ID: 1019889249

View in Genome Browser
Species Human (GRCh38)
Location 7:3932867-3932889
Sequence ACACACAGGTGAGACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889249_1019889254 -8 Left 1019889249 7:3932867-3932889 CCACCTCTGTCTCACCTGTGTGT 0: 1
1: 0
2: 4
3: 41
4: 360
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889249 Original CRISPR ACACACAGGTGAGACAGAGG TGG (reversed) Intronic
900121507 1:1050365-1050387 CCCCACAGGAGAGACGGAGGTGG - Intronic
900421720 1:2558652-2558674 AGTGAGAGGTGAGACAGAGGTGG - Intronic
900538386 1:3190435-3190457 ACACACAGGAGGGAGAGAGGAGG - Intronic
900997530 1:6130487-6130509 GCACTCAGGGGAGCCAGAGGAGG + Intronic
902291448 1:15438192-15438214 ACACACACGTCAAACAGAGTGGG + Intergenic
903366568 1:22809003-22809025 ACAGACAGCTGAGTCAGAGCTGG + Intronic
904330403 1:29754734-29754756 AAAGACAGGTGAGACCCAGGTGG + Intergenic
904670770 1:32163306-32163328 AGACCCAGGTAAGAAAGAGGAGG + Exonic
904808921 1:33150847-33150869 ACACTCAGGTGTGACAGTGGAGG + Intronic
905247730 1:36626576-36626598 ACACACAGCTGGTACATAGGTGG - Intergenic
905319326 1:37104784-37104806 ACACACAGGTGTGCAACAGGAGG - Intergenic
905668271 1:39775347-39775369 ACTCAGAGATGAGACAGAGGAGG + Intronic
905772294 1:40646094-40646116 ACACCCAGATGAGACAGCCGAGG - Intronic
905966818 1:42105224-42105246 ACACAAAGGGGAGAGAGTGGGGG - Intergenic
906282013 1:44560932-44560954 ACACAAGGGTGGGACAGAGTTGG - Intronic
907789758 1:57650840-57650862 ACAAACAGGGGAGGCAGAGATGG - Intronic
908318620 1:62959589-62959611 ACACACAGGAGAGTGAAAGGGGG + Intergenic
909039366 1:70630707-70630729 ACACACAGGTCCGACATATGTGG - Intergenic
909715634 1:78702951-78702973 AAACACAGGTGAAGCAGATGTGG - Intergenic
911044115 1:93614751-93614773 ACAAACAGTTGAGTCAGAAGTGG - Intronic
911285987 1:95993043-95993065 AAATACATGTGAGAAAGAGGGGG + Intergenic
911505944 1:98751473-98751495 ACAGGAAGGTGAGCCAGAGGTGG - Intronic
912498754 1:110107930-110107952 ACACTCCCGTTAGACAGAGGAGG + Intergenic
913527216 1:119705112-119705134 ACAGACAGGTGAGAGAGACATGG + Intronic
917099737 1:171432921-171432943 TCCCACAGGAGAAACAGAGGAGG + Intergenic
918224897 1:182472375-182472397 ACCTACGGGTGAGACAGAAGAGG - Exonic
918229684 1:182516171-182516193 ACCCACAGGAAAGAGAGAGGTGG + Intronic
918702785 1:187626381-187626403 ACACACAGCTGACAAAGAGAAGG + Intergenic
919159094 1:193805524-193805546 ACACACACGTGAAACACAGTTGG + Intergenic
920099716 1:203509272-203509294 ACACACAGTTCAGACACAGGAGG + Intergenic
920298440 1:204974101-204974123 ATGCAGAGGTGAGACCGAGGGGG + Intronic
920371117 1:205479953-205479975 ACAAACGTGTGAGACAGAGAGGG + Intergenic
920581041 1:207107908-207107930 GCAAGGAGGTGAGACAGAGGAGG + Intronic
921548093 1:216497701-216497723 ACAGAAAGGAGAGACAGAGTAGG + Intergenic
922776428 1:228216189-228216211 AGAAGCAGGGGAGACAGAGGTGG - Intronic
922824909 1:228511199-228511221 AAAGACAGGAGAGACAGAGATGG - Intergenic
924685124 1:246281180-246281202 CCACACAGGTGAGAAGGAAGTGG + Intronic
924953015 1:248902802-248902824 ACACACAGATGGGGCAGTGGGGG + Intergenic
1063205001 10:3822408-3822430 ACACAGAGAGGAGACAGAGGTGG - Intergenic
1064771031 10:18722985-18723007 ACACACAGGTGGGACAAGGTGGG + Intergenic
1065450501 10:25851665-25851687 ACAGACAGGTGAGAGACAAGTGG + Intergenic
1065756199 10:28933782-28933804 ACACACAGGTGTGGTAGAGCAGG + Intergenic
1065846653 10:29749353-29749375 AAATACAGTTGAGAGAGAGGAGG + Intergenic
1067238766 10:44472995-44473017 CCACACAGGTGCGCCAGAGTGGG - Intergenic
1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG + Exonic
1070098441 10:73361403-73361425 ACACACACGGGAGGCTGAGGTGG - Intergenic
