ID: 1019889247

View in Genome Browser
Species Human (GRCh38)
Location 7:3932860-3932882
Sequence GGTGAGACAGAGGTGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 531}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889247_1019889254 -1 Left 1019889247 7:3932860-3932882 CCAACACCCACCTCTGTCTCACC 0: 1
1: 0
2: 5
3: 51
4: 531
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889247_1019889251 -7 Left 1019889247 7:3932860-3932882 CCAACACCCACCTCTGTCTCACC 0: 1
1: 0
2: 5
3: 51
4: 531
Right 1019889251 7:3932876-3932898 TCTCACCTGTGTGTTCAGATAGG No data
1019889247_1019889252 -6 Left 1019889247 7:3932860-3932882 CCAACACCCACCTCTGTCTCACC 0: 1
1: 0
2: 5
3: 51
4: 531
Right 1019889252 7:3932877-3932899 CTCACCTGTGTGTTCAGATAGGG 0: 1
1: 0
2: 3
3: 20
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889247 Original CRISPR GGTGAGACAGAGGTGGGTGT TGG (reversed) Intronic
900121501 1:1050358-1050380 GGAGAGACGGAGGTGGGGGCCGG - Intronic
900143872 1:1149760-1149782 GGTGACACAGATGTGGGGTTGGG + Intergenic
900305255 1:2003690-2003712 GGCCAGCCAGAGGTGGGTGTGGG - Exonic
900413313 1:2523578-2523600 GTTGGGACAGAGGTGGGGGTGGG + Intronic
900421716 1:2558645-2558667 GGTGAGACAGAGGTGGACGGGGG - Intronic
901150233 1:7096431-7096453 GGGGAGACAGAGTCGGATGTGGG - Intronic
901518290 1:9764131-9764153 GGAGAGAGAGAGGTGGGTGGGGG + Intronic
901881071 1:12194124-12194146 GGTCAGACAGAGCTGGATATGGG + Intronic
902712607 1:18250499-18250521 GGAGAGACAGCGATGGGTGACGG - Intronic
903117592 1:21190950-21190972 TGTGAGTTAGAGCTGGGTGTGGG - Intergenic
903117598 1:21190984-21191006 TGTGAGTTAGAGCTGGGTGTGGG - Intergenic
903117604 1:21191018-21191040 TGTGAGTTAGAGCTGGGTGTGGG - Intergenic
903293984 1:22332176-22332198 GGGGAGAGAGGGGTGGGTGAGGG - Intergenic
903580053 1:24364197-24364219 GGCGAGACAGGCGTGGGTGGAGG - Exonic
903999795 1:27332420-27332442 AGGGAGACAGATCTGGGTGTGGG - Intronic
904055455 1:27667048-27667070 CGCGAGAGAGAGGTGGGGGTGGG + Intronic
904670774 1:32163313-32163335 GGTAAGAAAGAGGAGGGTGCAGG + Exonic
904914692 1:33961291-33961313 TGTGAGAAAGAGGTGGGGTTTGG - Intronic
905364566 1:37443027-37443049 GGAAAGACAGTGGTGGGGGTGGG - Intergenic
905687990 1:39922457-39922479 GAGGAGGCAGAGGTGGGGGTCGG + Intergenic
905972514 1:42152889-42152911 AGTGAGAGAGATGTGGGTCTTGG + Intergenic
906110616 1:43319648-43319670 GGTGTGACACAGGTGTGTCTTGG + Intronic
906212708 1:44021060-44021082 GGTGTGACATTGGTGGGTGGAGG + Intronic
906504648 1:46369619-46369641 AGTGAGGCAGAGGAGGATGTTGG + Intergenic
906604935 1:47161906-47161928 GGGGAGGCAGAGATGGGTGGTGG + Intergenic
906676469 1:47697240-47697262 GGTGACACAGAGGTGACTCTAGG + Intergenic
909432594 1:75606844-75606866 GGTGACTAAGAAGTGGGTGTGGG - Intronic
909678340 1:78263287-78263309 GTTGTGGCAGAGGTGTGTGTGGG + Intergenic
911330812 1:96523655-96523677 GCAGAGACAGAGGTGGGAATGGG - Intergenic
911771493 1:101748293-101748315 GGTGAGCCAGGGGTTGCTGTTGG + Intergenic
912380024 1:109242371-109242393 GGTGAGTCTCAGGTGTGTGTTGG - Intergenic
912863603 1:113237115-113237137 GGTGAGACAAAGGTGGGCAGAGG - Intergenic
913214827 1:116611407-116611429 GGTTAGACATGGGTGTGTGTTGG - Intronic
913305116 1:117421143-117421165 GGTGATGGAGAAGTGGGTGTAGG + Intronic
914505184 1:148282314-148282336 GAGGAGACAGAGCGGGGTGTGGG - Intergenic
914507381 1:148301834-148301856 GAGGAGACAGAGCGGGGTGTGGG + Intergenic
915239307 1:154508434-154508456 AGAGAGACAGAGGTGTATGTTGG + Exonic
915765120 1:158354797-158354819 GGTGAAGCAGAGGAGGGAGTGGG - Intronic
915894528 1:159801449-159801471 GCTGAGACTGAGCTGGGTCTGGG - Intronic
915894766 1:159803227-159803249 GCTGAGACTGAGCTGGGTCTGGG - Intronic
915934969 1:160085012-160085034 GGTGAGACAGGGGTCGGAGGCGG + Intronic
916030105 1:160869159-160869181 GGTGAGAGAGAGGTGGACGGGGG + Intergenic
916107982 1:161444425-161444447 CGTGAGACAAAGGTGGGGGAGGG - Intergenic
916109568 1:161451807-161451829 CGTGAGACAAAGGTGGGGGAGGG - Intergenic
916112741 1:161466598-161466620 CGTGAGACAAAGGTGGGGGAGGG - Intergenic
917505356 1:175622448-175622470 GGTTAGATAGAGGTTAGTGTGGG - Intronic
917591097 1:176477884-176477906 CTTGAGACAGAGGTGAGTCTGGG - Intronic
917959171 1:180128800-180128822 GGTGTGACAGAGCAGGGCGTGGG - Intergenic
918424539 1:184394976-184394998 GGTGAGGCAGGGGTGGGTGTTGG - Intronic
919776825 1:201199643-201199665 GCTGAAAAAGAGGTGGGTTTGGG + Exonic
920131944 1:203738856-203738878 GGGGACACAGTGGTGGTTGTGGG + Intronic
920522229 1:206635950-206635972 GGTGAGACAGGGATGGGGGGAGG - Intronic
920667163 1:207971562-207971584 GGGGAGAGGGAGGTGGGTTTGGG - Intergenic
920704176 1:208239860-208239882 GGTGAGGAAGAGGTGAGTGGGGG + Intronic
921284277 1:213594963-213594985 GTTGGGAGAGAGGTGGGTGGAGG + Intergenic
921478357 1:215635963-215635985 GGTGCGGCAGGGGTGGGGGTGGG + Intronic
921902068 1:220461910-220461932 TTGGAGACTGAGGTGGGTGTGGG + Intergenic
922271669 1:224041419-224041441 GGTGAGAAAGAGGAGGGGTTGGG - Intergenic
922918496 1:229278707-229278729 GGAGAGACAGAGGTGGTTAAAGG - Intronic
923437355 1:233979923-233979945 GGTGAGGCTGAGGTGGGTTTGGG + Intronic
923844350 1:237712355-237712377 GGTGAGGCAGGGGTCAGTGTGGG + Intronic
924725163 1:246662858-246662880 TGTGAGCCACAGGTGGCTGTTGG - Intronic
1064013564 10:11755621-11755643 TGGGAGGCAGAGGTGGGTGGGGG - Intronic
