ID: 1019889248

View in Genome Browser
Species Human (GRCh38)
Location 7:3932866-3932888
Sequence CACACAGGTGAGACAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889248_1019889254 -7 Left 1019889248 7:3932866-3932888 CCCACCTCTGTCTCACCTGTGTG 0: 1
1: 0
2: 0
3: 33
4: 338
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889248 Original CRISPR CACACAGGTGAGACAGAGGT GGG (reversed) Intronic
900121505 1:1050364-1050386 CCCACAGGAGAGACGGAGGTGGG - Intronic
900538385 1:3190434-3190456 CACACAGGAGGGAGAGAGGAGGG - Intronic
902747619 1:18483801-18483823 CACACAGGTGGGAAAGATGGAGG + Exonic
904095942 1:27977482-27977504 CACATAGCTGAGACACAGATGGG + Intronic
904340533 1:29831137-29831159 CACAAATGTGAGACATCGGTGGG + Intergenic
904808922 1:33150848-33150870 CACTCAGGTGTGACAGTGGAGGG + Intronic
905101692 1:35529364-35529386 CACACAGATGAGAAAGAGTAAGG - Intronic
905621298 1:39450361-39450383 CACACAACTGATACAGAGCTAGG + Intronic
905668272 1:39775348-39775370 CTCAGAGATGAGACAGAGGAGGG + Intronic
906012292 1:42539304-42539326 AACAAAGGTGAGACTGAGTTAGG + Exonic
908150934 1:61302051-61302073 TACACAGGGGAGATAGTGGTAGG + Intronic
909039365 1:70630706-70630728 CACACAGGTCCGACATATGTGGG - Intergenic
909187431 1:72505923-72505945 CTGATAAGTGAGACAGAGGTAGG - Intergenic
909715633 1:78702950-78702972 AACACAGGTGAAGCAGATGTGGG - Intergenic
909915214 1:81309414-81309436 CACACAGTTGGGACAGAACTGGG + Intronic
911044114 1:93614750-93614772 CAAACAGTTGAGTCAGAAGTGGG - Intronic
911505943 1:98751472-98751494 CAGGAAGGTGAGCCAGAGGTGGG - Intronic
912940354 1:114039379-114039401 CCCACAGGTGAGACAGATCTTGG + Intergenic
913120292 1:115734047-115734069 AGCACAGGTGAGAGAGGGGTTGG + Intronic
913178086 1:116293276-116293298 CGCACAGGAGAGACAAAAGTGGG + Intergenic
915934967 1:160085006-160085028 CAGTGAGGTGAGACAGGGGTCGG + Intronic
918336594 1:183521343-183521365 CACTTAGGGGAGGCAGAGGTGGG - Intronic
919159095 1:193805525-193805547 CACACACGTGAAACACAGTTGGG + Intergenic
920099717 1:203509273-203509295 CACACAGTTCAGACACAGGAGGG + Intergenic
920446452 1:206022172-206022194 CACAGAGGGGACCCAGAGGTTGG + Exonic
923628348 1:235632385-235632407 CACACAGATGAGAAACATGTTGG - Intronic
924084964 1:240441479-240441501 TACAGAGGTGAGAAACAGGTTGG - Intronic
924548614 1:245053526-245053548 AACATAGGTGAGATATAGGTGGG + Intronic
924685125 1:246281181-246281203 CACACAGGTGAGAAGGAAGTGGG + Intronic
1062937647 10:1400191-1400213 CACGCAGGAGAGACAGACGCAGG - Intronic
1062958892 10:1558275-1558297 CACGGAGGGGGGACAGAGGTGGG - Intronic
1063545845 10:6980756-6980778 GACACAGGGGAGGCAGAGGCAGG - Intergenic
1064505011 10:16019246-16019268 AACAAAGGTGAGAGAGAGTTTGG - Intergenic
1065175429 10:23070659-23070681 AACAGAGGGGAGACAGAGATTGG + Intergenic
1065317353 10:24476204-24476226 CACACAGATGACACTGAGCTAGG - Intronic
1066651992 10:37665102-37665124 TACAAAGGTGAGACAGGCGTAGG + Intergenic
1067238765 10:44472994-44473016 CACACAGGTGCGCCAGAGTGGGG - Intergenic
1067287937 10:44921122-44921144 CACACAGGAGGGACAGAGACTGG + Intronic
1068150861 10:53129018-53129040 CACACACATAAAACAGAGGTGGG - Intergenic
1068199109 10:53760122-53760144 CACGGAGGGGAGAGAGAGGTAGG + Intergenic
1068842919 10:61636177-61636199 CTTACTGGTGAGTCAGAGGTAGG - Intergenic
1070098440 10:73361402-73361424 CACACACGGGAGGCTGAGGTGGG - Intergenic