1070919821 10:80177519-80177541 AAACAAAGCTGAGAGAGAGGGGG - Intronic
1071164328 10:82786876-82786898 ACAAACATGAGAGACAGAGGAGG - Intronic
1072519875 10:96221933-96221955 ATTCACAGCTGAGAGAGAGGGGG + Intronic
1072565800 10:96615724-96615746 TCATACAGGTGAGAAAGAAGAGG + Intronic
1072631159 10:97147566-97147588 AGACCCAGGTGAGGCAGAGGTGG + Intronic
1073218635 10:101851488-101851510 ACACACAGCTCTGACAGAAGGGG + Intronic
1073488182 10:103835053-103835075 GCACACAGGTGGGGCAGAGGTGG + Intronic
1075330098 10:121567652-121567674 ACACACAGCAGTGGCAGAGGAGG + Intronic
1076559080 10:131349442-131349464 ACACACAGGTGACACACAGGTGG - Intergenic
1076559086 10:131349512-131349534 GCACACAGGTGACACACAAGTGG - Intergenic
1076821275 10:132941158-132941180 ATACACAGGTGACACACAGGGGG - Intronic
1076921743 10:133457904-133457926 ACACACAGTTGAGGCAGGGCTGG - Intergenic
1077144349 11:1037931-1037953 GGGCACAGGTGGGACAGAGGTGG - Intergenic
1077715664 11:4577603-4577625 GCACACAGTTGAGATAAAGGTGG - Intronic
1077921452 11:6644947-6644969 TCACACAGATGGGAGAGAGGAGG - Intronic
1077952098 11:6970734-6970756 TGACACAGGTGAGATAGAGAGGG - Intronic
1078335794 11:10462317-10462339 CCAAACAGGGGAGAGAGAGGCGG + Intronic
1078596061 11:12687854-12687876 ACTCACCGTTGAGAGAGAGGGGG + Intronic
1078838776 11:15057895-15057917 ACAGGAAAGTGAGACAGAGGAGG - Intronic
1079601508 11:22316647-22316669 AGGCACAGGGGAGAGAGAGGCGG - Intergenic
1080606229 11:33867132-33867154 ACTCACAGGGGAGGCAGTGGGGG + Intronic
1080928406 11:36782635-36782657 TCAGAGAGGTGAGACAGAAGAGG + Intergenic
1083716711 11:64581632-64581654 CCACACATGTGAAGCAGAGGTGG + Intergenic
1084302490 11:68260705-68260727 ACACACAGGTTACACACAGTAGG + Intergenic
1084462589 11:69304149-69304171 ACACAGAGGTGGGGCAGACGAGG + Intronic
1084934117 11:72577991-72578013 ACAAGAATGTGAGACAGAGGAGG + Intronic
1084939282 11:72603723-72603745 ACACAAAGGCTAGAGAGAGGTGG + Intronic
1085108772 11:73868900-73868922 ACAGACACTGGAGACAGAGGTGG + Intergenic
1085391017 11:76182230-76182252 ACACACAGGTGAGGCCTGGGCGG + Intergenic
1085921208 11:80959444-80959466 ACAAACAGGAGAGATAGAGCAGG - Intergenic
1086460346 11:86999536-86999558 ACACACAGATGAGACTGACCAGG - Intergenic
1087678580 11:101191418-101191440 ACACACTGATGGTACAGAGGTGG + Intergenic
1087679144 11:101199856-101199878 GCACACAGGTGAGCCAGTGCAGG - Intergenic
1088096436 11:106106098-106106120 TCACCCAGGTGAGGCAGTGGTGG - Intergenic
1089169686 11:116503316-116503338 ACACCCAGGACACACAGAGGAGG - Intergenic
1089272312 11:117310154-117310176 GCACTCAGGTGAGGCCGAGGCGG - Intronic
1089643107 11:119860543-119860565 ACACAAAGGTGGGACACAGGTGG - Intergenic
1089668014 11:120032575-120032597 ACACACAGGTGGGACACAAAGGG - Intergenic
1090872488 11:130760786-130760808 ACTCAAAGGTGAGAAAGGGGAGG - Intergenic
1090879818 11:130823695-130823717 ACTCAAAGGTGAGACTGAGTGGG + Intergenic
1091096128 11:132823811-132823833 ACACACAGGTTAACCATAGGAGG - Intronic
1092891545 12:12973903-12973925 ACACACAGGTGAGGAAGCTGAGG - Intergenic
1093905997 12:24692412-24692434 ACATTCAGGTGAGAGAGTGGAGG - Intergenic
1094509051 12:31085119-31085141 GCGAGCAGGTGAGACAGAGGCGG + Exonic
1094762075 12:33545467-33545489 ACACACAGGATAGTCAGATGTGG + Intergenic
1096242239 12:49965686-49965708 ACTCTGAGGAGAGACAGAGGTGG - Intergenic
1096332305 12:50724636-50724658 GAACACATGTGAGACAGACGAGG - Intronic
1098086795 12:66854204-66854226 ACACACAGGCGAGGGTGAGGAGG + Intergenic
1098128093 12:67320860-67320882 ACACACACATGAGACAGGGCAGG + Intergenic
1100108243 12:91204844-91204866 ACACAAAGGAGAGCCAAAGGTGG + Intergenic
1100367303 12:93933560-93933582 AGACACAGCTGAAAGAGAGGGGG - Intergenic
