ID: 1019889246

View in Genome Browser
Species Human (GRCh38)
Location 7:3932850-3932872
Sequence AGGTGGGTGTTGGCTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889246_1019889251 3 Left 1019889246 7:3932850-3932872 CCAAAAGAAGCCAACACCCACCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1019889251 7:3932876-3932898 TCTCACCTGTGTGTTCAGATAGG No data
1019889246_1019889254 9 Left 1019889246 7:3932850-3932872 CCAAAAGAAGCCAACACCCACCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889246_1019889252 4 Left 1019889246 7:3932850-3932872 CCAAAAGAAGCCAACACCCACCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1019889252 7:3932877-3932899 CTCACCTGTGTGTTCAGATAGGG 0: 1
1: 0
2: 3
3: 20
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889246 Original CRISPR AGGTGGGTGTTGGCTTCTTT TGG (reversed) Intronic
900083058 1:873656-873678 AGGTGGGTGTGGGCAGTTTTAGG - Intergenic
901028099 1:6289912-6289934 ATTTGGGTGTGGGCATCTTTTGG - Intronic
906275471 1:44512276-44512298 ATGTGGTTGTTGACTTCTTCAGG - Intronic
906833004 1:49053309-49053331 AGGTGGATATTGGTTACTTTGGG - Intronic
908264761 1:62367414-62367436 GGGTGGGTGTTGGGGTCATTTGG - Intergenic
909936400 1:81556039-81556061 AGGTTGATGCTGACTTCTTTTGG - Intronic
916289383 1:163147725-163147747 ATGTGTGTGTTAGCTTCTATGGG - Intronic
917347709 1:174045744-174045766 AGGTGGGTGGTGGGTACTTGAGG - Intergenic
917815554 1:178706277-178706299 AGGTGTGGGTTGGATCCTTTGGG + Intergenic
918082244 1:181216759-181216781 GGGTGGGGGTTGTCTGCTTTAGG - Intergenic
921001898 1:211052567-211052589 TTTTGGGTGTTGGCTTCATTTGG - Intronic
921026606 1:211289334-211289356 AGGATGGTGTTGGCTGCATTGGG - Exonic
922668774 1:227493637-227493659 AGGTGGGTGTGGGCAGTTTTAGG + Intergenic
922670822 1:227507662-227507684 AGGTGGGTGTGGGCAGTTTTAGG - Intergenic
922767354 1:228162988-228163010 GTGTTGGTGGTGGCTTCTTTGGG + Intergenic
922897346 1:229110740-229110762 AGCTGGGAGGCGGCTTCTTTGGG - Intergenic
1062764000 10:47728-47750 AGGTGGGTGTGGGCAGTTTTAGG + Exonic
1063552442 10:7045799-7045821 ACGTGGGTGTTGAGGTCTTTAGG - Intergenic
1064671117 10:17714719-17714741 AGGTGGCTGTTGGCTGCCTCCGG - Exonic
1067332195 10:45333061-45333083 AGGTGTCTGTTGGCTTCTTCTGG + Intergenic
1068649755 10:59508975-59508997 GGGTGTTTGTTGGCTTCTTAAGG - Intergenic
1073036097 10:100565149-100565171 AGGTTGAGGTTGGCTTCTTCAGG + Intergenic
1074531949 10:114304412-114304434 AAGTGGGTGTTGTTTTGTTTGGG - Intronic
1074733321 10:116400855-116400877 AGGTAGGTGGTGGCTGCTTCAGG + Intergenic
1074747283 10:116547389-116547411 AAGCGGGTGTTGACATCTTTTGG - Exonic
1083172167 11:60929469-60929491 AGGTGGGTGGGGGCTGCTTTGGG - Intronic
1084961377 11:72718494-72718516 AGGTGGAGGTGGGCTTCTGTGGG - Intronic
1087817764 11:102678179-102678201 AGGTGGGTGTTGGCCTTTTCTGG + Intergenic
1089191875 11:116659560-116659582 AAGAGCGTGTTGGCTTCTTTGGG - Intergenic
1089710238 11:120309418-120309440 AGCTGGGTTTTGGGTTCTATAGG - Exonic
1090339481 11:126003881-126003903 AGGTGAGTGAGGGCTTCCTTTGG - Exonic