1070449289 10:76541791-76541813 CACATAGGGGAGGCAGAGGCAGG - Intronic
1070699604 10:78591557-78591579 GAGACAGATGAGACAGAGGTTGG + Intergenic
1071164327 10:82786875-82786897 CAAACATGAGAGACAGAGGAGGG - Intronic
1071602187 10:86963721-86963743 CCCACAGGAGAGACAGAAGGTGG + Intronic
1072178535 10:92954724-92954746 CATATAGGTTTGACAGAGGTAGG + Exonic
1072228195 10:93389130-93389152 AACACAGGAGAAACAGAGGTAGG - Exonic
1072276553 10:93828929-93828951 TACACAGAAGAGGCAGAGGTGGG + Intergenic
1072452532 10:95550069-95550091 GACACAGGAGATACAGAGGATGG + Intronic
1072833824 10:98689942-98689964 GTCACATGAGAGACAGAGGTTGG - Intronic
1073577451 10:104638735-104638757 CAGACAGGAGAGACAGAAGGAGG + Intergenic
1074423871 10:113333715-113333737 CACACAGGTGAATAACAGGTGGG - Intergenic
1074496168 10:113981866-113981888 CACAAAGAGGAGACTGAGGTAGG - Intergenic
1074986399 10:118663571-118663593 GACAGATGAGAGACAGAGGTAGG + Intergenic
1075127465 10:119712013-119712035 CACACAGGGGAGAAAGTGATAGG - Intergenic
1075187051 10:120272025-120272047 CAGACAGATGATACAGAGATAGG - Intergenic
1075330388 10:121569937-121569959 CACACAAGAGAGAAAGAGGTTGG + Intronic
1075531094 10:123230411-123230433 CACAGAGGTGAGAGGGAGGCTGG + Intergenic
1076262708 10:129080246-129080268 CTCACAGGTGATCCAGACGTTGG + Intergenic
1076921742 10:133457903-133457925 CACACAGTTGAGGCAGGGCTGGG - Intergenic
1077218168 11:1403730-1403752 CATGCTGGTGAGACAGAAGTGGG + Intronic
1079533917 11:21487532-21487554 CACACAAATGAGAAAGAGGAAGG + Intronic
1080357973 11:31473552-31473574 CACATAGGAAAGATAGAGGTAGG + Intronic
1080834760 11:35929891-35929913 CATACAGTTGAGAGAGAGGAAGG - Intergenic
1080928407 11:36782636-36782658 CAGAGAGGTGAGACAGAAGAGGG + Intergenic
1083626922 11:64076674-64076696 CACACAGCTCAGAAAGAGGTTGG + Intronic
1083830104 11:65226011-65226033 CACACTGGTGAGGAAGGGGTCGG - Intergenic
1083880459 11:65545898-65545920 ATCAGAGGTGAGACAGAGGGTGG - Intronic
1084264790 11:67999339-67999361 CACACAGGAGTGGCACAGGTCGG - Intronic
1084451721 11:69242938-69242960 CCCACATGTGAGAAGGAGGTGGG + Intergenic
1084997572 11:72996969-72996991 GAGACTGGGGAGACAGAGGTTGG + Intronic
1085146291 11:74200930-74200952 CACTCGGGAGAGACTGAGGTGGG - Intronic
1087175710 11:95092933-95092955 CACACAGGGGAGGAAGAGGCAGG + Intronic
1087462859 11:98467100-98467122 GACTCAGGTGACACAGATGTTGG - Intergenic
1087678581 11:101191419-101191441 CACACTGATGGTACAGAGGTGGG + Intergenic
1087918059 11:103832477-103832499 CACACAGGTAAGAAAGACCTAGG + Intergenic
1088016140 11:105062547-105062569 CACAGTGGAGAAACAGAGGTTGG - Intronic
1088021208 11:105121861-105121883 CACACTGGAGAAACAGGGGTGGG - Intergenic
1088081711 11:105924642-105924664 CACACAGAAGAGCCAGAGGACGG + Exonic
1088377680 11:109159911-109159933 GACACAGGTGGGACACAGGCTGG + Intergenic
1089138919 11:116271047-116271069 CCCACACGTGGGGCAGAGGTGGG - Intergenic
1089270496 11:117298644-117298666 CTCACAGGTGACACAGACCTAGG + Intronic
1089272311 11:117310153-117310175 CACTCAGGTGAGGCCGAGGCGGG - Intronic
1090502180 11:127272039-127272061 CATATAGGTGAGAAAGAGGATGG + Intergenic
1091025307 11:132136194-132136216 TACGGAGGTGAGACACAGGTGGG - Intronic
1092261789 12:6956803-6956825 CAGACAGGTGGGGCAGGGGTAGG - Intronic
1092282946 12:7110850-7110872 CACCTAGGTGAGACCAAGGTGGG - Intergenic
1093051697 12:14511851-14511873 CACAGAGGTGAGCCAAAGCTGGG - Intronic