1101268787 12:103120502-103120524 AGGCAGAGGTGAGAAAGAGGAGG + Intergenic
1101993807 12:109510310-109510332 ACAAACAGGAAAGTCAGAGGAGG - Intronic
1101995725 12:109523686-109523708 ACTGACAGGTGAGACAGCTGAGG + Intronic
1102380660 12:112463737-112463759 CCACAGAGGTCAGACTGAGGTGG + Intronic
1102548597 12:113674551-113674573 ACAGAGAGGAGAGACAGAGAGGG - Intergenic
1104074043 12:125373723-125373745 AAACACAGGTTAGAAAGGGGAGG - Intronic
1104279931 12:127367296-127367318 ACACAGAGGGAAGATAGAGGAGG - Intergenic
1104762245 12:131304440-131304462 ATCCACAGGTGAGGCAGATGTGG + Intergenic
1104817531 12:131656356-131656378 ATCCACAGGTGAGGCAGATGTGG - Intergenic
1104920029 12:132285896-132285918 AGAGACAGGAGAGACAGAGGAGG + Intronic
1104920033 12:132285919-132285941 AGAGACAGGGAAGACAGAGGAGG + Intronic
1105303522 13:19154422-19154444 CCACACAGGTGGGACAGGGCAGG + Intergenic
1105892532 13:24691754-24691776 CCCCACAGGAGAGACTGAGGAGG - Intronic
1106075822 13:26460028-26460050 ACAAAGAGGACAGACAGAGGAGG - Intergenic
1106571710 13:30933720-30933742 GCAAACAGGAGAGACAGAGGAGG + Intronic
1106616795 13:31337935-31337957 ACACACAGGCCTGTCAGAGGTGG + Intergenic
1106728869 13:32517853-32517875 CTCCACAGGGGAGACAGAGGTGG - Exonic
1107064642 13:36199969-36199991 CCTCACAGGTGAAAAAGAGGTGG + Intronic
1108207283 13:48103116-48103138 ACACAGAGGAGAGACACAGAAGG + Intergenic
1108798827 13:54067596-54067618 ACACACAGGTGAGCGAGTGCAGG - Intergenic
1109877521 13:68425951-68425973 ACACACAAGAGATACAGGGGTGG - Intergenic
1111536688 13:89611163-89611185 ACACCCAGTTGTCACAGAGGAGG - Intergenic
1111804473 13:93022411-93022433 TCACACAGGTTACACAGAAGAGG - Intergenic
1112247837 13:97750553-97750575 ACAGAGAGGGGAGAAAGAGGAGG - Intergenic
1112413176 13:99180981-99181003 ACAGACAGGTGAGACACAAAGGG + Intergenic
1112592208 13:100774120-100774142 ACAGACAGGTGAGACACAAAAGG + Intergenic
1113092870 13:106633308-106633330 ACAGACAGGTCAGACAGTAGGGG + Intergenic
1113707412 13:112443718-112443740 ACACACACATCACACAGAGGGGG + Intergenic
1114347566 14:21812376-21812398 AGACACAGCTGTGACAGATGAGG + Intergenic
1115119705 14:29926354-29926376 ATACAGACGTGAGGCAGAGGGGG - Intronic
1115464408 14:33699039-33699061 ACACATAGGAAACACAGAGGTGG + Intronic
1115624229 14:35173885-35173907 CCACACCGATGAGACTGAGGGGG - Intronic
1116397459 14:44463562-44463584 AAACACAGATGAGACAGCTGGGG - Intergenic
1116463243 14:45202166-45202188 ACACACAGCTGAGTCTGAGCAGG - Intergenic
1117202927 14:53411094-53411116 ACACACAGGAGAGATAAGGGAGG - Intergenic
1117744909 14:58860050-58860072 ACACAAATGTGAGACACAGAGGG - Intergenic
1119727232 14:76928862-76928884 ACAAAGAGGGGAGACACAGGAGG + Intergenic
1120080996 14:80216146-80216168 ACCTACTGGTAAGACAGAGGGGG + Intronic
1120950259 14:90034497-90034519 ACACGCAGGCCAGACATAGGTGG - Intronic
1120955625 14:90079504-90079526 GCACACAGGTGAGACCTGGGTGG - Intronic
1121173959 14:91876586-91876608 ACACACAGAGGAGGAAGAGGAGG + Intronic
1121718863 14:96095609-96095631 ACAAAGGGGTGAGCCAGAGGAGG - Intergenic
1121735130 14:96213119-96213141 TCACACAGGTGAGAAAGGAGAGG - Intronic
1122008603 14:98727153-98727175 ACACACACCTGAGGCAGAGAGGG - Intergenic
1122048948 14:99042290-99042312 ACACAGAGCTGAAACGGAGGAGG - Intergenic
1122443963 14:101755697-101755719 AGCCACTGGTGAGAGAGAGGAGG + Intergenic
1122464654 14:101923025-101923047 AGACACAAGTCAGAGAGAGGTGG - Intronic
1122537115 14:102473151-102473173 AGCCACAGGAGAGGCAGAGGCGG - Intronic
1126750806 15:51875117-51875139 TCAGAAAGGTGAGAAAGAGGAGG - Intronic
1126957385 15:53948802-53948824 GCACACAGCTGACACAGAGTAGG + Intergenic
1127548334 15:60011073-60011095 ACAGACAGGAGAGACAGAACAGG - Intronic