1091026370 11:132145058-132145080 GGATGGGTGATGGCTTCTATTGG - Intronic
1092365012 12:7870820-7870842 AGGTGGGTGGGGGCTTCACTGGG - Intronic
1093072603 12:14722438-14722460 AGTTGGGTTTTGGATTTTTTGGG + Intergenic
1094813832 12:34165438-34165460 AGGTGGGTGTGGGCAGTTTTAGG + Intergenic
1095103089 12:38203083-38203105 AGGTGGGTGTGGGCAGTTTTAGG - Intergenic
1097660630 12:62426621-62426643 CTGTGCATGTTGGCTTCTTTAGG + Intergenic
1097959998 12:65522990-65523012 AGGTGGGAATTGGGTTCTTACGG + Intergenic
1098865360 12:75756468-75756490 AGGGTGGTGTTGGTATCTTTTGG - Intergenic
1101208473 12:102512834-102512856 ATCTGGGTGTTGGCTGCTGTGGG + Intergenic
1102542145 12:113628840-113628862 AGGTCAGGGATGGCTTCTTTGGG + Intergenic
1103480233 12:121245839-121245861 ATTTGGGTGTTTGCATCTTTTGG - Intronic
1108795414 13:54024192-54024214 AGGTGGGTGTTCTCTCCTGTGGG - Intergenic
1108975787 13:56441967-56441989 AGGCAGGTCTTGGCTTCTTTGGG + Intergenic
1109845331 13:67981730-67981752 AGCTGGGTGTTTGCTTTATTTGG + Intergenic
1110556992 13:76870740-76870762 GTTTTGGTGTTGGCTTCTTTTGG - Intergenic
1110604179 13:77411744-77411766 AGGTGTGCATTGCCTTCTTTTGG + Intergenic
1112160101 13:96858280-96858302 AGCACTGTGTTGGCTTCTTTTGG - Intergenic
1112985227 13:105440880-105440902 AGGTGGGTTTTACCTTTTTTAGG - Intergenic
1114666900 14:24383200-24383222 AAGTGGGTGTTGGCTGCTGGTGG + Intergenic
1114669395 14:24400695-24400717 AGGAGTGTTTTGGGTTCTTTGGG + Intronic
1116153111 14:41167198-41167220 AGGTGGCTCTTGCCTTCTTATGG - Intergenic
1119639374 14:76303242-76303264 ATGTGGTGGGTGGCTTCTTTAGG - Intergenic
1120765236 14:88322726-88322748 AGGTGGGTGTTTCCTACTTTTGG - Exonic
1121000245 14:90446704-90446726 AGCTGGGTGTTGGCTGATTCAGG - Intergenic
1124873369 15:33566151-33566173 AGGTGGTAGCTGGCTTCTCTTGG - Intronic
1126178742 15:45764571-45764593 AGGTTGATGTTGGCTTTTTCAGG - Intergenic
1127534109 15:59874052-59874074 AGGTGGGTGTTTTCTTCTTAAGG - Intergenic
1128102818 15:65017937-65017959 ATGTAGGTGTTTGCTTATTTTGG + Intronic
1129903512 15:79169890-79169912 AAGTGGGTGTTTGCAGCTTTTGG + Intergenic
1129955044 15:79628545-79628567 AGGTGGAGGTTGCCTTCCTTTGG - Intergenic
1130784998 15:87086313-87086335 ATGTGGGTGTTGACTAATTTGGG - Intergenic
1132161550 15:99547548-99547570 AGGTGGTTTTTGGATTCTCTGGG + Intergenic
1132252451 15:100343831-100343853 AGGTTGGTGATGGCTACTTCAGG - Intergenic
1133445121 16:5853161-5853183 AGGAGGGAGTGGGCTTCTTGGGG + Intergenic
1135522401 16:23187530-23187552 AGATGGGGGTTGGCTAATTTGGG - Intronic
1135850371 16:25957889-25957911 AGGTGGCTGTTGGCTGGTGTGGG + Intronic
1136984153 16:35083977-35083999 AGGTGGGTTCAGGCTGCTTTTGG - Intergenic
1137305537 16:47196004-47196026 AGGTTGGTGTTTTTTTCTTTTGG + Intronic
1139512842 16:67437113-67437135 AAGTGGGGGTGGGATTCTTTAGG - Exonic
1140955713 16:79863138-79863160 AGGTAGGCGTTGGAATCTTTTGG + Intergenic
1141965858 16:87442686-87442708 GTGTGGGTGTTGATTTCTTTGGG - Intronic
1142637039 17:1264224-1264246 AGGTGGGTGCTGGCTTGGTGTGG - Intergenic