1093663682 12:21787059-21787081 CATAAAGGTGAGAAAGAAGTAGG + Intergenic
1094253366 12:28392906-28392928 TACAGTGGTGAGACAAAGGTAGG + Intronic
1094762076 12:33545468-33545490 CACACAGGATAGTCAGATGTGGG + Intergenic
1096548175 12:52355706-52355728 CATACAGGTGAGACAGCCCTAGG - Intergenic
1096992787 12:55818525-55818547 CACGGAGGTGAGAGAGAGGGTGG + Intronic
1097978430 12:65712351-65712373 CACATTGCTGAGACAGAGATAGG - Intergenic
1098348406 12:69530392-69530414 AACAGAGCTGAGACTGAGGTGGG - Intronic
1100563438 12:95771912-95771934 ATCACAGGTGAGAGAGAAGTTGG - Intronic
1101293567 12:103396998-103397020 CACACAGATCAGACAGATGTTGG - Intronic
1101496856 12:105262980-105263002 CACACAGGCCAGACAGAATTTGG + Intronic
1101805555 12:108060631-108060653 GACACAGGTGAGGCAGAGTAAGG - Intergenic
1103190723 12:118999440-118999462 AACACAGGTGGGACACAGCTGGG - Intronic
1103360668 12:120351579-120351601 CACAGAGGAGAGACAGAGAGAGG + Intronic
1103473804 12:121203482-121203504 CACAGAGGTGAGAGAGACGAAGG - Intergenic
1103508471 12:121457028-121457050 CCCACAGGTAAGACAGACCTCGG + Intronic
1104347525 12:128014841-128014863 GACAATGGTAAGACAGAGGTGGG + Intergenic
1104415456 12:128593947-128593969 AACTCAGGAGAGCCAGAGGTTGG - Intronic
1104476693 12:129076272-129076294 AACACAGGTGAGAGAGAGAGTGG + Intronic
1104728343 12:131091719-131091741 CACAGAGGTGAGGCAGTGGCAGG + Intronic
1104986758 12:132601540-132601562 CACAGAGGTGAGCCAGGGCTCGG - Intergenic
1105303523 13:19154423-19154445 CACACAGGTGGGACAGGGCAGGG + Intergenic
1105706276 13:22969404-22969426 CCCAAAGGTGACACAGGGGTAGG - Intergenic
1106082630 13:26513028-26513050 CAGCCAGGGGAGACAGGGGTGGG - Intergenic
1106571711 13:30933721-30933743 CAAACAGGAGAGACAGAGGAGGG + Intronic
1106616796 13:31337936-31337958 CACACAGGCCTGTCAGAGGTGGG + Intergenic
1106728868 13:32517852-32517874 TCCACAGGGGAGACAGAGGTGGG - Exonic
1108123137 13:47211334-47211356 CAAACTAGTGAGTCAGAGGTTGG - Intergenic
1109930785 13:69214715-69214737 CACAGAGTTCAGACATAGGTGGG + Intergenic
1111664798 13:91253677-91253699 GACACAGGTGAGCCAGAAGGTGG + Intergenic
1112991988 13:105525234-105525256 CACACATGTGAGAAGAAGGTGGG - Intergenic
1114481592 14:23038897-23038919 CAAACAGGTGAAAGGGAGGTGGG + Intergenic
1115983823 14:39083350-39083372 CAGATAGGTGAGAGACAGGTAGG - Intronic
1117227600 14:53678890-53678912 TACACAGGTGAGACAAATATAGG - Intergenic
1118565999 14:67141776-67141798 TATCCAGGTGTGACAGAGGTAGG - Intronic
1118819780 14:69337739-69337761 CACACAGGCTGGCCAGAGGTGGG + Intronic
1120950258 14:90034496-90034518 CACGCAGGCCAGACATAGGTGGG - Intronic
1121466955 14:94121889-94121911 CCCATAGGTGACCCAGAGGTTGG - Intergenic
1121867116 14:97372902-97372924 CACAAAGGAGAGACACAGGTCGG - Intergenic
1121990945 14:98556677-98556699 CACAAAGGTGTGACAAAGATAGG + Intergenic
1122304549 14:100753868-100753890 CACAGAGTTCAGAGAGAGGTGGG - Intergenic
1122597479 14:102903423-102903445 AACACAGGTGAGGCAGGGGCCGG + Exonic
1123056568 14:105573812-105573834 CACACCGGTGAGCCAGGGGCTGG - Intergenic
1123081643 14:105697973-105697995 CACACCGGTGAGCCAGGGGCTGG + Intergenic
1124015104 15:25867116-25867138 CACACTGGTGACACAGCTGTGGG + Intergenic
1125117041 15:36106634-36106656 CAAAGAGGAGAGAAAGAGGTAGG + Intergenic
1125285194 15:38085224-38085246 CGCACACGTGCGAGAGAGGTGGG - Intergenic