1129243935 15:74268541-74268563 ACCCTCAGGTCAGCCAGAGGGGG - Intronic
1129462417 15:75706230-75706252 ACTCTCTGGGGAGACAGAGGGGG - Intronic
1129709147 15:77811427-77811449 AGACACAGGAGAGGCAGGGGAGG - Intronic
1129897846 15:79121868-79121890 ACACAAAGGTGAGGCTGGGGCGG - Intergenic
1130076833 15:80696260-80696282 ACACACAGGCGAGCCAAAGCAGG - Intronic
1130913552 15:88287674-88287696 AGGCACAGGTGAGAAAGAGTGGG + Intergenic
1132002963 15:98198342-98198364 ACACACAAGGGAGACACATGAGG - Intergenic
1132784919 16:1651473-1651495 ACACACAGGTCATCTAGAGGTGG + Intronic
1132784923 16:1651505-1651527 ACACACAGGTCATCTAGAGGTGG + Intronic
1132784960 16:1651739-1651761 ACACAGAGGTCATAGAGAGGTGG + Intronic
1132784964 16:1651769-1651791 TCACACAGGTCACAGAGAGGTGG + Intronic
1133027585 16:2995430-2995452 TCAGCCAGGTGAGACAGATGGGG + Intergenic
1133285223 16:4687603-4687625 ACACACGGGGGAGAGAGAGAAGG + Intronic
1133394527 16:5435580-5435602 AGACACAGGTGGGACCCAGGAGG + Intergenic
1133606263 16:7391191-7391213 ACACCAAGGTGGGACGGAGGTGG - Intronic
1134248349 16:12556645-12556667 AGACACAGCAGAGACAGAAGTGG + Intronic
1135065233 16:19304148-19304170 ACAGACAGGTGAGAAAGCAGTGG + Exonic
1135085482 16:19471624-19471646 ATCCACAGGTGAGAGAGAGGGGG - Intronic
1135689401 16:24523956-24523978 AGACACAGGTGAGGCAGACAAGG + Intergenic
1137038519 16:35588592-35588614 TCACTCAGGTGAGAAAGATGGGG - Intergenic
1137610636 16:49814966-49814988 ACACACGTGTGGGAAAGAGGAGG - Intronic
1137704510 16:50525211-50525233 ACAAAGAGGTGAGACAGAGATGG + Intergenic
1139239146 16:65372664-65372686 TCACACAGTTGGGACAGAGGAGG + Intergenic
1139348808 16:66322611-66322633 ACCCACAGGAGAGCCACAGGAGG + Intergenic
1139428250 16:66896307-66896329 ACTCAGAGGAGAGTCAGAGGAGG - Intergenic
1139782762 16:69365431-69365453 ACACAGAGCAGAGGCAGAGGTGG + Intronic
1140813667 16:78601362-78601384 AGAAACGGGTAAGACAGAGGAGG + Intronic
1141162388 16:81638150-81638172 ATACAAAGGAGAGACAGAGGAGG - Intronic
1142283663 16:89162002-89162024 ACACCCATGTGTCACAGAGGAGG + Intergenic
1142962353 17:3558737-3558759 AGACACAGCTGGGACAGAGCAGG + Intergenic
1143157900 17:4850368-4850390 AGACGCAGGTGAGACAGAAGGGG - Intronic
1143383468 17:6510548-6510570 ACACACAGATGACTCAGAAGTGG - Intronic
1143966130 17:10757549-10757571 GCACAGGGGTGACACAGAGGAGG + Intergenic
1144150556 17:12439313-12439335 ACACACAGGTGGTAAAGAGAGGG - Intergenic
1146619962 17:34389507-34389529 ACAGGAAGGTGTGACAGAGGAGG + Intergenic
1146704537 17:34991371-34991393 AGCCCCAGGAGAGACAGAGGGGG - Intronic
1147766731 17:42841879-42841901 AGACACAGGAGGGAGAGAGGGGG - Exonic
1147945622 17:44078582-44078604 CCAAGCAGGTGAGACCGAGGAGG - Exonic
1148123171 17:45224022-45224044 ACCCACAGGTGGGTCAGAGAGGG + Intronic
1150656436 17:67042761-67042783 ACCCACAGGGAACACAGAGGTGG + Intergenic
1150913789 17:69415256-69415278 ACAGTCAGGAGAGACAGAGCAGG + Intronic
1151782415 17:76256152-76256174 ACTCACAGCTGGGAGAGAGGAGG - Intergenic
1152623195 17:81376166-81376188 ACACACACCTGAGACGGAGAAGG + Intergenic
1154218088 18:12430076-12430098 ACACACACGGGGGACAGATGGGG - Intronic
1155698773 18:28716991-28717013 GCACACAGATGAAACAGAGAAGG - Intergenic
1155939642 18:31790694-31790716 ACACACAGGTCTAACAGAGATGG + Intergenic
1157741575 18:50097849-50097871 ACACCCTGGTGAAACTGAGGAGG + Intronic
1160348594 18:78154637-78154659 ACCCAGAGGTGAGAGAGAGCAGG - Intergenic
1160409683 18:78667265-78667287 ACACACAGGAGAGGATGAGGAGG + Intergenic
1160481281 18:79241990-79242012 ACACACAGGTGGGCCCAAGGAGG - Intronic
1161353820 19:3808394-3808416 ACACACATGTGAGAGGGTGGCGG - Intronic
