ID: 1019890268

View in Genome Browser
Species Human (GRCh38)
Location 7:3940890-3940912
Sequence GGCCACTCCATGAGAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019890268 Original CRISPR GGCCACTCCATGAGAGTGTG AGG (reversed) Intronic
900692121 1:3987283-3987305 GGCCACCATATGAGGGTGTGGGG + Intergenic
903929180 1:26852595-26852617 GGCCATTCAATGAGAATGTGGGG - Intronic
905825675 1:41024299-41024321 GCCGAATCCATGGGAGTGTGGGG - Intergenic
913239513 1:116817827-116817849 GGCCATCCCAAGAAAGTGTGGGG - Intergenic
915524763 1:156468746-156468768 GGAGACTGCATGTGAGTGTGTGG - Intronic
916653267 1:166850114-166850136 AGCCACTGAATGACAGTGTGCGG + Exonic
916993793 1:170273987-170274009 GGCCACTCCATTTGAGTATCTGG + Intergenic
922052410 1:222006213-222006235 GGCCACTGCATGGCAGTCTGGGG - Intergenic
922331791 1:224583403-224583425 GGCCACACTATGTGAGAGTGAGG + Intronic
922573000 1:226644789-226644811 GGCCTTTCCATGACAGGGTGAGG - Intronic
922773856 1:228206161-228206183 GGCCACTCCTGGAGGCTGTGGGG + Intronic
922797165 1:228345902-228345924 AGCCACACCATGAAAGCGTGTGG - Intronic
924146511 1:241081462-241081484 GGCCTCTCCATGGCAGTGTTTGG - Intronic
1062767857 10:79484-79506 GCCCACCCCATGAGAGGCTGAGG + Intergenic
1067107201 10:43374310-43374332 GGCCACACCCTGAGGCTGTGTGG + Intronic
1071497376 10:86178506-86178528 GGCCATTTCATGAGGGTGTTAGG + Intronic
1074091384 10:110261446-110261468 AACCCCTCCAAGAGAGTGTGAGG + Intronic
1075911446 10:126128617-126128639 GGCCTGTGCATGTGAGTGTGTGG + Intronic
1075960364 10:126562955-126562977 GCCCAGCCCATGAGAGTGGGTGG - Intronic
1076558380 10:131345062-131345084 GGCCCATGCATGAGAGGGTGAGG - Intergenic
1078689164 11:13561724-13561746 GGTCACTACATGGGAGAGTGAGG - Intergenic
1085453534 11:76653276-76653298 GGCAAATTCATGAGAGTGAGTGG + Intergenic
1089216599 11:116837906-116837928 TTCCCCTCCATGGGAGTGTGTGG + Exonic
1092650799 12:10632558-10632580 GGCTACTGCATGTGTGTGTGTGG + Intronic
1095747664 12:45677520-45677542 GTAAACTCCATGACAGTGTGTGG - Intergenic
1102112140 12:110372492-110372514 GGTCACACCAGGTGAGTGTGCGG - Intergenic
1103963642 12:124624686-124624708 GGGCACTGCATGAGTGTGAGTGG - Intergenic
1104567003 12:129894275-129894297 ATTCACTCCATGAGAGTGTATGG + Intronic
1106481955 13:30143434-30143456 GGCTACTCCAAGGGAGTGTCAGG + Intergenic
1106772157 13:32972062-32972084 GGGCACTGCATGAGGCTGTGAGG - Intergenic
1115309533 14:31965443-31965465 GACAACACCATGAGAGTCTGAGG - Intergenic
1116632869 14:47356519-47356541 GGCCACTCCATCTGAGTCTGGGG - Intronic
1118105994 14:62660230-62660252 GGGCACTGCACCAGAGTGTGGGG - Intergenic
1120093048 14:80356096-80356118 GGCCTATCCATGGGAGGGTGTGG + Intronic
1120707080 14:87756267-87756289 TGTCTCTGCATGAGAGTGTGCGG + Intergenic
1121907222 14:97757520-97757542 GGAGGCTCCATTAGAGTGTGGGG + Intronic
1123105156 14:105837840-105837862 GCCCAATCCATGAGAGTCTATGG - Intergenic
1123482141 15:20641872-20641894 GGAAATTCCATGATAGTGTGGGG + Intergenic
1123635875 15:22358496-22358518 GGAAATTCCATGATAGTGTGGGG - Intergenic
1124070541 15:26388726-26388748 GGCCATCCCAAGACAGTGTGAGG - Intergenic
1124400177 15:29341103-29341125 GGCCTCTCCTTGGGAGTATGTGG - Intronic
