ID: 1019890290

View in Genome Browser
Species Human (GRCh38)
Location 7:3941021-3941043
Sequence TGGTGGGTCAGGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1044
Summary {0: 1, 1: 0, 2: 3, 3: 98, 4: 942}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019890290 Original CRISPR TGGTGGGTCAGGAGGGAGAA GGG (reversed) Intronic
900113967 1:1020768-1020790 GGGTTGGTCAGGAGAGAAAAAGG + Intronic
900318479 1:2070815-2070837 GGGTGGGCCAGGAAGGGGAAGGG + Intronic
900500085 1:3000063-3000085 GGGTGGGGCTGAAGGGAGAATGG + Intergenic
900521375 1:3106965-3106987 TGGTGGGGCAGGGGAGAGAAAGG - Intronic
900934233 1:5755316-5755338 TGGTGGGTCAGCCGGGCCAAGGG - Intergenic
900969200 1:5980186-5980208 GGGTTGGTCAGGAGGCAGGAGGG - Intronic
901260916 1:7869988-7870010 TGATGGTTCAGTGGGGAGAATGG + Intergenic
901453475 1:9350313-9350335 TGGTGGGGCAGGAGGGGTACAGG + Intronic
901600631 1:10420966-10420988 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
901777355 1:11569535-11569557 TGGTGGGGCGGGAGGGAGAGAGG + Intergenic
901928959 1:12584468-12584490 GGGGGGGTGAGGAGGCAGAAAGG - Intronic
902039326 1:13481494-13481516 TGGAGGCTGAGGAAGGAGAATGG - Intronic
902346462 1:15821814-15821836 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
902515911 1:16989584-16989606 TGGTGCCTGAGGAGGGAGACAGG + Intronic
902814170 1:18906666-18906688 GGGTGAGTGAGGAGAGAGAAGGG + Exonic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
902920837 1:19665298-19665320 AGGTGGGTGAGGGGGGTGAATGG - Exonic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
902988104 1:20167859-20167881 TTGGGGGTCAGGAGACAGAAGGG - Intronic
903186274 1:21631084-21631106 GGGTGGGATAGGAGAGAGAAGGG - Intronic
903996208 1:27306880-27306902 TGGTGGCTCTGGAGGGAGGGTGG - Exonic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904988484 1:34572578-34572600 TTGTGGGCCAGGAGGAAGAAGGG + Intergenic
905100932 1:35521527-35521549 TGGAAGCTGAGGAGGGAGAATGG + Intronic
905588190 1:39138478-39138500 TGGAGGCTGAGGTGGGAGAATGG + Intronic
906166253 1:43688649-43688671 TCGTGGGGCAGGAGGAAGAATGG + Intronic
906210320 1:44009322-44009344 TGGGGGCTGAGGCGGGAGAATGG - Intronic
906349391 1:45044617-45044639 TGGAGGCTGAGGTGGGAGAATGG + Intronic
906520563 1:46464613-46464635 TGGTGGCAAGGGAGGGAGAAGGG - Intergenic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906664124 1:47606653-47606675 TGTTGGGGCAGCAGAGAGAAAGG + Intergenic
906729152 1:48066368-48066390 TGGTGTGGCAGGAGAGAGATAGG - Intergenic
907417817 1:54326623-54326645 GGGTCGGCCATGAGGGAGAAAGG - Intronic
908645632 1:66275041-66275063 TGAAAAGTCAGGAGGGAGAATGG + Intronic
909239601 1:73195594-73195616 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
909958230 1:81802956-81802978 TCGTGGGTCGGGAGGGTGCAGGG + Intronic
910049509 1:82958250-82958272 TGGTCGCTAAGGAGGGAGTAGGG - Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910731143 1:90398758-90398780 TGGTGGAGCAGGAGAGAGAGAGG + Intergenic
911595899 1:99798861-99798883 TGGTGGCTGAGGCAGGAGAATGG - Intergenic
912149765 1:106843796-106843818 TTTTGGGTCAGGAGGGAGGCTGG + Intergenic