1143746609 17:8999202-8999224 AGGAGGGTGTTTCATTCTTTTGG + Intergenic
1143830575 17:9647254-9647276 AGGTGGGGGTTGGCATCTCATGG - Intronic
1144188047 17:12814859-12814881 AGGAGGGTTTTTGCTTTTTTGGG - Intronic
1145787302 17:27602650-27602672 AGGTGTGTGTTTGCCTCCTTTGG + Intronic
1146089602 17:29863113-29863135 ATGTGGCTTTTGGCATCTTTAGG + Intronic
1148088053 17:45006598-45006620 AAGTGGCTGATGGCTGCTTTGGG + Intergenic
1152738105 17:82007371-82007393 AGGGGGCTGTTGACTTCATTTGG - Intronic
1152956906 18:48061-48083 AGGTGGGTGTGGGCAGTTTTAGG + Exonic
1155847885 18:30731710-30731732 AGATGGGTGCTTGCTTCTTCTGG - Intergenic
1156196267 18:34777176-34777198 ACTTGAGTGTAGGCTTCTTTGGG + Intronic
1158530966 18:58260812-58260834 AGGTGAGAGAAGGCTTCTTTGGG + Intronic
1160157556 18:76445065-76445087 AAGTGGGTTTTGGCTCCTCTGGG - Intronic
1160519413 18:79495468-79495490 AAGTGGGTCTTAGCTTGTTTCGG + Intronic
1163385508 19:16997532-16997554 AGATGGATGTTGGCTCCATTGGG + Intronic
1164266986 19:23628593-23628615 TGGTGGATGTTAGCTTTTTTTGG + Intronic
1164687607 19:30178286-30178308 TGGTGGTTGTTGGCTGCCTTTGG + Intergenic
1164847636 19:31448240-31448262 AGGTGGGTCTTGGCATTCTTGGG + Intergenic
1166672994 19:44722677-44722699 AGGTGAGTGTGGGCCTCTCTTGG - Intergenic
1167087980 19:47323757-47323779 AGGCTGGTGTTGTCTTCTTGAGG - Intergenic
1168645595 19:58057061-58057083 ATGGGGGTGTTGGAGTCTTTGGG - Intergenic
927096318 2:19750204-19750226 AGGTGGGTGTTGGCATGGTGTGG - Intergenic
927419162 2:22912006-22912028 AGGTGGGTGGTTTCTTTTTTTGG + Intergenic
927521374 2:23700699-23700721 CCGTGGGTGTAGACTTCTTTTGG - Intronic
928539025 2:32266929-32266951 AGGTGGCTGCTGGCATCTTTTGG - Intergenic
930453483 2:51575058-51575080 AGGTAGATGTTTGCTTCTTTGGG + Intergenic
932792074 2:74662475-74662497 ATGTGGGTGTTGGCTGCTGGGGG + Intronic
932962402 2:76428971-76428993 AGATGGGTTTTGGCATATTTGGG + Intergenic
933808378 2:86016686-86016708 AGGTGCCTGTGGGCTTCGTTGGG + Intergenic
937250378 2:120519894-120519916 AGGTGCGTGTTTACTTCTTTGGG - Intergenic
937335185 2:121058268-121058290 GGGTGGGTGCTGGCTTCCTTAGG + Intergenic
937356900 2:121203442-121203464 AGCTGGGTGGTGACTTCTTGGGG - Intergenic
940791337 2:158033077-158033099 AGCTGGGTGTTGCCTACATTTGG - Intronic
1172229446 20:33327061-33327083 AGGTGGGTGCTGGGTGCTCTTGG - Intergenic
1175937643 20:62521699-62521721 AGGTGTGTGGTGGCATCTCTTGG + Intergenic
1176008018 20:62876693-62876715 GGGAGGGTGCTGGCTGCTTTGGG + Intergenic
1176140422 20:63542501-63542523 AGCTGGGTGAAGGCTACTTTGGG - Exonic
1178020360 21:28401371-28401393 AGGTGTGTCTTTGCTTCTTTAGG - Intergenic
1178742445 21:35214836-35214858 AGTTGAGTGTTGAATTCTTTAGG - Intronic
1184490924 22:44808463-44808485 ACGTGGGTGTGGGCTGCTTGTGG + Intronic
949381787 3:3454748-3454770 AGGTGAGTTTTAGCTTCTCTTGG + Intergenic
950223886 3:11217839-11217861 AGGTGGGGCTTGGCTTCTCTAGG - Intronic
956977800 3:74601984-74602006 AGCTGGGAGTTGGCTTATCTAGG - Intergenic
957436322 3:80181709-80181731 AGTTCAGTGTTGGTTTCTTTCGG - Intergenic