1064391022 10:14942260-14942282 TGAGAGACAGAAGTGGGTTTCGG + Intronic
1064401384 10:15024269-15024291 TGAGAGACAGAAGTGGGTTTCGG + Intergenic
1064402605 10:15034049-15034071 GGAGAGAAAGAGGTGGGGGAAGG + Intronic
1064635394 10:17360577-17360599 GGCCAGAAAGAGGTGGGGGTGGG + Intronic
1065388710 10:25159819-25159841 GATGAGACAGAGGATGATGTTGG + Intergenic
1065746931 10:28850666-28850688 GCTGAGACAAGGGTGGGAGTGGG + Intronic
1067091066 10:43266173-43266195 GGTGAGTGAGAGGTGGGGGCGGG - Intronic
1069981323 10:72254984-72255006 GGGGAGAGAGAGCTGGGTGGGGG - Intergenic
1070069019 10:73067664-73067686 AGGGAGACAGGAGTGGGTGTGGG - Intronic
1070345736 10:75540143-75540165 GGTGCCTCAGAAGTGGGTGTGGG + Intronic
1070603897 10:77884992-77885014 GGTGTGACAAAGGTGAGCGTTGG - Intronic
1071025017 10:81102121-81102143 GGTGATATAGACGTGGATGTAGG - Intergenic
1071511423 10:86264790-86264812 GGTGACACAGACGAGCGTGTGGG - Intronic
1071704547 10:87983056-87983078 GGTGATAGAGAGGTGGATGCTGG - Intergenic
1072538498 10:96381017-96381039 GGTGGGTCAGTGCTGGGTGTTGG - Intronic
1073304549 10:102492679-102492701 GGCAAGACAGAGGTTGGTGGAGG + Intronic
1075284848 10:121174622-121174644 GGTGAGAGAGGGATGGGTCTGGG - Intergenic
1075715393 10:124552368-124552390 TGTGAGAGAGGGGTGGGTGGTGG - Intronic
1075731632 10:124639888-124639910 GGAGAGACAGAGGTTGGTTTGGG + Intronic
1075838300 10:125475024-125475046 GGAGAGATAGAAGTGGGAGTTGG - Intergenic
1076383486 10:130040588-130040610 GGGGAGGCCGAGGTGGGTGGAGG + Intergenic
1076595956 10:131624009-131624031 GGTGGGAGAGAGGTGGGGGGAGG + Intergenic
1076883484 10:133251049-133251071 GGGGAAACAGAGGGGGGTCTGGG - Intergenic
1077429144 11:2507376-2507398 GCTGTGACTGAGGTGGCTGTGGG + Intronic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077533453 11:3107972-3107994 GGATATACAGAGGTGGGGGTGGG - Intronic
1077612728 11:3654095-3654117 GGATAGACAGAGGTAGGAGTTGG - Intronic
1078513306 11:12002855-12002877 AGAGAGACAGAGTTGGTTGTTGG - Intronic
1078706322 11:13747399-13747421 GCTGAGACCCAGGAGGGTGTAGG - Intergenic
1078970305 11:16402679-16402701 GGTGAAACAGGAGTGGGTGGAGG - Intronic
1079601490 11:22316597-22316619 GGAGAGAGAGAGGTGGGGGAAGG - Intergenic
1079601497 11:22316619-22316641 GGAGAGAGAGAGGTGGGGGAAGG - Intergenic
1081610855 11:44562491-44562513 GGTGACGAAGAGGTGGCTGTAGG + Intergenic
1081996160 11:47365578-47365600 GGTCAGATACAGGTGGGTTTGGG - Intronic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1083438922 11:62663208-62663230 GCTGGGACAGAGGTGGGTGAGGG - Intronic
1083878360 11:65536552-65536574 CATGAGAGAGAGGTGGGTATGGG - Intronic
1084506206 11:69570022-69570044 GATGGGTCAGAGGAGGGTGTGGG - Intergenic
1085021686 11:73214043-73214065 GGTGAGAATGAGGTGGGAGCTGG - Intergenic
1085088102 11:73686085-73686107 GGTGGGAAAGATGTGGGGGTTGG + Intronic
1085517246 11:77118726-77118748 GGTCAGACTGAGGAGGCTGTGGG - Intronic
1085527110 11:77170652-77170674 GGTGAGACAGGTGTGGCTCTCGG + Intronic
1085805592 11:79633133-79633155 GTTGATACAGAGCTGGGCGTAGG + Intergenic
1087966584 11:104422741-104422763 GGCGAGTCCCAGGTGGGTGTGGG - Intergenic
1089616274 11:119696602-119696624 GGTGAGTCAGGGCTGGGTGTTGG + Intronic
1089982149 11:122781170-122781192 GGAGAGGAAGAGGTGGGGGTGGG - Intronic
1090391643 11:126392783-126392805 GATGTGACAGAGCTGGATGTGGG + Intronic
1091332351 11:134739846-134739868 GGTGCGAGAGTGGTGTGTGTGGG + Intergenic
1092287778 12:7139340-7139362 GATGAGAAATAGCTGGGTGTGGG + Intronic
1092983004 12:13816656-13816678 TGTGATACGGAGGTGGGTGTTGG - Intronic
1094590372 12:31814082-31814104 TTTGGGATAGAGGTGGGTGTTGG - Intergenic
1095977560 12:47950079-47950101 GGAGGGGCAGAGGAGGGTGTGGG + Intergenic
1096152043 12:49320511-49320533 GGTGAGACTGAGGTGGATTAGGG + Intergenic
1096153008 12:49326158-49326180 GGTGAGAAAGGAGAGGGTGTGGG + Exonic
1096258519 12:50077049-50077071 GGTGAGAAACAGGTGGGAGAGGG + Intronic
1096488031 12:51996719-51996741 AGAGTGGCAGAGGTGGGTGTGGG - Intronic
1096793914 12:54062067-54062089 AGGGAGAAAGAGGAGGGTGTTGG - Intergenic
1096974634 12:55693119-55693141 GGTGAGGCTTAGGTGGGGGTGGG - Exonic
1097153686 12:56997249-56997271 GGAGAGAAAGAGATGGGGGTGGG - Intergenic
1097182409 12:57178926-57178948 GATGAGACACAGGTGGGAGCAGG - Exonic
1097957588 12:65501910-65501932 TGTCAGACAGAAGTGGGTGGAGG + Intergenic
1098819292 12:75208475-75208497 GGGGAGAAAGAGGAGGGTCTTGG - Intronic
1099748603 12:86740986-86741008 GGAGGGAGAGAGGTGGGTGTGGG - Intronic
1100017931 12:90034650-90034672 ACTGAGACAGAGGAGGGTCTCGG + Intergenic
1100383973 12:94088586-94088608 TGTGAGACACAGGTTGGTGAGGG - Intergenic
1100477643 12:94948986-94949008 AGTGGGACTGAAGTGGGTGTGGG + Intronic
1100503262 12:95194604-95194626 GGTGGGAGGGGGGTGGGTGTGGG + Intronic
1100503376 12:95195770-95195792 GGTGGGAGGGGGGTGGGTGTGGG + Intronic
1101150452 12:101878027-101878049 GGTCAGGCAGAGGTGGGAGCAGG + Intronic
1102455071 12:113065951-113065973 GGAGAGACAGAGGTGGCGGGCGG - Intronic
1102760421 12:115380306-115380328 TCTGGGACAGAGGTGGGGGTGGG + Intergenic
1103703372 12:122859197-122859219 GGTGAGGCACAGCTGAGTGTGGG + Exonic
1104001702 12:124864196-124864218 GGGGAGACATAGGTGGGGGAAGG - Intronic
1104347526 12:128014847-128014869 GGTAAGACAGAGGTGGGAGAAGG + Intergenic
1104418008 12:128611502-128611524 GGTGAGACAGCAGTGGGCATGGG - Intronic