1125540908 15:40469633-40469655 CACACAGATGAGCCAGGGGAAGG - Intergenic
1125593934 15:40872681-40872703 CACAGGGGTGAGAAAGAGCTTGG - Exonic
1126410964 15:48372635-48372657 CACACAGAGGATACAGATGTTGG + Intergenic
1126778663 15:52119964-52119986 CTCCCAGGCGAGCCAGAGGTGGG - Exonic
1128038949 15:64552891-64552913 CACTCTGGGGAGGCAGAGGTGGG - Intronic
1128096290 15:64959030-64959052 CTCACAGAGGAGACAGAAGTGGG + Intergenic
1128133954 15:65249203-65249225 CACAGAGTTGAGACAGAAGCAGG - Intronic
1130170684 15:81509822-81509844 GACACAAGTTAGACAGAGGGTGG - Intergenic
1132339315 15:101068029-101068051 CACACACGGGACACAGAGGGAGG + Intronic
1132956928 16:2599255-2599277 GACACAGTTGAGTCAGAGGCAGG - Exonic
1132969280 16:2677708-2677730 GACACAGTTGAGTCAGAGGCAGG - Intergenic
1133606262 16:7391190-7391212 CACCAAGGTGGGACGGAGGTGGG - Intronic
1134247150 16:12548405-12548427 CACAGTGGGGAGCCAGAGGTAGG - Intronic
1134907139 16:17989667-17989689 CAGACAGGCAAAACAGAGGTGGG - Intergenic
1135569222 16:23535418-23535440 CACACAGCTATGACAGAGGTAGG - Intronic
1136994921 16:35182778-35182800 CACACAGGCTAGACAGGGATGGG - Intergenic
1137704511 16:50525212-50525234 CAAAGAGGTGAGACAGAGATGGG + Intergenic
1139239147 16:65372665-65372687 CACACAGTTGGGACAGAGGAGGG + Intergenic
1139273259 16:65703270-65703292 AACACAGGTGAGAAGGGGGTAGG - Intergenic
1140065901 16:71610986-71611008 TACACAGGTGAGACTGAGCTTGG - Intergenic
1142027863 16:87824129-87824151 CACAGAGGGGAGACAGTGGATGG - Intergenic
1142693261 17:1619795-1619817 CACAGAGGTGACAGAGAGGATGG + Intronic
1147480998 17:40762570-40762592 TGCATAGCTGAGACAGAGGTTGG + Intergenic
1148152871 17:45406573-45406595 CACAGAGGCAAGTCAGAGGTTGG + Intronic
1148293234 17:46475575-46475597 CCCACAGGTGAAAAAGATGTAGG + Intergenic
1148315419 17:46693278-46693300 CCCACAGGTGAAAAAGATGTAGG + Intronic
1148957102 17:51362970-51362992 TACACAGGTAAAACAGAGCTAGG - Intergenic
1150344101 17:64391003-64391025 AACCCAGGCGAGACAGAGGGAGG - Intronic
1150656438 17:67042762-67042784 CCCACAGGGAACACAGAGGTGGG + Intergenic
1150950699 17:69800294-69800316 CACACAGGAACGACAGAAGTAGG + Intergenic
1151916333 17:77120905-77120927 CACTTAGGTGAGAGAGAGGCAGG + Intronic
1153423423 18:4934769-4934791 CACAGAGATGACACAGAAGTTGG + Intergenic
1156352144 18:36310822-36310844 GGTACAGGTGAGACACAGGTAGG + Intronic
1158500294 18:57994801-57994823 CACTCATGAGAGAAAGAGGTTGG - Intergenic
1158866615 18:61643852-61643874 GCTAGAGGTGAGACAGAGGTAGG + Intergenic
1161458371 19:4381402-4381424 GAGAGAGGGGAGACAGAGGTAGG - Intronic
1161657304 19:5524194-5524216 CACAGAGGTGAGAGAGAAGAGGG - Intergenic
1163245423 19:16090911-16090933 CACATATGGGAGACAGAGGCAGG - Intronic
1163641942 19:18466973-18466995 CTCACAGGTGAGGCACAGGCAGG - Intronic
1163650265 19:18513478-18513500 CACCCAGGCGAGACAGAGGAGGG + Intronic
1163794534 19:19329533-19329555 ATCACAGGTGAGTCTGAGGTGGG - Intronic
1164802857 19:31092088-31092110 CTGACAGGTGAGACAGGGGCTGG - Intergenic
1165326971 19:35119471-35119493 CACAGGAGAGAGACAGAGGTTGG - Intronic
1166301868 19:41915616-41915638 GAGACAGATGAGACAGAGATGGG - Intronic
1166880882 19:45929325-45929347 GACAGAGGGGAGACAGAGGTGGG + Intergenic
1166927121 19:46276704-46276726 CACACAGATGGAACAGAGCTTGG + Intergenic
1167508158 19:49882000-49882022 CGCACAGGTGATGCACAGGTAGG - Intronic