959339117 3:105105661-105105683 AGGTTGTTGTTGGGTTTTTTTGG + Intergenic
960695083 3:120388138-120388160 GGGTGGGGGATGGCTTCTCTAGG - Intergenic
961140177 3:124549308-124549330 GTGTGTGTGTTGGCTTCTTGGGG - Intronic
961753268 3:129110140-129110162 TGGTGGTTCTTGTCTTCTTTAGG + Intronic
963285789 3:143433278-143433300 AGATGGTTGCTGGGTTCTTTGGG + Intronic
965570271 3:170165420-170165442 ATCTGGGTATTGGCTTCTATTGG - Intronic
965615371 3:170586564-170586586 AGGTGGGTCTTGTCTTCTTTAGG - Intronic
968357405 3:198120086-198120108 AGGTGGGTGTGGGCAGTTTTAGG - Intergenic
969712017 4:8849972-8849994 CTGTGGGTGTTGGTTTCTCTGGG + Intronic
970018540 4:11540231-11540253 AGGTGGCTTTTGTTTTCTTTCGG - Intergenic
970584415 4:17501577-17501599 AGATGGATTTTGTCTTCTTTTGG - Intronic
971864587 4:32152929-32152951 AGGGGAGTTTTGTCTTCTTTTGG - Intergenic
974878119 4:67722084-67722106 TGGTGGGTTTTGGCTGGTTTTGG + Intergenic
976784701 4:88804949-88804971 AGGAGGGTTAAGGCTTCTTTGGG - Intronic
977790291 4:101092401-101092423 AGGCTGGTGTTGGATTTTTTTGG + Intronic
978735297 4:112077718-112077740 AGTTGGGTGTGGGCAACTTTAGG - Intergenic
980876964 4:138671286-138671308 AGGTGTGTGTGGGCTGCTATGGG - Intergenic
984754356 4:183312176-183312198 ATGTGGGTGTTGGCTCCTGATGG + Intronic
985441134 4:189983164-189983186 AGGTGGGTGTGGGCAGTTTTAGG + Intergenic
986118471 5:4804956-4804978 AGGTGGGGGATGGCGCCTTTGGG - Intergenic
986536807 5:8796642-8796664 AAGTGGGTTTTGGCTTCGTCTGG - Intergenic
987170597 5:15253314-15253336 AGGTGGGTTGTGGATTATTTGGG + Intergenic
988306036 5:29495337-29495359 ATTTGGTTCTTGGCTTCTTTTGG + Intergenic
991161453 5:63507983-63508005 AGGTGTCTGTTGGCTTCTACTGG - Intergenic
991630037 5:68647420-68647442 ATGAGGGTGTTGGCTTCTAGAGG - Intergenic
995282914 5:110355681-110355703 TGGAGGGTGTGGGCTTCTCTAGG + Intronic
995831158 5:116357753-116357775 TGGTGGCTGTTGGCAACTTTAGG + Intronic
996230978 5:121063724-121063746 AGGTGGGTGTTGCCATCTGTAGG + Intergenic
996901852 5:128551877-128551899 AGGTGGTTGGAGGCTTCGTTTGG - Intronic
997140234 5:131372063-131372085 AGTTGGGTGATGTCTTCATTGGG + Intronic
997731590 5:136184032-136184054 AAGAGGATGTTGGCTTCTCTTGG + Intronic
997785364 5:136706401-136706423 AGGTTGGTGGTGGAGTCTTTAGG - Intergenic
1002974229 6:2058489-2058511 ATGAGGGTTTTGGCTTGTTTTGG - Intronic
1003118935 6:3304470-3304492 AAGTGGGTATGGGCCTCTTTGGG + Intronic
1004008755 6:11660709-11660731 AGGTGGGTGGTTGCTTTTTAGGG + Intergenic
1004310452 6:14540568-14540590 AGGAGGGTGAAGGCTTGTTTTGG + Intergenic
1008878813 6:56359482-56359504 AGGTGGGGGTTGGTTGGTTTGGG + Intronic
1009575286 6:65449009-65449031 ATGTGGGTGTTAGTTTCTTAAGG - Intronic
1011785612 6:90841076-90841098 ATGTGAGGTTTGGCTTCTTTAGG - Intergenic
1012172642 6:96038382-96038404 AAATGGGTTTTGGCTTGTTTTGG - Intronic
1016423153 6:143906257-143906279 AGGTAGGTGTTGTGTTTTTTAGG + Intronic
1017304274 6:152898620-152898642 AGGTGGGTGTGGTCAGCTTTAGG - Intergenic
1017374766 6:153756344-153756366 AAGTATGTGTTGGCTTCTCTTGG + Intergenic