1161657305 19:5524195-5524217 ACACAGAGGTGAGAGAGAAGAGG - Intergenic
1162320164 19:9966839-9966861 AGACACAAATGAGAAAGAGGAGG + Intronic
1163650264 19:18513477-18513499 ACACCCAGGCGAGACAGAGGAGG + Intronic
1165895787 19:39140112-39140134 AGACAGAGGTGAAACAGAGAAGG - Intronic
1166301869 19:41915617-41915639 AGAGACAGATGAGACAGAGATGG - Intronic
1166349145 19:42186423-42186445 GCACACAGGTGAGGAAGAGTAGG + Intronic
1166574666 19:43826518-43826540 ACACACAGGAGAGAGAGAGAGGG + Intronic
1166880881 19:45929324-45929346 GGACAGAGGGGAGACAGAGGTGG + Intergenic
1167300542 19:48675009-48675031 TCACACAGCTAGGACAGAGGTGG - Intergenic
1167721384 19:51182659-51182681 ACGGGCAGGGGAGACAGAGGCGG - Intergenic
1167763592 19:51464111-51464133 ACGGGCAGGGGAGACAGAGGCGG + Intergenic
925025734 2:605910-605932 ACACACAGGTGAGCAAGTGGAGG - Intergenic
925064850 2:921935-921957 AGACAGAGGGAAGACAGAGGAGG - Intergenic
925588440 2:5486667-5486689 ACACAGAGAAGAGACAGAGCAGG + Intergenic
926748827 2:16182004-16182026 ACACACTGGGGAGGCAGAGTGGG + Intergenic
928091616 2:28378071-28378093 ACACACAGGTGTGCCAGGGCTGG + Intergenic
928873461 2:36009590-36009612 ATATACAGGTGAGACAGAACAGG + Intergenic
929845005 2:45515684-45515706 ACAATCAGGTGAGAAAGAGGAGG - Intronic
931705003 2:64939897-64939919 AAACACAGGAGGGAAAGAGGAGG - Intergenic
932180432 2:69642101-69642123 ACACACAGATGAAACACAGAGGG + Intronic
932631945 2:73352271-73352293 ATAGACAGGTGATCCAGAGGTGG + Intergenic
934553800 2:95277152-95277174 AGTCACAGGTGGGGCAGAGGTGG - Intronic
934680036 2:96277066-96277088 ATCCGCAGGTGAGCCAGAGGTGG - Exonic
935211012 2:100939302-100939324 ACACAAAGGGGAGACAGATTAGG - Intronic
937258285 2:120569744-120569766 ACACACAGGTGAGAGAGAGAAGG - Intergenic
937275274 2:120680033-120680055 ACACGCAGGTGTGCCAGAGGGGG - Intergenic
937924326 2:127156158-127156180 ACACCCAGGAGAGACACTGGGGG + Intergenic
939223840 2:139339797-139339819 AGAAAGAGGAGAGACAGAGGAGG + Intergenic
940584800 2:155633319-155633341 CTACACAGGTAAGACACAGGGGG + Intergenic
941771842 2:169353352-169353374 ACACAAAGGTGAAACTTAGGGGG + Intronic
941858530 2:170254529-170254551 ACACGCAGGTAGGACAGTGGTGG - Intronic
943522888 2:188975919-188975941 ACAGGCAGGGAAGACAGAGGAGG - Intronic
943789154 2:191912195-191912217 ACAGAGAGGAAAGACAGAGGGGG - Intergenic
944978109 2:205080979-205081001 ACACAGTGATGAGAGAGAGGAGG - Intronic
945060492 2:205904557-205904579 ACATACATCTGAGACAGAGAAGG - Intergenic
945154000 2:206818104-206818126 ACACATAGATGAGAAAGAAGAGG - Intergenic
945647829 2:212522559-212522581 ACGCAGAGGTAAGACAGGGGAGG + Intronic
945720027 2:213407644-213407666 ACAGACAGGAGAGAGAGAGGGGG + Intronic
946831219 2:223729913-223729935 AGACATATGTGAGCCAGAGGAGG - Intergenic
947319013 2:228896255-228896277 ACAAAGAGGTGACACAGAGCGGG - Intronic
948258015 2:236582743-236582765 GCACACAGGTGGTACAGATGAGG - Intergenic
948550442 2:238768670-238768692 AGACACAGGAGATGCAGAGGGGG - Intergenic
1168779899 20:480001-480023 ACACACAGGTAATACAGCAGGGG + Intronic
1169434601 20:5574623-5574645 AGACACTGGGGAGACTGAGGTGG + Intronic
1172056761 20:32159542-32159564 TCACACAGATGAAACAGAGGGGG - Intronic
1172229626 20:33328075-33328097 GCCCACAGGTAAGGCAGAGGAGG + Intergenic
1172881706 20:38204218-38204240 ACACACAGAGAAGCCAGAGGAGG - Intergenic
1172949603 20:38714428-38714450 ACAGGCAGGTGAGACACAGGAGG - Intergenic
1173059346 20:39646779-39646801 ACTCACAGTCGAGACAGAGGAGG - Intergenic
1173944875 20:46942635-46942657 TCACACAGGAGAGTCAGAGAAGG - Intronic
1175911673 20:62408016-62408038 GCAGGCAGGTGACACAGAGGTGG - Intergenic
1176719034 21:10378658-10378680 AGAGACAGGGGAGAGAGAGGGGG - Intergenic
