG - Intronic
1151961333 17:77407537-77407559 GGTGGGTGTTGGCTTCAGTGTGG + Intronic
1152125294 17:78443111-78443133 GGTGGCTGTTTCCTTCTTTTAGG + Intronic
1152291945 17:79444902-79444924 AATGGGTGTGGGTTTCTTTTTGG - Intronic
1152496331 17:80675314-80675336 GGATGAAGTTGGCTTCTTTTAGG + Intronic
1152560651 17:81077153-81077175 GGTGGGCGTGGGTTTCTCTTCGG + Intronic
1153133035 18:1879529-1879551 GGTGGGTGTGGCCTTATTTCTGG + Intergenic
1153500721 18:5746761-5746783 GGTGGGTGGTTGTTTCTGTTTGG + Intergenic
1155847884 18:30731709-30731731 GATGGGTGCTTGCTTCTTCTGGG - Intergenic
1156368605 18:36452143-36452165 GGTGCGTCTTGGCATTTTTTTGG + Intronic
1157942234 18:51942026-51942048 TGTGGGTGTTTCATTCTTTTAGG + Intergenic
1158603566 18:58875588-58875610 GGTTGGTGTTTGCTTCATTATGG + Intronic
1159939137 18:74392715-74392737 GGTGGGTGTAGGGTTCTCGTGGG - Intergenic
1161871052 19:6870266-6870288 GGTGGGTGCTGTTTTATTTTGGG + Intergenic
1162014969 19:7840584-7840606 TATGGGTGTAGGTTTCTTTTTGG - Intronic
1163145509 19:15377147-15377169 GTTGTGTGATGGCTTTTTTTTGG - Intronic
1164054646 19:21611945-21611967 GGTGGGTTCTTGCTTATTTTTGG + Intergenic
1166574231 19:43822188-43822210 AGTGGGTATTGGTGTCTTTTTGG + Intronic
1167777754 19:51572024-51572046 GGTCAGTGTTGGCCTCTTCTTGG + Intronic
927487682 2:23499910-23499932 AGGAGGTGTTGGCTTTTTTTAGG + Intronic
928293415 2:30060367-30060389 GATTGGTGATGGCTTCTATTTGG - Intergenic
929412327 2:41710905-41710927 GGTGTGTGAGGGCTTCTATTGGG + Intergenic
929680040 2:43984732-43984754 GGTGGGTGTGATCTTCTTGTGGG - Intronic
931095049 2:58930273-58930295 AGAGGTTTTTGGCTTCTTTTTGG - Intergenic
932620758 2:73263900-73263922 GGTGGGTGGTGGGTGCTGTTGGG - Intronic
935320332 2:101881401-101881423 GGTTGGTTTTGGATTTTTTTTGG + Intronic
936226480 2:110658636-110658658 GGTGGGTGATGGCTGCACTTTGG + Exonic
937250377 2:120519893-120519915 GGTGCGTGTTTACTTCTTTGGGG - Intergenic
938035222 2:128029120-128029142 AGTAGGTGTTGGCAACTTTTGGG - Intergenic
938743460 2:134254457-134254479 GGTGACTTTTGGCTTCATTTGGG + Exonic
938829688 2:135038094-135038116 GGGAGGTGTTTGCTTCTTTATGG + Intronic
946100704 2:217318139-217318161 GGTGGCTGTTTGCTTCTTCAAGG + Intronic
946502410 2:220263525-220263547 GATGGGTGTTGCCTTGCTTTTGG + Intergenic
946928336 2:224647769-224647791 GGTTTCTGTTGGGTTCTTTTGGG - Intergenic
947477116 2:230460367-230460389 TGGGGGATTTGGCTTCTTTTGGG + Intronic
947838777 2:233194136-233194158 GCTGGATGTTGGGTTCTGTTGGG - Intronic
948475660 2:238217377-238217399 GATGGGTGGAGGCTTCTATTTGG + Intergenic
1173810552 20:45952639-45952661 AGTGGGTGCCAGCTTCTTTTAGG + Exonic
1174179599 20:48666415-48666437 GGTGGTTGTGGGCTTCTCGTTGG - Intronic
1175731925 20:61360007-61360029 TGTGGCAGTTTGCTTCTTTTTGG - Intronic
1179092565 21:38280412-38280434 GGTGTGTGTTCGCTTTCTTTGGG + Intronic
1179495355 21:41768017-41768039 GGTGAGTGAAGGCTTATTTTTGG + Intergenic
1181858418 22:25799490-25799512 AGTGGCTGGTGGCTTCCTTTGGG + Intronic