1105218558 13:18304885-18304907 GGTTAGACATGGGTGTGTGTTGG - Intergenic
1107355472 13:39561183-39561205 AGTGAGACAGAGAGGGGTATGGG - Intronic
1107780371 13:43895318-43895340 AGTGAGATAGAAGTGGGTGAGGG - Intergenic
1108942173 13:55969985-55970007 GGTGAGAGAGAGATGAGTGATGG + Intergenic
1110126349 13:71947677-71947699 GGTGAGAAAGAGATGGGCTTTGG + Intergenic
1111000745 13:82177182-82177204 GCAGAGACAGAGAAGGGTGTGGG + Intergenic
1111562288 13:89967047-89967069 TGTGAGACAGAGATGGGGGAAGG + Intergenic
1112499360 13:99930594-99930616 GCTGAGACAGGGGTGCGTGCAGG + Intergenic
1113108851 13:106800109-106800131 GGGGAGGCAGAGCTGGGAGTTGG + Intergenic
1113720724 13:112553798-112553820 GGTGAGACAGAGCTGGCCATGGG - Intronic
1114183463 14:20383460-20383482 TGTGAGAAGGAGGTGGGTGTCGG - Intronic
1114549772 14:23526028-23526050 GGCGAGACAGAGGGGGAGGTGGG - Exonic
1114552288 14:23539736-23539758 GGTCAGCCAGAGGTGGGAGGGGG - Intronic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1118384329 14:65243250-65243272 TGTGAGAGTGAGGTGGGTGGTGG + Intergenic
1119768252 14:77204325-77204347 GGGGAGACAGAGGTGGGCAAGGG + Intronic
1119773442 14:77235462-77235484 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119773499 14:77235638-77235660 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119773508 14:77235665-77235687 GGGGAGACTGTGGTGGGTGGCGG + Intronic
1119773572 14:77235849-77235871 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119773644 14:77236052-77236074 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119773680 14:77236159-77236181 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119773708 14:77236238-77236260 GGGGAGACTGTGGTGGGTGGGGG + Intronic
1119784003 14:77298884-77298906 CATGGGACAGAGGTGGGTGATGG + Intronic
1120275362 14:82366899-82366921 ATTGAGACAGAGCTGGGGGTAGG - Intergenic
1120325347 14:83017363-83017385 AGAGAGAAAGAGGTGGGGGTGGG - Intergenic
1121424366 14:93837894-93837916 TGGGAGACAGAGGTTGGAGTGGG + Intergenic
1121466952 14:94121883-94121905 GGTGACCCAGAGGTTGGTATGGG - Intergenic
1121535306 14:94686825-94686847 AGTCAGACAGAGCTGGGTGCAGG - Intergenic
1121685348 14:95831487-95831509 GGTAGGAAAGAGGTGGGTGGTGG - Intergenic
1121990947 14:98556683-98556705 GGTGTGACAAAGATAGGTGTGGG + Intergenic
1122170213 14:99867067-99867089 GGTGGGAGAGAGGTGGGTAAGGG - Intronic
1122727000 14:103762732-103762754 GGTGAGACGGATGGGGGTGGAGG + Intronic
1122970413 14:105150004-105150026 GGTGATAGTGAGGTGGGTGGGGG + Intronic
1123049482 14:105533921-105533943 GGTGAGACAGAGCTGGAGGCTGG - Intergenic
1123057174 14:105576002-105576024 GGTGTGACAGAGCTGGGAGCAGG - Intergenic
1123081070 14:105695889-105695911 GGTGTGACAGAGCTGGGAGCAGG + Intergenic
1124424944 15:29555908-29555930 GGAGATTCAGAGGTGGGTGCGGG - Intronic
1124637817 15:31376030-31376052 GGTGATTCAGAGGTGGGGATGGG + Exonic
1124863973 15:33471285-33471307 GGTGACACACAGATGGGTATGGG - Intronic
1125884796 15:43220657-43220679 GGTGATAATGAGGTGGCTGTGGG - Intronic
1128358736 15:66945827-66945849 GGTGGGGCAGAGGTGGGTGAGGG - Intergenic
1128519228 15:68364654-68364676 GGAGAGGCAGGGGTGGGGGTGGG - Intronic
1130285610 15:82552014-82552036 AGTGACCCACAGGTGGGTGTGGG + Intronic
1130622382 15:85477217-85477239 GTTGAGTCAGAGGTGCGAGTGGG + Intronic
1131091025 15:89625159-89625181 GGTGACACATAGGTGGGTTCAGG - Exonic
1131382351 15:91974456-91974478 GGAGAAACAGAGGAGGGTGAAGG + Intronic
1131542723 15:93288467-93288489 AGTGAGGCAGAGGTGGTTGGTGG - Intergenic
1132146713 15:99433618-99433640 CCTGGGACAGAGGTGGGGGTGGG - Intergenic
1132498653 16:275341-275363 GGAGAGACAGAGGTGGAGGGAGG + Intronic
1132715200 16:1286577-1286599 GGGGAGAGACAGGTGGGTCTGGG + Intergenic
1132830633 16:1926427-1926449 GGCGAGGCAGGGGTGGGGGTTGG - Intergenic
1133161081 16:3912278-3912300 GCTGAGAGAGAGGCGGGTTTCGG + Intergenic
1133283183 16:4678587-4678609 GGAGAGACAGAGATGGGGATGGG + Intronic
1133461067 16:5986524-5986546 GGTGAGAGGGAGGTGAATGTGGG - Intergenic
1133917757 16:10124607-10124629 GGTGAGACGGAGCTGGGAGATGG + Intronic
1134055548 16:11167624-11167646 GGAGAGACACAGGTGGGTTGGGG - Intronic
1134172306 16:11977674-11977696 AGTGAGAGGGAGGTGGGTGTGGG + Intronic
1135015921 16:18925657-18925679 GGTGAGAAAGAGGCGGGGGTGGG - Intronic
1135016125 16:18926274-18926296 GGTGAGAGAGAGGCGGATGAAGG + Exonic
1135321542 16:21501482-21501504 GGTGAGAAAGAGGCGGGGGTGGG - Intergenic
1135321743 16:21502101-21502123 GGTGAGAGAGAGGCGGATGAAGG + Intergenic
1135437224 16:22437164-22437186 GGTGAGAGAGAGGTGGATGAAGG - Intronic
1135437408 16:22437737-22437759 GGTGAGAAAGAGGCGGGGGTGGG + Intergenic
1136016070 16:27402075-27402097 AGTGAGAAAGAGGTGGGAGGGGG - Intergenic
1136016758 16:27405692-27405714 TGTGAGCCAGGGGTGGGGGTGGG - Intronic
1136089128 16:27905862-27905884 GGTGAGGCAGGGGTGGGAGTGGG - Intronic
1136333216 16:29595208-29595230 GGTGAGAGAGAGGCGGATGAAGG + Intergenic
1136556297 16:31009757-31009779 GGTGACCCAGAGGTGGGAGATGG - Intronic
1138221612 16:55256363-55256385 GGGCAGACAGAGGTGGGGGCGGG + Intergenic
1138519485 16:57562977-57562999 CGTGTGACAGAGGTGTGGGTGGG + Intronic
1138927060 16:61605115-61605137 GGTGAGGCAGAGGGGAGTGAGGG + Intergenic
1139960600 16:70715311-70715333 GGTGAAACAGATGTGGGGGAGGG - Intronic