1176719116 21:10379082-10379104 ACAGAGAGGGGAGAGAGAGGGGG - Intergenic
1176735245 21:10540263-10540285 ACACACAAGAGAGACTGAGTAGG + Intronic
1178150231 21:29785967-29785989 ACACAGAGGAGAGACACAGAGGG - Intronic
1178565242 21:33677876-33677898 ACCCACATGAGAGACAGTGGTGG - Intronic
1179666512 21:42916551-42916573 ACAGAAAGGTGAGACACTGGAGG - Intergenic
1180300266 22:11031640-11031662 AGAGACAGGGGAGAGAGAGGGGG - Intergenic
1181712011 22:24696791-24696813 ACACAGAGATGTGACGGAGGAGG + Intergenic
1181832324 22:25570721-25570743 AGACACAGGAGAAGCAGAGGGGG - Intronic
1182427607 22:30283204-30283226 ACACACAGATGAGAAAGTGGGGG - Intergenic
1182571775 22:31244514-31244536 ACACACAAGGGCCACAGAGGAGG - Intronic
1184242575 22:43218942-43218964 GCACAGAGGTCAGAGAGAGGAGG - Intronic
1184490245 22:44804167-44804189 ATACACAGGTGAGGAACAGGTGG - Intronic
1184836784 22:47028603-47028625 ACAGGCAGGCGAGACAGAAGAGG - Intronic
1184898122 22:47424195-47424217 GCACAGAGGAGGGACAGAGGGGG + Intergenic
952162216 3:30705431-30705453 TCACACAACTGAGACAGAGCAGG + Intergenic
952874429 3:37931453-37931475 ACACAGAGAAGACACAGAGGGGG - Intronic
953125817 3:40090889-40090911 ACATGCAGGTGGAACAGAGGGGG + Intronic
954063083 3:48085521-48085543 AAAAACAAGTGAGACAGAGTAGG + Intronic
954608616 3:51932604-51932626 AGACACAGGTCAGTCTGAGGGGG + Intergenic
955178405 3:56640964-56640986 ACCCAAAGGTGAGGCAGATGAGG - Intronic
955964560 3:64374936-64374958 CCACACAGGTAAGATAGAGCTGG + Intronic
956837138 3:73104521-73104543 ACACACAGCAGAAACAGAGGAGG - Intergenic
958468174 3:94484065-94484087 ACAGAAAGGTTAGACAGTGGTGG + Intergenic
961377701 3:126477203-126477225 GCAAACAGATCAGACAGAGGTGG - Intergenic
961814277 3:129540782-129540804 ACACACAGAGGAGACAAAAGGGG + Intergenic
962796665 3:138855564-138855586 ACACAGAGGTAAGAAAGAGTCGG + Intergenic
962952560 3:140232846-140232868 TGACACAGGTCAGAGAGAGGGGG - Intronic
962956226 3:140269534-140269556 ACACAAATGTGGGACAGAGAGGG + Intronic
967506168 3:190255235-190255257 ACACAGAGCTGACACACAGGAGG - Intergenic
967630877 3:191741999-191742021 ACAGACAGCTGAGATAAAGGTGG - Intergenic
969232792 4:5843228-5843250 ACCCCCTGGTTAGACAGAGGGGG + Intronic
969899511 4:10336090-10336112 GCACACTGGGCAGACAGAGGTGG - Intergenic
971661581 4:29424021-29424043 AGATACCGGAGAGACAGAGGAGG - Intergenic
973057342 4:45677949-45677971 TCACACAGGTGGAATAGAGGGGG - Intergenic
973733818 4:53850384-53850406 GCACACACGTGAGAGAGAGGTGG + Intronic
975251745 4:72187802-72187824 ACACACATATGAGAGAGAGAGGG - Intergenic
978104487 4:104884738-104884760 TTAGTCAGGTGAGACAGAGGTGG - Intergenic
978736055 4:112085896-112085918 GCACTCAGGTGAGAAAGATGGGG - Intergenic
980236127 4:130109081-130109103 ACAGCCATGTGAGACAGAGGTGG - Intergenic
983778802 4:171642645-171642667 GCAAACAGCTGAGACAAAGGTGG + Intergenic
985126772 4:186702117-186702139 CCACACAGGTGACACAGGGATGG + Intronic
985671797 5:1210600-1210622 CCTCACAGGTGAGACGGATGGGG - Intronic
986147682 5:5094615-5094637 ACACACATGAGAGAAAGAGAAGG + Intergenic
986937518 5:12908016-12908038 AAGCACAAGTGAGTCAGAGGGGG - Intergenic
989163166 5:38410732-38410754 GCAGTGAGGTGAGACAGAGGAGG - Intronic
989449710 5:41572480-41572502 ACAGAAAGGTGAGACTGAAGAGG - Intergenic
990657914 5:57978139-57978161 ACCAACAGCTGAGACAGAAGAGG - Intergenic
991146059 5:63305853-63305875 ACACACACATGAGAGAGAGAAGG - Intergenic
991422211 5:66453203-66453225 ACACACTGCTCAGAGAGAGGAGG - Intergenic
992432532 5:76723089-76723111 ACACACAGGAGAGAGATAGCAGG - Intronic
992799508 5:80282802-80282824 ACACACAGGTAAGAGGGAAGTGG - Intergenic
993655174 5:90569084-90569106 ACAAGCATGTGAGACAGAGAGGG + Intronic