1167523961 19:49972385-49972407 CTCAAAGGTGAGCCTGAGGTTGG - Intergenic
925025733 2:605909-605931 CACACAGGTGAGCAAGTGGAGGG - Intergenic
925926399 2:8673906-8673928 CACTGAGGTGACACAGATGTTGG + Intergenic
926683994 2:15684664-15684686 GACACAGGAGACACACAGGTAGG - Intergenic
926987330 2:18639198-18639220 CACAAAGATGAGAAAGAGGCCGG - Intergenic
927251004 2:20994755-20994777 CACACTTGGGAGACAGACGTGGG - Intergenic
928091617 2:28378072-28378094 CACACAGGTGTGCCAGGGCTGGG + Intergenic
928124091 2:28604185-28604207 CAGTCACGTGAGACAGAGGAAGG - Intronic
929886505 2:45883544-45883566 CACACAGATGAGCAAGAGGGAGG - Intronic
931225445 2:60325231-60325253 GGCAAAGGTGAGGCAGAGGTGGG + Intergenic
932315169 2:70775848-70775870 CACAATGGTGAGACAGGTGTAGG - Intergenic
932451411 2:71813004-71813026 CACTCAGGTGGGCCAGAGGGAGG - Intergenic
932842767 2:75099164-75099186 CACTGGGGTGAGACAGAGGCTGG - Intronic
934934351 2:98453851-98453873 CAGACAGGAGAGACAGTGGCAGG + Intronic
935264286 2:101381440-101381462 CACACAGGTGAGTCACATCTGGG + Intronic
936255098 2:110904444-110904466 CACCCAGGAAAGACAGAGGCAGG - Intronic
937258284 2:120569743-120569765 CACACAGGTGAGAGAGAGAAGGG - Intergenic
937685984 2:124697950-124697972 CCCAGAGGGGAGACAGAGGATGG + Intronic
938263081 2:129909046-129909068 CACAGAGGTGAGGCAGGGGCTGG - Intergenic
938427067 2:131201505-131201527 CACACAGCAGAGACAGGGTTGGG - Intronic
938641990 2:133290965-133290987 AGCACATGGGAGACAGAGGTGGG - Intronic
939779871 2:146432688-146432710 GACAGAGGTGAGAAAGAGGCAGG - Intergenic
940328000 2:152445174-152445196 CACACAGGTGAAACACAGACTGG - Intronic
940979009 2:159980241-159980263 CTCACAGGTGATATACAGGTGGG + Intronic
941303641 2:163832952-163832974 CTCACTGGTGAAAAAGAGGTAGG + Intergenic
944222330 2:197315025-197315047 CACACATGTGAGCCAGAGATTGG + Intergenic
946436373 2:219658628-219658650 CACAGAGTTGAGTCAGAGGCAGG + Intergenic
946662933 2:222020301-222020323 CACACATGTGCTACAGAGGGTGG + Intergenic
948026540 2:234782511-234782533 CACTCAGGTGTGGCAGAGGCTGG - Intergenic
1168885261 20:1247100-1247122 CAAACAGCTGAGCCAGAAGTGGG + Intronic
1169193233 20:3670623-3670645 AAAACTGGTGAGACAGAGGCTGG + Intronic
1169434602 20:5574624-5574646 GACACTGGGGAGACTGAGGTGGG + Intronic
1170044969 20:12075276-12075298 CTCACAGGTAGGACAGAGCTGGG + Intergenic
1170648921 20:18221565-18221587 CACTCAGGAGAAACAGAGGGAGG - Intergenic
1172595185 20:36146296-36146318 CACACTGGGGATACAGAGATCGG + Intronic
1172833156 20:37853970-37853992 CACAGAGATGAAACAGAGATTGG - Intronic
1173797511 20:45872612-45872634 CACAAAGGTGAGACAGAGCATGG + Intronic
1173944874 20:46942634-46942656 CACACAGGAGAGTCAGAGAAGGG - Intronic
1173974219 20:47174990-47175012 GACTCAGGTGAGACAGGGATGGG + Intronic
1175169283 20:57068763-57068785 CACACAAGACAGACAGAAGTAGG - Intergenic
1175870588 20:62207759-62207781 CACACAGGCAAGACAGGGGCAGG + Intergenic
1175911672 20:62408015-62408037 CAGGCAGGTGACACAGAGGTGGG - Intergenic
1176052280 20:63126188-63126210 CAGACAGGTGAGGCAGATGCAGG + Intergenic
1179101693 21:38360048-38360070 CACACAGCCATGACAGAGGTGGG + Intergenic
1179196179 21:39164769-39164791 CACAATGGTGGGACAGAGGCAGG - Intergenic
1179580290 21:42339027-42339049 CAGGCAGGTGAGGCAGAGGTAGG + Intergenic
1182149686 22:28019363-28019385 CACACAGAGGAGACACAGGAAGG - Intronic
1182427606 22:30283203-30283225 CACACAGATGAGAAAGTGGGGGG - Intergenic