1140134195 16:72190670-72190692 GGTGAGAGAGAGGTGGGGTTGGG + Intergenic
1140196064 16:72856584-72856606 GGGCAGACAGAGGTACGTGTAGG + Intronic
1140472298 16:75222712-75222734 GGTGAGGCCCAGGTGGGTTTGGG + Intronic
1140509802 16:75498887-75498909 GGGGCGACAGGGGTTGGTGTTGG - Intergenic
1140515598 16:75539095-75539117 GGGGCGACAGGGGTTGGTGTTGG - Exonic
1141167423 16:81669709-81669731 GGTGAGTGTGAGGTGGGTATGGG - Intronic
1141220337 16:82063689-82063711 GGTTAGAAAGAAGTGGGTGTTGG + Intronic
1141497019 16:84417229-84417251 GGTGAGTGAGAGGCAGGTGTGGG + Intronic
1141816947 16:86417413-86417435 GATGAGGCAGAGATGGGTCTGGG - Intergenic
1142111595 16:88334900-88334922 TGTGTGACAGAGATGGATGTGGG + Intergenic
1142207781 16:88792185-88792207 GGTGGGCCAGAAGTGGGGGTGGG - Intergenic
1142237581 16:88929569-88929591 GGTGATGCAGATGTGGGTATTGG - Intronic
1142273952 16:89105881-89105903 GGCGAGAGGCAGGTGGGTGTGGG + Intronic
1142364308 16:89641921-89641943 GGTGACATGGAGGTGGGTGAGGG + Intergenic
1142685420 17:1574758-1574780 GGTGGGTCCGAGGTGTGTGTGGG - Exonic
1143751705 17:9032829-9032851 AGTGAAACAGGGCTGGGTGTCGG - Intronic
1143868342 17:9940096-9940118 GGTAGGAGAGAGGTGGGAGTGGG - Intronic
1144465665 17:15495021-15495043 GGAGAGACAGAGGAGGGGATGGG + Intronic
1144525190 17:15983269-15983291 CGGGAGACAGAGGTGGCAGTGGG + Intronic
1144556352 17:16286107-16286129 GATGGGCCAGAGGTGGGTGGAGG + Intronic
1144572348 17:16407764-16407786 GGTGAGGCAGATGAGGGTGAGGG + Intergenic
1144937345 17:18910805-18910827 GGTGAGACAGAGCTGAGCGGAGG + Intronic
1145973977 17:28973709-28973731 GGCCAGACAGGGCTGGGTGTCGG + Intronic
1146261887 17:31427444-31427466 CCTGGGACAGAGGTGGGGGTGGG - Intronic
1146691918 17:34882618-34882640 GGGGAGGCAGAGGTGGGAGTGGG - Intergenic
1146820065 17:35977787-35977809 TGTGAACCAGAGGTGGGGGTGGG - Intronic
1147044922 17:37744925-37744947 GGTGCGAGAGAGGAGGGTGGAGG + Exonic
1147338406 17:39740181-39740203 GGTTAGACTGGGGTGGGAGTGGG + Intronic
1147412714 17:40265065-40265087 GGGGAGGCCGAGGTGGGTGGAGG - Exonic
1147903545 17:43807421-43807443 CGGGAGACTGAGGTGGGAGTGGG - Intronic
1147991879 17:44338952-44338974 GGGGAAAAAGAGGTGGGGGTGGG + Intergenic
1148854567 17:50571720-50571742 GGGGAGTCAGAGGTGTCTGTTGG + Intronic
1148944619 17:51249234-51249256 TGGGAGACAGAGTTGGGGGTGGG + Intronic
1150282887 17:63939777-63939799 GGTGAGAAAGAGACGGGCGTGGG + Exonic
1150469713 17:65426559-65426581 ACTGAGACAGAGCTGGGGGTGGG + Intergenic
1151534936 17:74733784-74733806 GGTGAGTCAGAAGTGGGTTAGGG - Intronic
1152022662 17:77788849-77788871 TCTGAGGCAGAGATGGGTGTGGG - Intergenic
1152122363 17:78426604-78426626 GGAGACACACAGATGGGTGTGGG + Intronic
1152352620 17:79791930-79791952 GCTGGGATAGAGGTGGGCGTGGG - Intergenic
1152460412 17:80439366-80439388 GGGGAGACAGGGATGGGTGAGGG - Intergenic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1153027771 18:686987-687009 GGTGAGTCAGAGAAGGCTGTGGG - Intronic
1153174666 18:2357450-2357472 AGGCAGACAGAGATGGGTGTTGG - Intergenic
1153717101 18:7860818-7860840 GCTGAGACAGAGTAGGGAGTGGG - Intronic
1154289498 18:13095008-13095030 GGGGTGACAGGGGTGGGTGGTGG - Intronic
1154477529 18:14777867-14777889 TGGGAGACAGAGGTGGCAGTAGG + Intronic
1155716285 18:28947792-28947814 TGGGAGACAGAGGTGGCAGTGGG + Intergenic
1156480151 18:37431086-37431108 GGTGAGCCAGAGGTGAGGATGGG + Intronic
1156675991 18:39528099-39528121 AGTGAAACAGAAGGGGGTGTGGG - Intergenic
1157106802 18:44781505-44781527 AGAGAGACAGAGGTGGGGGTGGG - Intronic
1157189679 18:45570313-45570335 GGTGAGATAGGTGAGGGTGTAGG - Intronic
1157713094 18:49863524-49863546 GCTGAGACAGAGCTGCATGTGGG + Intronic
1157930033 18:51811703-51811725 AAAGAGACAGAGGTTGGTGTAGG - Intergenic
1158774053 18:60555501-60555523 GATGAGACAGTGGTGGGGGCTGG - Intergenic
1159005199 18:63004777-63004799 GGAGGGACAGAGGTGGGGCTGGG + Intergenic
1160095294 18:75866222-75866244 GGAGAGACAGGGGCTGGTGTAGG + Intergenic
1160401651 18:78614659-78614681 GGTGGGACATAGGTGTGGGTGGG + Intergenic
1160535355 18:79588696-79588718 GGGGAGACAGAGGAGGGGCTCGG + Intergenic
1160717644 19:583618-583640 GCTGAGACCGCAGTGGGTGTTGG + Intergenic
1160761807 19:789251-789273 GGAGGGTCAGAGGTGGCTGTCGG - Intergenic
1161098361 19:2407181-2407203 GATGAGACAGAGTTGGGATTAGG - Intronic
1161151936 19:2714275-2714297 GTTGAGAAGGTGGTGGGTGTAGG - Intergenic
1161435205 19:4258847-4258869 GGTGAGGCAGCGGGGGCTGTGGG - Intronic
1161633670 19:5373446-5373468 GGGGTGAGTGAGGTGGGTGTGGG + Intergenic
1162174648 19:8822252-8822274 GGTGAGACAGGGCTGTGTTTGGG - Intronic
1162949132 19:14060362-14060384 GGGGAGGCAGAGGTGGCTGTGGG - Intergenic
1163756628 19:19110397-19110419 GGTGAGGCAGTGGGGCGTGTGGG + Intronic
1163847857 19:19647338-19647360 GGGGAGGCAGGTGTGGGTGTGGG + Intronic
1164299833 19:23952148-23952170 GGTAAGACAGACATGGATGTTGG - Intergenic
1165073715 19:33269554-33269576 GGGGAGCCTGTGGTGGGTGTTGG + Intergenic
1165363722 19:35351646-35351668 GGTGAGACGGAGCCGGGCGTGGG - Exonic
1166198398 19:41220881-41220903 TGTGTGACGGAGGTGGGAGTGGG - Intronic
1166326575 19:42054477-42054499 GGTGGGACAGAGGCGGGGGTGGG + Intronic
1166349828 19:42191303-42191325 GCTGACACAGAGCTGGGAGTTGG - Intronic
1166669924 19:44703706-44703728 GCTGGGGCAGAGGCGGGTGTTGG - Intronic
1167177712 19:47877136-47877158 GATGAGCCAGAGGAAGGTGTTGG + Intronic