993795966 5:92268152-92268174 ACACACTGGTGGGGCAGAGAAGG - Intergenic
993833500 5:92788531-92788553 AGAGACAGGAGAAACAGAGGGGG + Intergenic
996364028 5:122680785-122680807 GCTCAGAGGTGAGAAAGAGGGGG - Intergenic
996466305 5:123806479-123806501 AAAGACAGATGAGACAGAAGCGG + Intergenic
996591184 5:125149450-125149472 CCACAAAGGAGAGACAGAGCTGG - Intergenic
998418555 5:141963039-141963061 ACACACATGTCAGGGAGAGGTGG - Intronic
998876467 5:146605246-146605268 CCACACAGATGAGAGAGAGTAGG - Intronic
999640075 5:153663507-153663529 ACTCATAGGTGAGACAGCTGAGG - Intronic
1001257300 5:170193614-170193636 CCACACAGCTGAGTCAAAGGTGG + Intergenic
1001742487 5:174065385-174065407 AGACACAGATGAGGCAGAAGTGG + Intronic
1003054453 6:2805790-2805812 ACACACAGATGAGAGAGAGCTGG - Intergenic
1003336413 6:5177143-5177165 ACACACGGGGAAGACACAGGAGG - Intronic
1003719083 6:8680331-8680353 AAAGACATGTGAGACAGAGGAGG - Intergenic
1004066356 6:12248421-12248443 ACCCAGAAATGAGACAGAGGAGG - Intergenic
1004239964 6:13912170-13912192 ACACAATGGTGACACAGAAGAGG - Intergenic
1004917000 6:20341481-20341503 ACACACAGGTGAGGGTGAGATGG + Intergenic
1005864878 6:29929653-29929675 ACATAAAGTTGAGACAGAGATGG - Intergenic
1006135319 6:31892392-31892414 ACAGCAAGGTGAGACAGAGCTGG - Exonic
1007730561 6:43942902-43942924 GGACACAGGTGAGAAAGAGCTGG + Intergenic
1010590101 6:77702185-77702207 ACAAAGAGGTGAAACAGAGGCGG - Intronic
1010865376 6:80970176-80970198 GCACACAGCTGAGACACAGATGG - Intergenic
1010865992 6:80977333-80977355 GCAGAGAGGTGAGACAGAGGAGG + Intergenic
1010881324 6:81177379-81177401 ACACACATGTGAGAGAGAAAGGG - Intergenic
1011530320 6:88313988-88314010 ACACACAGGTCTCAGAGAGGAGG + Intergenic
1012279532 6:97312396-97312418 ACACCCAGGTGGAACAGAGTAGG - Intergenic
1012856021 6:104502705-104502727 ACACACAGGTGAATAAGATGTGG - Intergenic
1016789319 6:148051445-148051467 ACACACAGGTGAGGAATAGGAGG + Intergenic
1017929238 6:158938219-158938241 ACAGGCAAGTCAGACAGAGGAGG + Intergenic
1018273322 6:162103840-162103862 ACATACAGGTGAGGAAGAGGAGG - Intronic
1018278306 6:162156823-162156845 GCACACAGGTGGAACAGAGATGG + Intronic
1018347812 6:162921201-162921223 AGACCCAGGAGAGACAGAGTGGG + Intronic
1018395998 6:163378476-163378498 ACACAAAGGAGAGACAGAAGAGG + Intergenic
1018712169 6:166505148-166505170 ACCCACAGGTGGTACAGAGTTGG + Intronic
1019889249 7:3932867-3932889 ACACACAGGTGAGACAGAGGTGG - Intronic
1021939763 7:25668146-25668168 TCACAGAGGTGCGACAGAAGCGG - Intergenic
1022510363 7:30931555-30931577 AGACACAGATGGGAGAGAGGGGG - Intergenic
1023834058 7:44058273-44058295 CCCCAGAGGTGAGCCAGAGGTGG + Exonic
1024142940 7:46480585-46480607 ACACACATGTGGGGCAGATGTGG - Intergenic
1024595717 7:50935232-50935254 AAAAACAGGGAAGACAGAGGAGG - Intergenic
1026738011 7:72961041-72961063 AGACACAGGTGGCACAGGGGCGG + Intronic
1026789048 7:73319836-73319858 AGACACAGGTGGCACAGGGGCGG + Intronic
1026791483 7:73335379-73335401 ACACACGGGGCAGAAAGAGGAGG - Intronic
1026927784 7:74205895-74205917 ACCTACAGGCGAGGCAGAGGTGG + Intronic
1027105723 7:75404027-75404049 AGACACAGGTGGCACAGGGGCGG - Intronic
1027167227 7:75843527-75843549 ACAGACAGGTTAGGAAGAGGAGG + Intronic
1029062017 7:97808163-97808185 ACACACAAATGAGAAAGAGATGG + Intergenic
1031789253 7:126079404-126079426 ACCCAGAGGTGAGGCAGAAGAGG + Intergenic
1032859977 7:135867643-135867665 GAAGACAGCTGAGACAGAGGCGG + Intergenic
1034200565 7:149280945-149280967 ACTCACTGGTGACAGAGAGGAGG - Intronic
1036217470 8:6892626-6892648 ACACACGGATGAGACAGAGATGG + Intergenic
1036258555 8:7223167-7223189 AGAGACAGGGGAGACTGAGGAGG + Intergenic