1182230113 22:28831493-28831515 GGTGGGTGTTGGTGTCTCTGAGG + Intergenic
1182766165 22:32759946-32759968 GGTGGGTGCTGGCTGCTGGTGGG - Intronic
1182926503 22:34130208-34130230 GGTGAATGTTGGCATCTTTGAGG - Intergenic
1183025398 22:35062104-35062126 GTTTGTTGGTGGCTTCTTTTTGG - Intergenic
1183053787 22:35288262-35288284 GGTGGGTGGGGACTTCTTCTGGG - Exonic
1183219609 22:36504216-36504238 GGTTGGTGTTGGCTTCTTCCAGG + Exonic
1184138266 22:42562159-42562181 GCTGGGTACTGTCTTCTTTTAGG - Intronic
1184233787 22:43172320-43172342 GGTGGGTGATGGGCCCTTTTTGG - Intronic
1185124163 22:48996265-48996287 GGTGGATGTTGACTTCTTGATGG - Intergenic
952466440 3:33592137-33592159 AGTGGGTGTTGTCTTGTCTTTGG - Intronic
952507641 3:34021946-34021968 GCTGAGTGTGGGCTTCCTTTAGG + Intergenic
952753908 3:36849342-36849364 GTAGGATGTTGCCTTCTTTTTGG - Intronic
952854893 3:37762124-37762146 GGTGGGTTTTGGCTTCCTAAAGG - Intronic
953672505 3:44975307-44975329 GGTTGGGGTTGGCTTTTTTTCGG + Intronic
954903566 3:54041112-54041134 GGTGGGATTTGGTTTCTTCTGGG + Intergenic
959339118 3:105105662-105105684 GGTTGTTGTTGGGTTTTTTTGGG + Intergenic
960284949 3:115817770-115817792 GGTGAGTGCTGGCTTCTGCTAGG - Intronic
960695082 3:120388137-120388159 GGTGGGGGATGGCTTCTCTAGGG - Intergenic
960972600 3:123150422-123150444 GGTGGGTGTGCGGGTCTTTTTGG - Intronic
966769653 3:183492472-183492494 GGTGAGTAATGGCTTCTTATTGG - Exonic
967885362 3:194329975-194329997 GGTGGCTGTGGGCTCCTTTTTGG + Intergenic
968005153 3:195237599-195237621 GGTTGGTGGAGGCTTCTGTTTGG + Intronic
970584414 4:17501576-17501598 GATGGATTTTGTCTTCTTTTGGG - Intronic
971805790 4:31356240-31356262 GGAGGGTCTTGGCTTAATTTTGG + Intergenic
971864586 4:32152928-32152950 GGGGAGTTTTGTCTTCTTTTGGG - Intergenic
973095964 4:46200163-46200185 GTTGGGTGGTGGATGCTTTTGGG - Intergenic
973699263 4:53520606-53520628 GGTGGGGGTCAGGTTCTTTTTGG + Intronic
974140721 4:57883174-57883196 GGAGGCTGGTGGCTTCTTTGAGG + Intergenic
974816256 4:67007781-67007803 TTTGGTTGTTGGCCTCTTTTAGG + Intergenic
977231767 4:94459749-94459771 TGTGGGGGTTGGTTTCCTTTAGG + Intronic
983719913 4:170838151-170838173 GGTGGTTGTTGGTTTATTTTAGG - Intergenic
984754357 4:183312177-183312199 TGTGGGTGTTGGCTCCTGATGGG + Intronic
986407698 5:7442848-7442870 GGGGGGAGTTGCTTTCTTTTTGG + Intronic
986999910 5:13650113-13650135 GGATGGTTTTGGCTTCTTCTAGG + Intergenic
988686126 5:33527163-33527185 GGTGGAAGCTGGCTTCCTTTTGG + Exonic
991161452 5:63507982-63508004 GGTGTCTGTTGGCTTCTACTGGG - Intergenic
994346109 5:98688689-98688711 GGTGGTTGTTGAAATCTTTTGGG - Intergenic
995825263 5:116289669-116289691 GGGGGGTGGTGGGTTCTTCTTGG + Intronic
996411579 5:123164623-123164645 AGTGGGTGCTGCCTTCTTGTTGG - Intronic
996901851 5:128551876-128551898 GGTGGTTGGAGGCTTCGTTTGGG - Intronic
997603649 5:135157190-135157212 GGTGGGTATTGGCTCCTGATGGG + Intronic
997731591 5:136184033-136184055 AGAGGATGTTGGCTTCTCTTGGG + Intronic
997812820 5:136988720-136988742 GGTGGGCCTTGGCATCTTCTTGG - Intronic