1167314770 19:48756849-48756871 GGTGGGACAGAGTCGGGTGGTGG + Intronic
925207165 2:2016556-2016578 GCTGTGACAGAGAAGGGTGTTGG - Intronic
925625822 2:5841471-5841493 AGTGAGACAGAGGTGGATTGAGG + Intergenic
925904475 2:8531254-8531276 GGAGAGACAGAGAGAGGTGTAGG + Intergenic
926137588 2:10347460-10347482 GGTGGGGCAAAGGTGGGCGTGGG + Intronic
927341218 2:21984868-21984890 GGAGAAAGAGAGGTGTGTGTGGG - Intergenic
927812023 2:26185475-26185497 TGTGGGACAGAGATGCGTGTAGG + Intronic
927893982 2:26769681-26769703 GCTGAGGCAGAGGTGGCTGGAGG - Intronic
928188910 2:29143357-29143379 GTGGAGACAGAGATGGTTGTAGG - Intronic
929210300 2:39349618-39349640 GGAGAGACAGAGGAGGGAGAAGG + Intronic
929758826 2:44789585-44789607 TGTGAGACAGAGTTCTGTGTGGG - Intergenic
930128966 2:47828758-47828780 GGTAAGAAAGAGGAGGGTGCTGG + Intronic
930349925 2:50237961-50237983 GGAGAGACAGAAGTGTGTGTAGG - Intronic
932141087 2:69278832-69278854 AGTGAGACAGTGGTGGCAGTTGG + Intergenic
933714110 2:85347816-85347838 GGTAAGAGAGAGGTGGCTGTTGG - Intronic
935189234 2:100762683-100762705 ACTGAGACTGAGGTGGGTGGAGG - Intergenic
936462127 2:112721793-112721815 GGGGAGAGAGAGGAGGATGTTGG - Intronic
937771775 2:125727915-125727937 GGTGAGCCAGGGGTGGGTCCTGG - Intergenic
937993239 2:127675374-127675396 GGTGAGAGTGAGGCGGGGGTGGG + Intronic
940802076 2:158144457-158144479 GGACAGACAGAGGTGTGTGGAGG + Intergenic
941122940 2:161552847-161552869 AATGAGACAGATGTGGGAGTGGG + Intronic
942391068 2:175493450-175493472 CGTGAGACAGAGAAGGGAGTAGG - Intergenic
942401607 2:175609182-175609204 GTTGAGACCGAGGTGGGGGCCGG - Intergenic
942955023 2:181763784-181763806 ATTGAGAGAGAGGTGGGGGTAGG + Intergenic
945623290 2:212169808-212169830 GGTGAGAGAGAGCTGTGTGAAGG - Intronic
945803635 2:214464592-214464614 GGTGAGACCTAGGTCTGTGTTGG - Intronic
946147193 2:217739930-217739952 GGGGAGACAGAGGCTGATGTAGG - Intronic
946559434 2:220896394-220896416 GGTGCGGCAGAGGTGGGAGGAGG + Intergenic
946806350 2:223474799-223474821 TCTCAGACAGAGGTGGGTATAGG + Intergenic
947540879 2:230976968-230976990 ACTGAGACAGAGGCGGGGGTTGG - Intergenic
948223202 2:236289657-236289679 GGTGAGAAGGAGGAGGGTGGAGG + Intergenic
948311711 2:236992104-236992126 GGTGAGTCAGAGGTGAGGGTTGG - Intergenic
948464445 2:238145540-238145562 GGTGAGCCAGAGGTGGGACCAGG - Intronic
948480094 2:238243693-238243715 GGGAAGACAGAGGTGCGTGGAGG + Intergenic
948671985 2:239574684-239574706 GGTGAGAGTGAAGTGGGTGGGGG - Intergenic
948786696 2:240356359-240356381 GGTGAGGCAGAGGTGTGAGTCGG + Intergenic
948858540 2:240741908-240741930 TGGTAGACAGAGGTGGGTGAAGG - Intronic
1168826251 20:816309-816331 GGTGAGAAAAAGGTGGGAGATGG + Intergenic
1169297392 20:4411959-4411981 GGTGAGCCCGAGGGGGCTGTTGG + Intergenic
1169521270 20:6375679-6375701 GGAGGGAGAGAGGTGAGTGTGGG + Intergenic
1169911549 20:10651461-10651483 GGTGAGAGAGGGGCGGGTGCAGG - Intronic
1172192645 20:33071194-33071216 GGTGGGACAGGGGTGGTTGGGGG + Intronic
1172481742 20:35275615-35275637 GGTGAGGCAGAGATGGCTGCAGG + Exonic
1172525767 20:35599997-35600019 GTTGAGGCAGAGGTGGTTGAGGG - Intergenic
1172620051 20:36312820-36312842 GGGCAGACAGAGGTGGGTCCGGG + Intronic
1173582832 20:44159596-44159618 GGTAGGACAGCGGTGGGGGTGGG - Exonic
1173827064 20:46054889-46054911 GGGCAGACAGAGGTTGGGGTTGG - Intronic
1173843792 20:46175509-46175531 GGTGTGGCAGAGGAGGGTGAGGG - Intronic
1174163176 20:48565985-48566007 TGTCAGATAGTGGTGGGTGTTGG + Intergenic
1174875260 20:54220919-54220941 GGTGGGACACAGGTGGATTTTGG - Intronic
1175187785 20:57190506-57190528 GGTGAAGCCGAGGTGGGTATGGG + Intronic
1175486613 20:59351452-59351474 GCAGGGACAGGGGTGGGTGTGGG - Intergenic
1175990257 20:62785243-62785265 GGTGGGACAGAGGTGGGGGATGG + Intergenic
1176058543 20:63161542-63161564 GGTGAGTCAAAGGCGGGAGTGGG - Intergenic
1176142119 20:63549307-63549329 GAGGAGACGGCGGTGGGTGTGGG - Intronic
1177410827 21:20728626-20728648 GGGAAGACAGAGATGGGTTTTGG + Intergenic
1179788670 21:43743395-43743417 GGGGAGAGGGAGGTGGGTGCAGG - Intronic
1179853877 21:44153466-44153488 GGTGAGAAAGGCGTGGGTGGGGG + Intergenic
1180085753 21:45507232-45507254 GGGGAGGGAGAGGTGGGTGCTGG + Intronic
1181027269 22:20133250-20133272 GGGCAGAGAGAGGTGGGTGGGGG + Intronic
1181875625 22:25938358-25938380 AATGAAACAGAGGTGGGTGAGGG + Intronic
1182230112 22:28831482-28831504 GTTGTGTCTGAGGTGGGTGTTGG + Intergenic
1182371204 22:29812362-29812384 AGTAAGAAAGGGGTGGGTGTGGG - Intronic
1183315026 22:37132346-37132368 GGGGAGACAGAGGTGGGCAGGGG - Intronic
1183930798 22:41235102-41235124 GGTGAGACCTTGGTGGGTGGTGG - Intronic
1184391689 22:44206852-44206874 AGTGAGAAGCAGGTGGGTGTGGG - Exonic
1184739822 22:46421320-46421342 GGTGAGACAGAGGCTGCTGGAGG + Intronic
1184922040 22:47612728-47612750 GTTGGGGCAGAGGTGGGTGGGGG + Intergenic
1185062574 22:48614810-48614832 TGTGAGACAGATGTGGGGGCCGG + Intronic
1185399302 22:50607736-50607758 GGTGAGACTGAAGTGGCCGTTGG + Intronic
950044921 3:9943392-9943414 TGTGAGACAGAGGTGTGTCCGGG + Exonic
950297563 3:11845295-11845317 TGTGAGAAAGATGTAGGTGTTGG + Intronic
950553829 3:13683442-13683464 GGTGTGAGAGTGGTGAGTGTGGG - Intergenic
950881418 3:16325760-16325782 GGTGAGCCAGAGGAGGGACTAGG + Intronic
953026959 3:39151079-39151101 AGTGAGTCAGAGGTGGGGGGAGG + Intronic