1125936134 15:43637905-43637927 TGCTACTTCATAAGAGTGTGGGG - Intronic
1125948900 15:43734452-43734474 TGCTACTTCATAAGAGTGTGGGG - Intergenic
1128271361 15:66312868-66312890 AGCCACTCCCTAAAAGTGTGGGG + Intronic
1129876626 15:78979629-78979651 CCCCACTTCATGTGAGTGTGTGG + Intronic
1132456788 16:28577-28599 GCCCACCCCATGAGAGGCTGAGG + Intergenic
1135532228 16:23264620-23264642 GGCCACTCCATGAATATTTGTGG - Intergenic
1142478170 17:201950-201972 GGCCGCCCCCTGAAAGTGTGGGG + Intergenic
1143116247 17:4583376-4583398 GGCCAGTCCAGGAGGGTTTGTGG + Intergenic
1146637958 17:34519943-34519965 AGCCACTGCATGAGTGTGGGGGG - Intergenic
1149760048 17:59220831-59220853 TGCCAATCCCTGAGAGTTTGAGG + Intronic
1152631258 17:81411619-81411641 GGCCACCCGAAGAGGGTGTGGGG + Intronic
1157674888 18:49561645-49561667 GACCACTCCCAGAGAGAGTGTGG + Intronic
1158755685 18:60321557-60321579 AGACACTCAAGGAGAGTGTGTGG + Intergenic
1159019375 18:63130876-63130898 GGGCAATCCATGAGAATGTGAGG - Intronic
1163314515 19:16532844-16532866 GGACACACCATGAGCGTGGGGGG + Intronic
1163588528 19:18177170-18177192 GCACACTCCATGATAGTGTCTGG - Exonic
1166592240 19:44009675-44009697 GGCCACTCCTTTCGAGGGTGAGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925585129 2:5457558-5457580 GCCCCCTCCATGACTGTGTGTGG - Intergenic
927916272 2:26938706-26938728 GCCCACTCCAGGAGACTGTGGGG - Intronic
929043247 2:37767326-37767348 TGCAATTCCATGTGAGTGTGGGG - Intergenic
929121922 2:38490472-38490494 GGCCCCTCCATGAGAGAATGAGG - Intergenic
932011070 2:67977723-67977745 GGACACTGCATAAGCGTGTGTGG - Intergenic
932188148 2:69716041-69716063 GATCACTCCAGGAGAGAGTGAGG - Intronic
934732390 2:96667729-96667751 GGCCTCTCCATGAGATGGTTTGG + Intergenic
937455449 2:122037184-122037206 GGCCACGCCATGAGGGGTTGTGG + Intergenic
942233143 2:173878374-173878396 GGACACTCCATGAAATTATGTGG + Intergenic
946452539 2:219793371-219793393 GTCCTCTCCATGACAATGTGAGG + Intergenic
948864606 2:240768930-240768952 TGCCCCACCATGAGAATGTGGGG + Intronic
1169501085 20:6161314-6161336 GGCAAGTTCATGAAAGTGTGAGG + Intergenic
1171126068 20:22603155-22603177 GGCCACTCTTTGAGAGTCTAAGG + Intergenic
1171455757 20:25271217-25271239 AGCCTCTCCATGAGAGCCTGGGG - Intronic
1172906820 20:38376649-38376671 GTCCAATACATGAGAGTTTGAGG + Exonic
1173063390 20:39683364-39683386 GGGTACTCCATGAAAGAGTGTGG + Intergenic
1174312074 20:49665082-49665104 GGCCACTCCTGGAGAGTAAGTGG - Intronic
1179101368 21:38357912-38357934 GGCCAGGCACTGAGAGTGTGAGG - Intergenic
1179317428 21:40256492-40256514 AACCACTCCATGAAATTGTGTGG + Intronic
1183462624 22:37961392-37961414 GGCCAGTCCAGCAGAGTGGGGGG + Intronic
1184268400 22:43363213-43363235 AGCCATTCCATGACACTGTGGGG - Intergenic
1184357545 22:43992585-43992607 GGCCACTCTGTGTGACTGTGTGG + Intronic
1184613134 22:45618709-45618731 GCCCAGTCCCTGAGAGGGTGGGG + Intergenic
1185046909 22:48533143-48533165 GGCCACTCCATCAGGCTGGGCGG - Intronic
1203295409 22_KI270736v1_random:38826-38848 GGCAATTCCATGTGAGTCTGGGG - Intergenic
950456462 3:13095600-13095622 CGCCACTCCATGACACTGGGTGG + Intergenic
953035585 3:39207659-39207681 TGCCACTTCATTTGAGTGTGTGG + Intergenic
956634954 3:71354910-71354932 AGCCACTGAATGAGAGTGTTGGG + Intronic