1183131335 22:35839607-35839629 CATTCAGGTGTGACAGAGGCAGG - Intronic
1183237619 22:36631406-36631428 GACACTGCTGACACAGAGGTGGG - Intronic
1185145848 22:49136233-49136255 CACGCAGGGGTGACAGAGGGAGG + Intergenic
1185318076 22:50187308-50187330 CACGCAGGTGTGGCAGAGCTGGG - Intronic
949215554 3:1562845-1562867 CACACAGGTGGCAAAGAGGAAGG + Intergenic
952162217 3:30705432-30705454 CACACAACTGAGACAGAGCAGGG + Intergenic
952949854 3:38514019-38514041 GACACGGGTGAAACTGAGGTTGG + Intronic
953698692 3:45179564-45179586 CACACAGCTGTGAAAGGGGTTGG + Intergenic
954337331 3:49927153-49927175 ATCACAGGTGTGACAGAGCTGGG - Intronic
954381865 3:50223375-50223397 CACACAGGTGAGAAGGGTGTGGG - Intergenic
954412785 3:50378268-50378290 CACACAGGTGAGACTTGGGGAGG - Exonic
955449778 3:59053218-59053240 CACGGAGGTGAGACAGAGACTGG - Intergenic
955931112 3:64057854-64057876 CTCAAAGGTGAGATATAGGTTGG - Intergenic
955964561 3:64374937-64374959 CACACAGGTAAGATAGAGCTGGG + Intronic
956045131 3:65188107-65188129 CACAGCGGTGACAGAGAGGTTGG - Intergenic
956167663 3:66408587-66408609 TACACTGGTGAGTCAGAGGATGG + Intronic
956837137 3:73104520-73104542 CACACAGCAGAAACAGAGGAGGG - Intergenic
958468175 3:94484066-94484088 CAGAAAGGTTAGACAGTGGTGGG + Intergenic
959459559 3:106608487-106608509 GACACATGAGAGAAAGAGGTGGG + Intergenic
959957939 3:112260401-112260423 CCCAAAGGTGACACAGATGTTGG - Intronic
960988145 3:123293568-123293590 CACACAGGTGAGGAGGGGGTGGG + Intronic
961061539 3:123832942-123832964 CACAAAGGAGAGAGAGAGGGTGG + Intronic
961377700 3:126477202-126477224 CAAACAGATCAGACAGAGGTGGG - Intergenic
961422223 3:126815508-126815530 CACAGAGGTGAGAGAGAGGGAGG - Intronic
961463040 3:127064936-127064958 CCCACTGGTGAGACAGCTGTTGG - Intergenic
961817816 3:129560301-129560323 CACAGAGGGGAGACTGAGGCCGG + Intronic
962384363 3:134920991-134921013 TACTCAGGGGAGACTGAGGTGGG - Intronic
964408404 3:156373913-156373935 CACACAGGACAGACACAGTTGGG - Intronic
967625428 3:191678240-191678262 CACAAATGTAAGACAGAGTTTGG - Intergenic
968392911 4:207378-207400 CCCAGAGGTGAGTCACAGGTGGG + Intergenic
968398402 4:264967-264989 CAGACACTTAAGACAGAGGTGGG + Intergenic
968416208 4:436480-436502 CAGACACTTAAGACAGAGGTGGG + Intronic
968473781 4:793572-793594 CACACAGGTGTCACTGAGGGAGG + Intronic
968811866 4:2803677-2803699 CTGACATGAGAGACAGAGGTGGG - Intronic
969042698 4:4313200-4313222 CTCACAGATGAGCCACAGGTGGG + Intronic
969331184 4:6474165-6474187 CAGACAGGTGAGAGAGAGAGAGG - Intronic
970265281 4:14276353-14276375 CTCACATGTGAGAAAGATGTTGG - Intergenic
971968836 4:33595615-33595637 CACACATGGGAGGCCGAGGTGGG - Intergenic
972080928 4:35148036-35148058 CACACAGATGGGATAGAGATAGG + Intergenic
975172176 4:71245111-71245133 TCCAGAGGTGAGAAAGAGGTAGG + Intronic
978193140 4:105939327-105939349 CACTGCGGTGAGAGAGAGGTTGG + Intronic
978735824 4:112083164-112083186 CATACAGGCAAGAAAGAGGTTGG - Intergenic
979582353 4:122375819-122375841 CACAGAGGACAGACAGAGCTAGG - Intergenic
980563929 4:134512583-134512605 CAGACAGGGGAGACACAGGCAGG + Intergenic
981811744 4:148783464-148783486 CAGACAGGTGATACAGATGCTGG + Intergenic
982374671 4:154676903-154676925 CCCAGAGGTGAAAGAGAGGTTGG + Intronic
984714211 4:182911559-182911581 CCCACAGGAGAGACACAGGGAGG + Intronic
985986416 5:3520432-3520454 CACAAAGGTGAAACAGTAGTAGG - Intergenic