953490087 3:43342341-43342363 TGTGAGAGAAAGGTGTGTGTTGG - Intronic
954457058 3:50605402-50605424 AGTGAGCAAGAGGTGGGTGATGG - Intergenic
954619731 3:51988680-51988702 GGTGGGAAAGAGGTGGGAGAAGG - Intronic
958144095 3:89601676-89601698 ATTGAGACAGAGGTGGTTGGAGG + Intergenic
960036863 3:113110614-113110636 AGTCAGACAGAGCTGGCTGTGGG + Intergenic
960465609 3:117993714-117993736 GGTGAACCAGAGATGGGGGTGGG + Intergenic
960663670 3:120088754-120088776 GGTGAGACAAGAGTGTGTGTTGG - Intronic
960665269 3:120102884-120102906 GATGACAGAGAGGTGGGGGTTGG + Intergenic
960735122 3:120770918-120770940 CCTGAAACAGAGGTGAGTGTAGG + Exonic
960857394 3:122117200-122117222 AGTGAGAGAGAGGTGGATGAAGG - Intronic
960938603 3:122919077-122919099 GGTGTGACAGAGATGGATGGTGG + Intronic
961002846 3:123385525-123385547 GGTGAGACAGGGGTGTGTACAGG + Intronic
961453622 3:127013771-127013793 GGTGCCACAGAGGTGACTGTGGG + Intronic
961463354 3:127067069-127067091 GGTGGCACAGAGGTCAGTGTGGG + Intergenic
961575372 3:127831728-127831750 GGAGACAGAGATGTGGGTGTTGG + Intergenic
961698264 3:128721875-128721897 GCTGAGGCAGAGATGGGAGTTGG - Intergenic
962840070 3:139225333-139225355 GGTTAACCAGAGGTGAGTGTGGG - Intronic
963302901 3:143618592-143618614 GGTGAGAGAGAGGTGGCCTTAGG + Intronic
964468856 3:157030136-157030158 GGTGAGAGAGAGGTGGGGGGAGG + Intronic
965369385 3:167841733-167841755 GGAGAGACAGATGTGTCTGTAGG + Intergenic
965862771 3:173167108-173167130 GATGAAACAGGGGTGGGAGTGGG + Intergenic
966234784 3:177688462-177688484 GGGGAGACATGGGTGGGTGCAGG - Intergenic
966826130 3:183966599-183966621 GGAGAGACAGAGATGGGGGGAGG - Intronic
966908145 3:184542577-184542599 AGAGAGACAGAGGTGGGGGGGGG + Intronic
967525943 3:190492861-190492883 GGTGAGGCTGGGGTGAGTGTGGG + Intergenic
968392914 4:207384-207406 GGTGAGTCACAGGTGGGTGAGGG + Intergenic
968510224 4:992318-992340 GGTGACAGAGGGGTGGGTGGAGG - Intronic
968634472 4:1670873-1670895 GCTGGGACAGAGGTGAGTCTGGG - Intronic
968634536 4:1671191-1671213 GGTGGGACAGAGGTGAGTCCGGG - Intronic
968702997 4:2065454-2065476 GGGGAGACAGAGGTGGAGGGTGG + Exonic
968733324 4:2282048-2282070 GGTGAGACACAGGAAGCTGTTGG - Intronic
968830993 4:2933012-2933034 GGGGAGAGGGAGGTGGCTGTGGG - Intronic
968929964 4:3573591-3573613 GGTGTGACACAGGTGGGAGAGGG + Intergenic
968944168 4:3654895-3654917 GGTGAGACTTAGGTGAGTGGTGG - Intergenic
968977529 4:3829854-3829876 GGTGAGCCAGGGATGTGTGTGGG + Intergenic
969237420 4:5875698-5875720 GGTGAGGAACAGGTGGGGGTTGG + Intronic
969837124 4:9850970-9850992 GGTGGGACACTGGTGGGGGTGGG - Intronic
972734890 4:41830803-41830825 GGTTGATCAGAGGTGGGTGTGGG + Intergenic
973978072 4:56283078-56283100 GATGAGACAGAGGTGTATGCTGG - Intronic
974022227 4:56701884-56701906 GGGGACACTGAGGTGGGGGTTGG + Intergenic
975914523 4:79308417-79308439 GGGGAGGCAGAGGGGGATGTGGG - Intronic
977057910 4:92216932-92216954 GGTGAAGAGGAGGTGGGTGTTGG - Intergenic
978419421 4:108514316-108514338 GGTGGGACAGAGGATGGTTTTGG + Intergenic
978427888 4:108601309-108601331 GGTGGGAGGGAGGTGGATGTGGG - Intergenic
979193414 4:117891082-117891104 GGAGAGAGAGAGGAGGGTATAGG - Intergenic
979279123 4:118844908-118844930 GGGCAGAGAGAGGTGGGTGAGGG + Intergenic
979342756 4:119546643-119546665 TGTGAGACATGGGTGGGGGTGGG - Intronic
980620920 4:135302574-135302596 TGTGAGAGAGATGTGTGTGTGGG + Intergenic
981100799 4:140827074-140827096 GGAGAGCCATAGGTAGGTGTAGG + Intergenic
981728443 4:147872222-147872244 GATGAGACAGAGGTGGCTGCTGG + Intronic
981801906 4:148667619-148667641 GGTAAGCCAGAGGTGGCTGAGGG - Intergenic
982845322 4:160245850-160245872 GGCGTGACAGAGGTGGCTGGAGG + Intergenic
983871851 4:172832765-172832787 CGAGAGACAGAGGTGGGTCCAGG - Intronic
984191608 4:176612862-176612884 AGGGAGACAGAGGTTGGTGGGGG - Intergenic
984809407 4:183781640-183781662 AATGAGACAGAGCTGGGAGTTGG - Intergenic
985181715 4:187272109-187272131 TGTGAGTGTGAGGTGGGTGTAGG - Intergenic
985183176 4:187287457-187287479 AGGGAGACAGAGATGGGGGTGGG + Intergenic
985575529 5:671849-671871 GGAGGGACAGGGTTGGGTGTGGG + Intronic
985661660 5:1160332-1160354 AGAGAGACAGAGATGGGTGGAGG + Intergenic
985705864 5:1401035-1401057 TGTGAGTCAGTGGTGGGTGCTGG - Intronic
985966755 5:3343623-3343645 GGGGGGAGAGAGGTGGGTGGTGG - Intergenic
987063192 5:14262296-14262318 GGTGAAGAAGAGGTGTGTGTTGG + Intronic
987887727 5:23832298-23832320 GGTGGGTCAGTGGTGGGTGCAGG - Intergenic
988651756 5:33159786-33159808 GGTGAGACAGAGATGAGTATGGG - Intergenic
988792580 5:34622332-34622354 GCTCAGACAGAGGTGGGTGGGGG - Intergenic
990382429 5:55230884-55230906 GGTGAGGCAGATGTGGGGCTGGG - Intergenic
990443024 5:55865737-55865759 GGTGAGAAAGAGGAGGGTGTGGG + Intronic
990637754 5:57748528-57748550 GTTGAGATAGAGGAAGGTGTGGG + Intergenic
990737123 5:58876776-58876798 GGTGAAGGAGAAGTGGGTGTTGG - Intergenic
990987970 5:61658779-61658801 GGTGAGGCAGAAGTGGGAGCTGG + Intronic
991219670 5:64198887-64198909 CGGGAGACAGAGGTGGCAGTGGG - Intronic
991593562 5:68279231-68279253 GGTGGGACAGAGGATGGGGTAGG + Intronic
991630259 5:68649598-68649620 GATGGGAGAGAGGTGGGAGTTGG - Intergenic
991934368 5:71787341-71787363 TGTGAGACTGAGGTGGTCGTGGG + Intergenic
995258727 5:110076869-110076891 GGTTAGTCAGAGTTGGGTTTTGG + Intergenic
995996706 5:118308936-118308958 GGAGAGACAGTGTAGGGTGTTGG - Intergenic
