ID: 1019889254

View in Genome Browser
Species Human (GRCh38)
Location 7:3932882-3932904
Sequence CTGTGTGTTCAGATAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019889246_1019889254 9 Left 1019889246 7:3932850-3932872 CCAAAAGAAGCCAACACCCACCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889244_1019889254 11 Left 1019889244 7:3932848-3932870 CCCCAAAAGAAGCCAACACCCAC 0: 1
1: 0
2: 0
3: 30
4: 222
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889245_1019889254 10 Left 1019889245 7:3932849-3932871 CCCAAAAGAAGCCAACACCCACC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889243_1019889254 12 Left 1019889243 7:3932847-3932869 CCCCCAAAAGAAGCCAACACCCA 0: 1
1: 0
2: 1
3: 25
4: 317
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889249_1019889254 -8 Left 1019889249 7:3932867-3932889 CCACCTCTGTCTCACCTGTGTGT 0: 1
1: 0
2: 4
3: 41
4: 360
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889248_1019889254 -7 Left 1019889248 7:3932866-3932888 CCCACCTCTGTCTCACCTGTGTG 0: 1
1: 0
2: 0
3: 33
4: 338
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data
1019889247_1019889254 -1 Left 1019889247 7:3932860-3932882 CCAACACCCACCTCTGTCTCACC 0: 1
1: 0
2: 5
3: 51
4: 531
Right 1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019889254 Original CRISPR CTGTGTGTTCAGATAGGGTG TGG Intronic
No off target data available for this crispr