986222005 5:5776412-5776434 CACTGAGGTGAAACTGAGGTTGG + Intergenic
986987679 5:13517318-13517340 GAGACAGATGAGACAGATGTAGG - Intergenic
989163165 5:38410731-38410753 CAGTGAGGTGAGACAGAGGAGGG - Intronic
990871643 5:60438269-60438291 CACACAGATGAGAAAGAAGCAGG + Intronic
991396827 5:66212841-66212863 CACAGAGATAACACAGAGGTTGG - Intergenic
992116612 5:73544421-73544443 CACCCAATTGAGACAGAGATTGG - Intergenic
993987320 5:94612770-94612792 CACACAACTGTGACAGAGTTGGG + Intronic
994375766 5:99014690-99014712 CACACAGATGGGACACAGCTTGG + Intergenic
994388488 5:99161561-99161583 CTCACAAGTCAGACAGATGTAGG - Intergenic
995907724 5:117145799-117145821 GACTAAGGTGTGACAGAGGTAGG - Intergenic
995989873 5:118224488-118224510 CACACAGGTGAGAGAGAGAAAGG + Intergenic
997036181 5:130194710-130194732 CACAAAGGTGGGACCCAGGTTGG - Intergenic
997195252 5:131974907-131974929 CAAACATGTGAGCCAGAGGCAGG + Exonic
997432003 5:133847346-133847368 CCCAAAGGGGAGCCAGAGGTGGG - Intergenic
997731914 5:136187705-136187727 CAAACAGCTTAGGCAGAGGTAGG + Intronic
998215817 5:140238042-140238064 CAGTCAGGTGAGACACAGGTTGG + Intronic
998418554 5:141963038-141963060 CACACATGTCAGGGAGAGGTGGG - Intronic
998680005 5:144456478-144456500 CACACAGGGGGGTCAGGGGTAGG + Intronic
1000646656 5:163767921-163767943 AAGACAGGTGAGAGAGAGGCTGG - Intergenic
1001742488 5:174065386-174065408 GACACAGATGAGGCAGAAGTGGG + Intronic
1003245105 6:4376516-4376538 AACTCAGGTGTGAGAGAGGTGGG + Intergenic
1003452280 6:6245964-6245986 CTCACAGGTAAAACAGAGGCTGG - Intronic
1004657412 6:17677137-17677159 GCCACAGGGGAGACAGAGCTTGG + Intronic
1004917001 6:20341482-20341504 CACACAGGTGAGGGTGAGATGGG + Intergenic
1007730562 6:43942903-43942925 GACACAGGTGAGAAAGAGCTGGG + Intergenic
1008442875 6:51553251-51553273 CACACTGGTGAAATGGAGGTTGG - Intergenic
1009491202 6:64294029-64294051 AACACAGGTGAAACAAATGTAGG + Intronic
1012395798 6:98795821-98795843 AACAGAGGCGAGGCAGAGGTTGG + Intergenic
1013064361 6:106669463-106669485 CACACTTGGGAGACTGAGGTGGG - Intergenic
1013129998 6:107223600-107223622 CACACATGGGAGGCTGAGGTGGG + Intronic
1013284991 6:108673465-108673487 CACACAGGTGACACAGATGGTGG - Intronic
1013328398 6:109071037-109071059 CACACAGATGGGAGAGAGGGTGG + Intronic
1014493769 6:122093962-122093984 CACAGTGGTGAGATAGGGGTAGG + Intergenic
1017966427 6:159270925-159270947 CACACATGTGTGACACAGCTAGG - Intronic
1018706858 6:166469790-166469812 CACACGCGTGACACAGAAGTGGG - Intronic
1019889248 7:3932866-3932888 CACACAGGTGAGACAGAGGTGGG - Intronic
1021939762 7:25668145-25668167 CACAGAGGTGCGACAGAAGCGGG - Intergenic
1022566264 7:31405855-31405877 CCCACAGGGTAGACAGAGGGAGG - Intergenic
1022674833 7:32489670-32489692 CACAGAGGATAGACAGAGTTGGG - Intronic
1022942840 7:35256280-35256302 CACACAAGAGACACAGAGCTGGG - Intergenic
1023576412 7:41632701-41632723 CACACAGATTAAACAGAGGAAGG - Intergenic
1024142939 7:46480584-46480606 CACACATGTGGGGCAGATGTGGG - Intergenic
1026296243 7:69054843-69054865 ATCTCAGGTGAGACAGAGGCAGG - Intergenic
1027232447 7:76280653-76280675 CACCCAGGAGAGGCAGAGGCAGG + Intronic
1027270383 7:76515479-76515501 AGGTCAGGTGAGACAGAGGTGGG - Intronic
1029062018 7:97808164-97808186 CACACAAATGAGAAAGAGATGGG + Intergenic
1030127907 7:106171850-106171872 CAGACAGATGAGGCAGTGGTAGG + Intergenic