1036310610 8:7681763-7681785 AGAGACAGGGGAGACTGAGGAGG + Intergenic
1036593737 8:10193364-10193386 AAACACAGGGGAGACAGAGGAGG - Intronic
1037587618 8:20288770-20288792 AGACGCAGGGGAGGCAGAGGAGG - Intronic
1038203717 8:25442968-25442990 ACACAGATGTAAGACAGAAGAGG + Intronic
1039945483 8:42125138-42125160 GCTCAAAGATGAGACAGAGGGGG + Intergenic
1040349805 8:46553145-46553167 ACACACAAATGAGAAAGAGATGG + Intergenic
1044139787 8:88636313-88636335 ACACACAGGAGAGACACCAGGGG + Intergenic
1044421792 8:92005101-92005123 CCAGACAGGTGAGAGGGAGGAGG - Exonic
1044735560 8:95274805-95274827 ACAAACAGATGAGTCTGAGGAGG + Intergenic
1045832905 8:106485941-106485963 ACCAACAGCTGGGACAGAGGGGG + Intronic
1045908777 8:107380854-107380876 AAACACAGGTAAGAGAGTGGTGG - Intronic
1046916823 8:119686994-119687016 ACACACACTTGTGATAGAGGAGG - Intergenic
1047047592 8:121072331-121072353 ACAAGAAGTTGAGACAGAGGTGG - Intergenic
1047682144 8:127265099-127265121 ACACTGAAGTGAGACAGATGGGG - Intergenic
1047962181 8:130018467-130018489 TCACACAGATTAGACAGCGGTGG + Intergenic
1048454505 8:134565751-134565773 ACACACAGATGAGACTGCAGGGG + Intronic
1048764960 8:137833754-137833776 AGACAAAGGTGAGACAGTCGTGG - Intergenic
1049206846 8:141367476-141367498 ACACCCACTGGAGACAGAGGGGG + Intergenic
1050468066 9:5952774-5952796 AAACACAGGTGTGACAGCAGTGG + Intronic
1051410948 9:16788846-16788868 AAAAACAGGTGGGAAAGAGGAGG - Intronic
1053505545 9:38640501-38640523 CCCTACAGGTGAGAAAGAGGAGG - Intergenic
1053785112 9:41647696-41647718 AGAAACAGGTGAGGCAGAGCAGG + Intergenic
1054173838 9:61861646-61861668 AGAAACAGGTGAGGCAGAGCAGG + Intergenic
1054448694 9:65390712-65390734 AGAAACAGGTGAGGCAGAGCAGG + Intergenic
1054663702 9:67719135-67719157 AGAAACAGGTGAGGCAGAGCAGG - Intergenic
1055759449 9:79591178-79591200 ATACACAGTTGTGACATAGGTGG + Intronic
1056094656 9:83240589-83240611 ACACAGATGAGAGACAGAGAAGG - Intergenic
1056557624 9:87703035-87703057 TCACACAGGTGAGTCATGGGAGG - Exonic
1056569026 9:87799667-87799689 TCACACAGGTGAGTCATGGGAGG + Intergenic
1056579993 9:87883528-87883550 ACACCCAGATCATACAGAGGAGG - Intronic
1057311457 9:93945801-93945823 GCAGAAAGGAGAGACAGAGGTGG - Intergenic
1057485477 9:95479644-95479666 ACACACTGGTCAGAGAGAGTTGG - Intronic
1057634261 9:96748345-96748367 ATATACAGGCAAGACAGAGGAGG + Intergenic
1057710614 9:97439546-97439568 ACATAGAGGTGACACAGAGTAGG - Intronic
1057804301 9:98209571-98209593 ACAGACAGGTGGGACAGCTGGGG + Intronic
1058640344 9:107077777-107077799 ACACACACGAGAGAGAGAGAGGG - Intergenic
1061559342 9:131393142-131393164 ATTCACAGGTGAGACAAAGGAGG - Intergenic
1061617215 9:131788129-131788151 ACACACACCTGAGTCGGAGGAGG + Intergenic
1185604802 X:1362282-1362304 ACAGAGAGGGGAGACAGAGAGGG - Intronic
1185720020 X:2373887-2373909 GCACACAGGTGAGAGAGTGGGGG + Intronic
1186441605 X:9591734-9591756 ACACACACATGATAAAGAGGAGG + Intronic
1187250690 X:17595325-17595347 AATCTCAGCTGAGACAGAGGAGG - Intronic
1187622005 X:21066908-21066930 ACACACATATGAGAGAGAGAGGG - Intergenic
1188886092 X:35551456-35551478 ACACAAAGGAGAGAAGGAGGAGG + Intergenic
1189392082 X:40584760-40584782 ATACACAAGTTAGACAGATGTGG - Intronic
1189848560 X:45157891-45157913 ACGCGCAGGTGGGAGAGAGGCGG + Intronic
1190362325 X:49661085-49661107 TCAGAGAGGAGAGACAGAGGAGG - Intergenic
1193554106 X:82932393-82932415 ACACAGAGGGGAGACTGAGGGGG + Intergenic
1193893048 X:87075430-87075452 ACACAGAGGTGGAACAGAGTTGG + Intergenic
1194473065 X:94321243-94321265 ACTAACAGGAGAGACAGAGAGGG - Intergenic
1196761419 X:119204026-119204048 ACTGACAGATGAGATAGAGGAGG - Intergenic
1200143540 X:153913777-153913799 ACAGACCATTGAGACAGAGGAGG - Exonic