996089197 5:119334441-119334463 TGGAAGACATAGGTGGGTGTTGG + Intronic
996342895 5:122457674-122457696 GGCGAGGCTGAGGTGGGTGTGGG - Intronic
997523843 5:134540039-134540061 GGTGAGGTGGAGGTGGGGGTGGG + Intronic
997605754 5:135174661-135174683 GATGGGGCATAGGTGGGTGTTGG - Intronic
997697324 5:135871873-135871895 GATGAGACTGAGGTGGGAGAGGG - Intronic
998355412 5:141531416-141531438 TGGGAGACTGAGGTGGGTGGAGG - Intronic
998521168 5:142801929-142801951 GGTGAGACTGGAGTGGGTGCGGG + Intronic
998536285 5:142934081-142934103 GGAGAGACAGTAGTGGGTTTGGG - Intronic
999139784 5:149351846-149351868 GATGAGAAAGGGGTGGGTATGGG - Exonic
999210190 5:149881597-149881619 GGGGAGACGGAGGAGAGTGTGGG + Intronic
999493189 5:152071557-152071579 GGTGTGGCAAGGGTGGGTGTGGG + Intergenic
1001271051 5:170312019-170312041 GGAGAGACAGAGGTGTGGCTTGG - Intergenic
1001482207 5:172096231-172096253 GGTGAGGCAGCAGGGGGTGTTGG - Intronic
1001992795 5:176132484-176132506 GGTGGGGCAGGGGTGGGGGTAGG + Intergenic
1002092167 5:176812004-176812026 GGTCAGGCAGTGGTGGGTGCAGG - Intronic
1002316845 5:178349288-178349310 GATGTGACAGAGGTCGGGGTAGG + Intronic
1002710610 5:181192488-181192510 GGACAGAAAGTGGTGGGTGTAGG + Intergenic
1003047859 6:2751267-2751289 GGGCAAACAGAGGTGGCTGTGGG - Intergenic
1003054452 6:2805783-2805805 GATGAGAGAGAGCTGGCTGTAGG - Intergenic
1003200906 6:3959594-3959616 GCTGAGCCAGAGGTGTGTGCAGG + Intergenic
1003318886 6:5035433-5035455 GCTGAGCCAGAGGTGTGTGCAGG - Intergenic
1004022871 6:11790449-11790471 GGGGAGACAGAGGTAGGTGGAGG - Intronic
1004576300 6:16898762-16898784 AGAGAGAGAGAGGTGGGTGGGGG - Intergenic
1005995479 6:30928488-30928510 GGAGAAACAGAGGTGAGGGTGGG + Intergenic
1006182775 6:32164017-32164039 TGTGGGCCAGAGCTGGGTGTAGG + Intronic
1006832379 6:36976677-36976699 GTTGACACGGAGGTGGGTCTTGG - Intronic
1007135920 6:39521949-39521971 GATGAGACAGAGGTGGGGCAAGG - Intronic
1007606076 6:43119139-43119161 GGTGAGGCAGGGTTGGGTGCAGG + Intronic
1007708680 6:43807078-43807100 GGTGAGACAGAGATGGAAGATGG - Intergenic
1007922839 6:45626376-45626398 GGTCACACTGAGGTGGGTGTTGG - Intronic
1008252133 6:49253149-49253171 GCAGAGACAGAGTTGGGGGTGGG + Intergenic
1013429348 6:110041994-110042016 GGAGATAAAGAGGTGAGTGTGGG + Intergenic
1014203696 6:118631809-118631831 GCAGAGAGAGAAGTGGGTGTGGG + Intronic
1014410816 6:121117626-121117648 TGGGAGACAGTGGTGGGAGTGGG + Intronic
1014780216 6:125556851-125556873 TGAGAGACAGAGGTGGGTCATGG + Intergenic
1016217851 6:141624841-141624863 GGAGAAACAGAGGTGGGTATGGG - Intergenic
1017654232 6:156612171-156612193 GGTTAGACAGAGGTGAGTGAAGG + Intergenic
1018706856 6:166469784-166469806 CGTGACACAGAAGTGGGTGGAGG - Intronic
1018909028 6:168091389-168091411 GGGGAGACAGAGATGGCTCTGGG - Intergenic
1019304465 7:326428-326450 GTTGAGACAGAGATGGGCGCTGG + Intergenic
1019646743 7:2134336-2134358 GGTGAGAGAGAGCAGGGTATGGG - Intronic
1019889247 7:3932860-3932882 GGTGAGACAGAGGTGGGTGTTGG - Intronic
1020261264 7:6531836-6531858 GGTGACCCAGAGGGGGGTGTTGG + Intronic
1021775785 7:24054091-24054113 GGTCAGGGAGAGGTGGGTGGAGG - Intergenic
1022038181 7:26553936-26553958 GATGAGACAAAGGTGGGGCTGGG - Intergenic
1022232577 7:28428472-28428494 GGTGAGAAAGAGTTGGATTTTGG + Intronic
1022573286 7:31474135-31474157 GACGAGACAGGGCTGGGTGTGGG - Intergenic
1022887430 7:34661150-34661172 CCTGTGACAGAGGTGGGTGGGGG + Intronic
1023743830 7:43303829-43303851 TGTGGGACAGGGGCGGGTGTAGG - Intronic
1023834062 7:44058280-44058302 GGTGAGCCAGAGGTGGAGGCTGG + Exonic
1023863324 7:44227737-44227759 TGGGGGACAGAGGAGGGTGTGGG + Intronic
1023863337 7:44227776-44227798 TGGGGGACAGAGGAGGGTGTGGG + Intronic
1024254017 7:47526563-47526585 GGTCAGACAGAGCTGGGTCCTGG - Intronic
1024544389 7:50505145-50505167 GGAGAGACAGACATGTGTGTGGG - Intronic
1024765602 7:52654597-52654619 GATGATGCAGAGGTGAGTGTGGG - Intergenic
1026864058 7:73811708-73811730 GGTGAGCCAGAGGTAGGATTTGG - Intronic
1026893755 7:73998401-73998423 GGGCAGCCAGAGGTGGGAGTGGG + Intergenic
1027358212 7:77380627-77380649 GGTGGGTAAGAGGTGGGGGTAGG + Intronic
1027480758 7:78693839-78693861 GTGGAGCCAGCGGTGGGTGTGGG - Intronic
1027840459 7:83304633-83304655 GGTGAGAGAGAGGAGGGTGTGGG + Intergenic
1028247600 7:88499876-88499898 GGTGACACAGAGGCTGGTGGAGG - Intergenic
1029515582 7:101021158-101021180 GAGGAGACAGAGGTGAGGGTTGG - Intronic
1031988325 7:128178391-128178413 AGTGGGACAGAGGTGGGAGATGG + Intergenic
1032209606 7:129901434-129901456 GGTGGGATAGAGGTCGGTGGGGG + Intronic
1032738449 7:134714054-134714076 GAAGAGACAGAGGTGGGAGGTGG - Intergenic
1033157942 7:138972365-138972387 GTTGAGAGAGAGGTGGGGGAGGG - Intronic
1033333705 7:140435246-140435268 GGAGAGGCAGATATGGGTGTGGG + Intergenic
1033623390 7:143083726-143083748 TGTGAGACAGAGAAGGATGTGGG + Intergenic
1034196502 7:149252409-149252431 GGAGAGGCAGAGGTGGGTGGTGG + Intronic
1036110571 8:5896266-5896288 TGTGAGAGAGAAGTGGGTGGGGG - Intergenic
1036987242 8:13548414-13548436 GGTGAAACAGAGGTGGAATTTGG + Intergenic
1037941179 8:22952187-22952209 GGTGGGACAGAGTTGGGTCAAGG - Intronic
1038175319 8:25176939-25176961 GGTGAGGCAGAGTTGGCTCTTGG - Intergenic
1038848596 8:31252698-31252720 GGTGAGACAGAGGTGGAAGAGGG + Intergenic
1039064694 8:33598487-33598509 GGGGGGACAGGGGTGGGTGGTGG + Intronic