999787784 5:154907742-154907764 GGTGGGCTTTTTCTTCTTTTTGG + Exonic
1002698744 5:181107903-181107925 AGTGGGTGTTTGCTGCTTTGTGG + Intergenic
1002887535 6:1310587-1310609 GGTGGGGAATGGCTGCTTTTTGG - Intergenic
1002974228 6:2058488-2058510 TGAGGGTTTTGGCTTGTTTTGGG - Intronic
1004120261 6:12814657-12814679 GGTGGGTGATGGCTTTCTCTAGG - Intronic
1005995272 6:30927030-30927052 GGCGGGTGTTAGCTCCATTTTGG + Intergenic
1007114278 6:39332353-39332375 GTTGGATGCTGGTTTCTTTTTGG + Exonic
1008952033 6:57172214-57172236 GGGGGGAGTTGGTTACTTTTAGG + Intergenic
1012496053 6:99834681-99834703 TGTTGGTGGTGGCTACTTTTTGG + Intergenic
1012849382 6:104428666-104428688 GTTGCGTTTTGGCTGCTTTTTGG - Intergenic
1015297592 6:131615481-131615503 GGTGTGTGTTTGCTTGTTTTTGG - Intronic
1015758664 6:136633619-136633641 GGTGGGATTTGGCTTCTTTCAGG - Intronic
1019889245 7:3932849-3932871 GGTGGGTGTTGGCTTCTTTTGGG - Intronic
1020757318 7:12218969-12218991 GCTGGGTGTCCTCTTCTTTTGGG - Intronic
1024293841 7:47827328-47827350 GGTGGGTGGCGGCTTCTGTCGGG - Exonic
1024570139 7:50716389-50716411 GTTGGGTGTTGGCTACTTCTTGG - Intronic
1026887739 7:73964205-73964227 GGGGGATGAGGGCTTCTTTTAGG - Intergenic
1027509572 7:79062902-79062924 GGTGGTTGTTTCTTTCTTTTAGG - Intronic
1032621788 7:133541771-133541793 AGTGGATGTTGGCCTCTATTTGG + Intronic
1034067115 7:148147660-148147682 GGCGGGTGTGGCCTTCTGTTGGG - Exonic
1034415474 7:150962265-150962287 GGTGGGTGCTGGGGTCTCTTGGG - Intronic
1035704987 8:1668733-1668755 GTTGGGTTTTGGCTTATTCTAGG - Intronic
1041395770 8:57389663-57389685 GGTGAATATTGGCTTCTTATGGG + Intergenic
1043424953 8:80139366-80139388 GATGGATGTGGGTTTCTTTTTGG - Intronic
1043944143 8:86230871-86230893 GGTGGCTGTTGTTTTGTTTTTGG + Intronic
1046677352 8:117124803-117124825 GGAGGGTGTGGGCTCCTATTGGG + Intronic
1048234062 8:132673711-132673733 GGTGGGTGGAGGCTTCTCTGAGG - Intronic
1049034037 8:140060693-140060715 GGTGGGTTTTGGTTTATTTCTGG + Intronic
1052342529 9:27377988-27378010 GATGTGTGTTGGCTTCTTGGGGG - Intronic
1052938050 9:34109806-34109828 GGTGGGTGTGGGCAGCTTTAGGG + Intronic
1053052031 9:34969946-34969968 GGTGGGTCTCGCCTTCCTTTAGG + Intronic
1055110419 9:72554162-72554184 ATTGGGTGTTGTCTTCTGTTTGG + Intronic
1057040705 9:91845489-91845511 GGTGGGGGTTGGCTTCTGAAAGG - Intronic
1058098281 9:100888161-100888183 AGAGGGTGTTGCCATCTTTTTGG + Intergenic
1058137635 9:101324766-101324788 GGCTGATGTTGGCTGCTTTTTGG - Exonic
1059873521 9:118604985-118605007 CCTGGGTGTTGGCCACTTTTTGG + Intergenic
1187724873 X:22192062-22192084 GGTTGGTGGTGGCTTGTCTTGGG + Intronic
1190992205 X:55563902-55563924 GGTGAATGGTGGCTTCTTTGGGG + Intergenic
1193295885 X:79830492-79830514 GGTGGCTGGAGGCTTCTGTTGGG + Intergenic
1198371454 X:135993310-135993332 AGTAGGTGTGGGGTTCTTTTTGG + Intronic
1201763004 Y:17559041-17559063 GGTGGGGGTGGGTTTCTTCTTGG + Intergenic
1201838548 Y:18346948-18346970 GGTGGGGGTGGGTTTCTTCTTGG - Intergenic
1202040074 Y:20673651-20673673 GCTGTTTGTTGACTTCTTTTTGG - Intergenic