1019889246 7:3932850-3932872 AGGTGGGTGTTGGCTTCTTTTGG - Intronic
1021312132 7:19108434-19108456 AGGTGGGGGTTGCCTGCCTTCGG + Intronic
1024293842 7:47827329-47827351 AGGTGGGTGGCGGCTTCTGTCGG - Exonic
1027471612 7:78581271-78581293 AGGTAGGTCTTTGCTTCCTTTGG - Intronic
1027609559 7:80343294-80343316 AGGTGAGGGTAGGCTTATTTGGG + Intergenic
1027609572 7:80343415-80343437 AGGTGAGGGTAGGCTTATTTGGG + Intergenic
1031873593 7:127113276-127113298 AGGGGTGTCTTGGCTTCCTTGGG - Intronic
1032000068 7:128259510-128259532 TGGGGGGAGTTGGCTTCTGTGGG - Intergenic
1034067116 7:148147661-148147683 AGGCGGGTGTGGCCTTCTGTTGG - Exonic
1034253271 7:149709327-149709349 TGGTTTGTGTTTGCTTCTTTTGG - Intergenic
1036053370 8:5225064-5225086 AAGGGAGTGTTGGCTCCTTTGGG + Intergenic
1038027840 8:23608160-23608182 GGGTTGGCGATGGCTTCTTTTGG - Intergenic
1038518552 8:28208440-28208462 ACATGCTTGTTGGCTTCTTTGGG + Intergenic
1040408495 8:47132816-47132838 AGGTGGGCGTGGGCTTCCCTGGG - Intergenic
1045412424 8:101932116-101932138 AGGTGAGTGCAGGCTTCTCTAGG + Intronic
1046600520 8:116312026-116312048 AGGAGTCTGTTGTCTTCTTTGGG + Intergenic
1047633291 8:126731553-126731575 AGGTGAGTCTTGAATTCTTTGGG - Intergenic
1048709390 8:137191356-137191378 AGGAGGGTCCTGGCTTCTTTAGG - Intergenic
1049248800 8:141577238-141577260 AGGTGGTTGCTGCTTTCTTTGGG + Intergenic
1049710914 8:144062952-144062974 GGGTGGGGGTTGGCTTTTGTTGG - Intronic
1049801380 8:144519004-144519026 AGGTGAGGGTTGCTTTCTTTCGG + Intronic
1051878161 9:21812287-21812309 AGGTAGGTGTGGGCAGCTTTAGG + Intronic
1052342530 9:27377989-27378011 TGATGTGTGTTGGCTTCTTGGGG - Intronic
1052396965 9:27950073-27950095 AGGTGGGAGAGGGCTTCTGTTGG + Exonic
1052938049 9:34109805-34109827 AGGTGGGTGTGGGCAGCTTTAGG + Intronic
1053105163 9:35402755-35402777 AGGTGGGAGGTTGCTGCTTTTGG + Intronic
1053254646 9:36605443-36605465 AGGTGGGAGGTGGCTGGTTTTGG + Intronic
1056211566 9:84369463-84369485 AGGTGGGTGTTAGCTGAGTTTGG + Intergenic
1056322000 9:85443945-85443967 AGGTGGGTATGAGCCTCTTTTGG - Intergenic
1058738670 9:107920907-107920929 AGGTCTGTGTTGTCTTCTTGGGG - Intergenic
1061632157 9:131879234-131879256 AGGTGAGTGTTAGCTTGGTTTGG + Intronic
1061650913 9:132049248-132049270 AGGTCGGTCTTGGCTTCTGGAGG + Intronic
1062135064 9:134922344-134922366 AGATGGGTTTTGGCTTCATTGGG + Intergenic
1062201049 9:135302882-135302904 AGCTGGGTGAGGGCTTCTTCGGG - Intergenic
1062435042 9:136543308-136543330 AGGTGGGTGATGCCTCCTCTGGG - Intronic
1062741257 9:138176571-138176593 AGGTGGGTGTGGGCAGTTTTAGG - Intergenic
1188216150 X:27479860-27479882 AGGTGGGTGTGGAATTGTTTGGG - Intergenic
1190992204 X:55563901-55563923 TGGTGAATGGTGGCTTCTTTGGG + Intergenic
1192626287 X:72732204-72732226 AGGTGGTTGTCGGCTTTTTAGGG - Intergenic
1196001439 X:110791327-110791349 ATGTGGGTCTTACCTTCTTTGGG - Intronic
1198886082 X:141339278-141339300 AGGGTGATGTTGGCTTCATTAGG - Intergenic
1198948807 X:142045526-142045548 AGGTGGAGATTTGCTTCTTTAGG + Intergenic
1199371789 X:147057967-147057989 AGCTGGGTATTGTCTTCCTTTGG - Intergenic