912515649 1:110215047-110215069 TGGTGGGCGAAGAGGGAGAGAGG + Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
912762536 1:112381997-112382019 TGGTGGGTGAGGGGAAAGAAGGG + Intergenic
913199667 1:116485468-116485490 TGGAGCCTCAGGAGGGAGACTGG + Intergenic
913476553 1:119243966-119243988 TGGGAGGTGAGGCGGGAGAATGG + Intergenic
913477356 1:119250970-119250992 GGGAGGCTCAGGCGGGAGAATGG + Intergenic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914451853 1:147799685-147799707 CGGTGGGGCAGGAGGGGGAGTGG + Intergenic
914827784 1:151147579-151147601 TGAAGGGTGGGGAGGGAGAAGGG - Intergenic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
915671044 1:157489313-157489335 TGGAGGCTGAGGAGGGAGAATGG + Intergenic
916153287 1:161817994-161818016 GGGAGGCTGAGGAGGGAGAATGG + Intronic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916415498 1:164588820-164588842 TGGTGGGGGCGGAGGGATAAAGG - Intronic
917028424 1:170665296-170665318 TGGTCGGTGAGGATGGGGAAGGG - Intronic
917439285 1:175052559-175052581 TGGAGGGCAAGGAGAGAGAAGGG + Intergenic
917670228 1:177266653-177266675 GGGAGGGTGAGGAAGGAGAATGG + Intronic
917709595 1:177670911-177670933 TGGTGGGCCCAGAGGGACAAAGG + Intergenic
917791947 1:178504591-178504613 TGACGGGTCAAGAGGGAGGAAGG + Intergenic
918599013 1:186330818-186330840 TTGTGGGACAGAAGGAAGAAAGG + Intronic
918737176 1:188079812-188079834 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919550330 1:198977673-198977695 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
919728181 1:200897071-200897093 GGGTTGGTGAGGAGGGAGAGGGG + Intronic
920047751 1:203144761-203144783 TCTTGGAACAGGAGGGAGAATGG + Intronic
920095987 1:203487173-203487195 GGGTGGGGGAGGAGAGAGAAGGG - Exonic
920303672 1:205005138-205005160 TGGTGGGCCAGGATGGGGCAAGG + Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920437468 1:205956732-205956754 GGTTAGGGCAGGAGGGAGAAGGG - Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921300498 1:213747063-213747085 GGGTGAGTAAGGATGGAGAAGGG + Intergenic
921660389 1:217794009-217794031 TGGAGGGTAAGGCAGGAGAATGG + Intronic
922089518 1:222382381-222382403 GGGTGAGTCAGGAGGCAGAAAGG + Intergenic
922333046 1:224594562-224594584 GTGTAGGTCAGGAGGCAGAAAGG + Intronic
922705269 1:227787230-227787252 TGGTGTCTCAGGAGGGCGCAGGG + Intergenic
922746689 1:228048228-228048250 TGGGAGAGCAGGAGGGAGAAGGG - Intronic
922816415 1:228452725-228452747 TGGAGGGTCAGGAGGGATCAGGG - Intergenic
922816431 1:228452781-228452803 TGGAGGGTCAGGAGGGTTCAGGG - Intergenic
922823115 1:228497994-228498016 TGCTGGGTCTGCAGGGAGCAGGG - Intergenic
922931967 1:229396974-229396996 ACGTGGGTCAGGAGGCAGAGGGG - Intergenic
923220526 1:231888631-231888653 CGGTGGCTGAGGTGGGAGAATGG + Intronic
923450489 1:234112658-234112680 TGGAGGCTGAGGAAGGAGAATGG - Intronic
923501933 1:234572308-234572330 TGGTGGGAAGGCAGGGAGAAGGG - Intergenic
923625216 1:235608040-235608062 AGGAGGCTCAGGAAGGAGAATGG - Intronic
924306328 1:242692713-242692735 GGCTGAGGCAGGAGGGAGAATGG - Intergenic