1039421603 8:37448100-37448122 TCTGAGACAGAGTTTGGTGTAGG + Intergenic
1040025055 8:42774277-42774299 TGTGAGACAGAAGTGGGAGCTGG + Intronic
1041872319 8:62648891-62648913 GCTGAGACAGAGGGTGGTGTTGG + Intronic
1042039041 8:64572858-64572880 GGTGAGGCAGTGGTGGGTGAGGG + Intergenic
1042194381 8:66220068-66220090 CCTGAGACAGGGGTGGGTGCGGG + Intergenic
1042702904 8:71636413-71636435 GGTTAGACTGACGTGGGTGGCGG + Intergenic
1043676347 8:82960468-82960490 GGTGTGAGTCAGGTGGGTGTAGG - Intergenic
1043745813 8:83872085-83872107 GCTGAGACAGAGATGAGAGTAGG - Intergenic
1044413343 8:91909606-91909628 GGTGAGGCTCAGGTGGGGGTAGG + Intergenic
1044522947 8:93220683-93220705 TGTGAAACAGAGGTGGGAGGTGG + Intergenic
1045879571 8:107021769-107021791 GGTGGGAGAGAGGTGGGGGTTGG + Intergenic
1047000789 8:120570458-120570480 GTTGACACAGAGGTGGGAGATGG - Intronic
1047436041 8:124836121-124836143 GGAGGAGCAGAGGTGGGTGTGGG - Intergenic
1047514752 8:125544546-125544568 GGAGAGTCAGAGGTGGGAGGAGG + Intergenic
1047650202 8:126912169-126912191 AGTAAGAGAGAGGTGGGTATAGG + Intergenic
1047927407 8:129694960-129694982 TGGGAGGCTGAGGTGGGTGTGGG + Intergenic
1048801098 8:138194287-138194309 GCAGAGACAGAGGAGGGTGTTGG - Intronic
1049157154 8:141074076-141074098 GGGGACACAGAGGTGGATGGGGG + Intergenic
1049642221 8:143720870-143720892 GGGGGGACAGAGGTGGGGGCAGG + Intronic
1049941457 9:549990-550012 GGGGACACTGAGGTGGGTTTTGG + Intronic
1051139492 9:13963401-13963423 GAGGAGAGAGAGGTGGCTGTTGG - Intergenic
1051349642 9:16186765-16186787 GAGGAGACAGTGGTGGGTATGGG + Intergenic
1051679330 9:19591220-19591242 GTTGAGAAAGTGGTGGGTGTAGG - Intronic
1053147510 9:35721805-35721827 TATGAGGCAGAGGTTGGTGTTGG + Intronic
1053440576 9:38112915-38112937 AGGGAGACAGACGTGGGTGAGGG + Intergenic
1053550247 9:39070540-39070562 GGTGGGGCAGAGGTGGGGATAGG + Intergenic
1053814358 9:41890651-41890673 GGTGGGGCAGAGGTGGGGATAGG + Intronic
1054460150 9:65458317-65458339 GGTGTGACACAGGTGGGAGAGGG - Intergenic
1054460218 9:65458526-65458548 GGTGTGACACAGGTGGGAGAGGG - Intergenic
1054616238 9:67296789-67296811 GGTGGGGCAGAGGTGGGGATAGG - Intergenic
1054648597 9:67609558-67609580 GGTGGGAGAGAAGTGGATGTGGG - Intergenic
1055094237 9:72394821-72394843 GATGACACAGGGGTGGGAGTGGG - Intergenic
1055594453 9:77850898-77850920 TGTGAGACAGATGTGGGGGTGGG - Intronic
1056063635 9:82910567-82910589 GGTGAGCCAGAGAGGAGTGTGGG - Intergenic
1056618602 9:88191086-88191108 GTTGAGACAGAGCTGGGAATTGG - Intergenic
1056711479 9:88995262-88995284 GGAGAGAGAAAGGGGGGTGTTGG + Exonic
1056794746 9:89650178-89650200 TGTGAGAGAGAGGGGGGTGGTGG + Intergenic
1056897405 9:90563855-90563877 GGTTACACAGAGGTGGGAGCAGG - Intergenic
1057124730 9:92608091-92608113 GGTGATATAGGGGTGGCTGTTGG - Intronic
1057547144 9:96027223-96027245 GGGGCGCAAGAGGTGGGTGTTGG - Intergenic
1057750759 9:97790952-97790974 GTTGAGACTGAGGTGCCTGTTGG - Intergenic
1057843325 9:98503311-98503333 ACTGAGAAAGAGGTGGGTGAGGG + Intronic
1057886395 9:98833201-98833223 TGGGAGACAGATGTGGGAGTTGG + Intronic
1060247663 9:121959667-121959689 GGTGAGGCAAGGGTGGCTGTGGG - Intronic
1060396146 9:123318352-123318374 GGTGAAACAGAGGAAGGTGCTGG + Intergenic
1060759791 9:126237585-126237607 GGAAAGCCAGAGCTGGGTGTGGG + Intergenic
1061068334 9:128293236-128293258 GGTTAGACAGACCTGGGTGCTGG - Intergenic
1061164143 9:128912726-128912748 GGTGAGTGAGAGGTGGGAGGTGG + Intronic
1061164781 9:128916054-128916076 GGTGAGAGTGAGGTGGGTGTGGG - Intronic
1061261984 9:129485464-129485486 GGAGAGAGAGAGGTGGGTTTTGG + Intergenic
1062282746 9:135759290-135759312 GGTGACACAGGGGTGGGCCTGGG - Intronic
1062360700 9:136186601-136186623 GCTGAGCCAGAGCTGGGTGGGGG - Intergenic
1062728839 9:138097111-138097133 GGGGACACAGAGGTGCATGTTGG - Intronic
1062732652 9:138118534-138118556 GGTGAGACTGAGATGGATTTGGG + Intronic
1185498738 X:581688-581710 GGTGAGAGAGAAATGGGTGACGG + Intergenic
1185866889 X:3632060-3632082 GGTGACAGAGAAGTGGGGGTGGG + Intronic
1186006302 X:5076291-5076313 GGAGAGACAGCGAGGGGTGTGGG - Intergenic
1188005060 X:25011356-25011378 GGTTGGAAAGAGGTGGGGGTGGG + Intronic
1188308403 X:28586729-28586751 GGGGAGACAGTGATGGGGGTGGG + Intergenic
1189129652 X:38485160-38485182 GCTCAGAGAGAGGTTGGTGTAGG + Intronic
1189289104 X:39872785-39872807 GGAAAGAGAGAGGTGGGTGGGGG - Intergenic
1189324895 X:40106187-40106209 GGTGGGACGGAGGTGGGGGGTGG - Intronic
1190103424 X:47540921-47540943 TGTGAGGCTGAGGTGGGTGGTGG - Intergenic
1191089578 X:56605922-56605944 GGTGTGGCACAGTTGGGTGTGGG + Intergenic
1191129835 X:56995706-56995728 AGTGAGAGAGAGGTGGTTGTGGG - Intergenic
1191937547 X:66441463-66441485 GCTGAGCCAGAAGTGGATGTAGG - Intergenic
1196807975 X:119605709-119605731 GGTGAGGAAGGTGTGGGTGTCGG - Exonic
1197181723 X:123543973-123543995 GGCTAGGCAGAGGTGGGTGAAGG - Intergenic
1197615287 X:128683749-128683771 GGTGGGGCTGAGGGGGGTGTGGG - Intergenic
1198579662 X:138049382-138049404 GATGGGACAGATGTGGTTGTGGG - Intergenic
1198766737 X:140087970-140087992 GGGAAGACAGAGGTGGGTGTTGG - Intergenic
1198776260 X:140182544-140182566 GTCGGGACAGAGGTGGGGGTGGG + Intergenic
1200211269 X:154347654-154347676 GGAGACACATAGGTTGGTGTGGG + Intergenic
1200270301 X:154676438-154676460 GGTGATGCAGAGCTGGCTGTGGG + Intronic
1200949053 Y:8875234-8875256 AGTGAGACACAGCTGAGTGTGGG + Intergenic