959395123 3:105827547-105827569 GGCCAGTCCATGGGAGTTTAAGG - Intronic
961153760 3:124661693-124661715 GTCCACTCTCAGAGAGTGTGGGG - Intronic
962364670 3:134770308-134770330 AGCCAGTCCATGAGAGTCTGTGG + Intronic
962630243 3:137268546-137268568 GACCACTGCATGAGAATGGGAGG + Intergenic
965984125 3:174731106-174731128 TGCCTTTCCATGATAGTGTGTGG - Intronic
968957599 4:3727135-3727157 GGCCCCTCCCTGTGAGTATGGGG - Intergenic
970878188 4:20896987-20897009 ATCCACTCCATGGTAGTGTGTGG - Intronic
975608421 4:76179689-76179711 GACCACTCTATGACAGTCTGCGG + Exonic
977096678 4:92754403-92754425 GGGCTTTCCAAGAGAGTGTGAGG + Intronic
981585639 4:146299491-146299513 AGCCACTCAAGGAGAGGGTGGGG + Intronic
985775259 5:1837900-1837922 GGCCTCTGCATGCCAGTGTGGGG - Intergenic
985788205 5:1910995-1911017 GTTCACTCCAGGTGAGTGTGGGG - Intergenic
986491254 5:8293396-8293418 GTCCACTCCTTGAGTGTGAGTGG - Intergenic
996817103 5:127586666-127586688 GGGGACTCCAAAAGAGTGTGGGG + Intergenic
1000881952 5:166708324-166708346 GGCAGCACCATGAGAGCGTGAGG - Intergenic
1001254030 5:170170180-170170202 GGCCACACCCTGGGAGTATGTGG - Intergenic
1001351789 5:170974840-170974862 GAGCACTGCATGAGAATGTGGGG + Intronic
1002014443 5:176308397-176308419 GGCCACCCCATGAGAGTTGTGGG + Intronic
1002361021 5:178670869-178670891 GGCCACTCGGTGAGATTGAGTGG + Intergenic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1004739851 6:18448237-18448259 GCCAAATCCTTGAGAGTGTGAGG + Intronic
1010609921 6:77941948-77941970 AGACACTCCATGAGTGTTTGGGG + Intergenic
1013603471 6:111726607-111726629 GGCCAGTCCATGCAAGGGTGTGG + Intronic
1019604062 7:1899681-1899703 GTCCACTCTAGGGGAGTGTGAGG + Intronic
1019890268 7:3940890-3940912 GGCCACTCCATGAGAGTGTGAGG - Intronic
1024186231 7:46951029-46951051 TGCCACTCCATCTGAGTGTCGGG + Intergenic
1024993666 7:55255037-55255059 GGCCACACCGGGAGTGTGTGAGG - Intronic
1028073004 7:86475731-86475753 GCCTACTTCATGAGATTGTGAGG + Intergenic
1028136876 7:87231312-87231334 GGCGGCTCCATGAGAGGTTGTGG - Intergenic
1035264460 7:157683527-157683549 GGCCACTCCTGGAGAGTGACTGG - Intronic
1035354527 7:158269135-158269157 GGCCACTCCAACAGAAGGTGGGG - Intronic
1036237012 8:7047729-7047751 GTCCACCCCATGAGATTCTGAGG - Intergenic
1037696179 8:21226024-21226046 TGCTTCTCCATGAGAGTCTGTGG + Intergenic
1038704805 8:29883734-29883756 GGCGACTCCAGGAGATTGTTTGG - Intergenic
1039310807 8:36316216-36316238 GGGCACTACATGAGAGTATATGG + Intergenic
1041255431 8:55976456-55976478 GGCCACACCAAGAGGGTGAGGGG - Intronic
1048777898 8:137967689-137967711 GGCCATGACATGAGAGGGTGAGG + Intergenic
1052448961 9:28601530-28601552 TGTCACTCAATCAGAGTGTGTGG + Intronic
1061761571 9:132855321-132855343 GGGCAGTCCATTAGCGTGTGCGG - Intronic
1061918241 9:133768413-133768435 GGCCCCACCCTGAGGGTGTGGGG - Intronic
1062290024 9:135790267-135790289 GGCCACCCCAGAAGCGTGTGTGG + Intronic
1186656066 X:11613482-11613504 GGACACTCTGTGAAAGTGTGTGG - Intronic
1190289618 X:48983609-48983631 GCCAAATCCATGAGAGTGGGAGG - Intronic
1196947000 X:120837100-120837122 GAGAACTCCATGAGAGTTTGAGG + Intergenic
1200399574 X:156011146-156011168 GCCCACCCCATGAGAGGCTGAGG - Intergenic