1030263273 7:107588936-107588958 CACCAAGGAGAGACAGAGTTTGG + Intronic
1032859978 7:135867644-135867666 AAGACAGCTGAGACAGAGGCGGG + Intergenic
1034309850 7:150077785-150077807 CACTAGGATGAGACAGAGGTTGG - Intergenic
1034370935 7:150595925-150595947 CACACAGGAGAGAGAGAGAAAGG + Intergenic
1034686062 7:152972470-152972492 GAGACAGGAGAGACAGGGGTGGG + Intergenic
1034797001 7:154022835-154022857 CACTAGGATGAGACAGAGGTTGG + Intronic
1035299144 7:157885853-157885875 CACAGAGGGGAGACTGAGGCAGG - Intronic
1036217471 8:6892627-6892649 CACACGGATGAGACAGAGATGGG + Intergenic
1037552636 8:19989666-19989688 CACACAGCTGGGACAGAGTTAGG + Intergenic
1038190282 8:25313950-25313972 AACACAGGTGAGACAGAAAGAGG - Intronic
1039290940 8:36093798-36093820 CACACATGGAAGACAGAGATTGG + Intergenic
1040349806 8:46553146-46553168 CACACAAATGAGAAAGAGATGGG + Intergenic
1043847780 8:85181123-85181145 CTCACAGGGGAGACCAAGGTAGG - Intronic
1045673854 8:104588176-104588198 CTAACAGGAGAGACTGAGGTGGG + Intronic
1045772939 8:105766255-105766277 AACACAGATGAGTGAGAGGTTGG - Intronic
1045908776 8:107380853-107380875 AACACAGGTAAGAGAGTGGTGGG - Intronic
1049538180 8:143192348-143192370 CACACAGGAAATACAGAGGCTGG + Intergenic
1052935263 9:34087592-34087614 CACACGGGGGACACACAGGTGGG + Exonic
1053492685 9:38522063-38522085 CACTGAGATGAGACAGATGTTGG + Intergenic
1055106292 9:72516601-72516623 CAAACAAGTGGGACAGAGGTAGG - Intergenic
1056569027 9:87799668-87799690 CACACAGGTGAGTCATGGGAGGG + Intergenic
1057747308 9:97762475-97762497 CACACAGGTGGGAAACAGGAAGG - Intergenic
1058251261 9:102698153-102698175 TACAATGGTGAGACAGAGATAGG - Intergenic
1059770239 9:117416959-117416981 CACAAAGGAGAGACTGAGGGAGG - Intergenic
1060409582 9:123391107-123391129 CACACTGGTGTGACTGTGGTGGG + Intronic
1062056656 9:134472507-134472529 CCCAGAGGTCAGTCAGAGGTGGG + Intergenic
1062108543 9:134768952-134768974 CACACAGCTTAGACACAGATTGG - Intronic
1062115633 9:134806661-134806683 CACACAGGTGGCACTGAGGCTGG - Intronic
1062229291 9:135472483-135472505 CACTGAGGTGAGTCAGATGTGGG + Intergenic
1062290913 9:135793983-135794005 CACCCAGGTGAGGCAGACTTGGG - Intergenic
1062617603 9:137405054-137405076 CTCACAGGTGAGCCAGGGGCTGG + Intronic
1186686072 X:11925739-11925761 GACACAGCTAAGACAGAGTTAGG + Intergenic
1188174046 X:26965836-26965858 CCCACAGGAGAGATAGAGTTTGG + Intergenic
1189281950 X:39825191-39825213 CACACAGGGGAGTTCGAGGTTGG + Intergenic
1190002724 X:46705151-46705173 CACACAGGGGAGAAAGGGGAAGG + Intronic
1190108948 X:47577619-47577641 CACACAGGTCAGAGACAGGCAGG + Intronic
1190362324 X:49661084-49661106 CAGAGAGGAGAGACAGAGGAGGG - Intergenic
1190460187 X:50665521-50665543 AATACCGCTGAGACAGAGGTAGG + Intronic
1190700387 X:52983991-52984013 GACACAGTTGTGACAGTGGTGGG - Intronic
1190736053 X:53256561-53256583 CACACAGCTGGGACAGGGCTGGG - Intronic
1192787478 X:74349276-74349298 CACATAGGTGAGAAAGAGAGAGG + Intergenic
1195003914 X:100668519-100668541 CCCAAAGATGAAACAGAGGTGGG + Intronic
1195510965 X:105714596-105714618 CACACATATGAGACAGAGAGAGG + Intronic
1195743286 X:108088514-108088536 CATACAGGAGAGGCTGAGGTAGG - Intronic
1196285008 X:113869598-113869620 CACAAAGGTGGGAGAGAGGGTGG - Intergenic
1197400529 X:125983896-125983918 CAGTGAGGTGAGACAGAAGTAGG - Intergenic
1201384085 Y:13419321-13419343 CAGTCAGGTGAGACAGAGGGTGG - Intronic