924754227 1:246927071-246927093 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1063110970 10:3037270-3037292 CGGTAGGTCAGGAGGCAGAAGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063749541 10:8927143-8927165 TGGTGCCTCAGGAGGGAGGCTGG - Intergenic
1064072199 10:12239901-12239923 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1064777290 10:18792978-18793000 GGGAGGCTAAGGAGGGAGAATGG - Intergenic
1064955501 10:20903857-20903879 TGGAGACTCAGAAGGGAGAAGGG + Intronic
1065311738 10:24423007-24423029 TGGAGGCTTAGGTGGGAGAATGG - Intronic
1065449549 10:25842492-25842514 TGATGGGTCAGGAGGGGAAAGGG - Intergenic
1065532515 10:26686840-26686862 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1066199001 10:33128029-33128051 GGGTGGGTGAGGAGAGGGAAGGG - Intergenic
1066572253 10:36786397-36786419 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1066622127 10:37367191-37367213 TGGTAGGGCAGGAAAGAGAAAGG + Intronic
1067103719 10:43351285-43351307 GGGTGGGTCGGGCGGGGGAACGG - Intergenic
1067412824 10:46079636-46079658 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
1067844604 10:49709846-49709868 TGCTGGGAGAGAAGGGAGAAGGG - Exonic
1068072239 10:52209734-52209756 AGATGGGTGATGAGGGAGAAGGG - Intronic
1068142333 10:53024398-53024420 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
1068959820 10:62855340-62855362 TTGGGAGTCAGGGGGGAGAATGG + Intronic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069409524 10:68139074-68139096 TGTTGGAGCAGGAGGAAGAAGGG - Intronic
1069826373 10:71257424-71257446 GGGTGGGCCTGGAGGGGGAAGGG - Intronic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070828676 10:79405677-79405699 TGGTGGGTCAAGAGGTGGAAAGG + Intronic
1071572361 10:86704682-86704704 TGGGGGCTGAGGCGGGAGAATGG - Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1072001629 10:91200945-91200967 GGGAGGGTCAGGTGGGAGAATGG + Intronic
1072712815 10:97728573-97728595 GGGTGGCTGAGGAAGGAGAATGG - Intergenic
1073119379 10:101112303-101112325 GGGAGGCTGAGGAGGGAGAATGG - Intronic
1073578723 10:104644906-104644928 GGGTGGGACATGAAGGAGAAGGG + Intronic
1073832178 10:107397302-107397324 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
1074175561 10:110998102-110998124 GGGAGGCTCAGGAAGGAGAATGG - Intronic
1074552294 10:114455915-114455937 AGGAGGGTGAGGCGGGAGAATGG - Intronic
1074851631 10:117443906-117443928 TGGTGGAGCAGGAGAGAGAGAGG - Intergenic
1075093708 10:119457607-119457629 TGGGGACTCAGTAGGGAGAAGGG - Intronic
1075393183 10:122107994-122108016 GGGAGGCTGAGGAGGGAGAATGG - Intronic
1075685867 10:124364754-124364776 TGGTGGGAAAGAAGGGAGCAGGG + Intergenic
1075753819 10:124794576-124794598 TGGTGGCTGAGGCAGGAGAATGG + Intergenic
1075818440 10:125284599-125284621 GGGAGGCTCAGGAAGGAGAAAGG - Intergenic
1076421592 10:130335863-130335885 TGGTGGGTAGGGAGGGAGACAGG + Intergenic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076640069 10:131909386-131909408 TGGTGGGTAAGAATGGAGATAGG + Intronic
1077211027 11:1371004-1371026 TGGTGGGGCTGGAGGGAGCGGGG + Intergenic
1077281305 11:1747425-1747447 TGATGGCTCAGGAGAGGGAAGGG + Intronic
1077765557 11:5156430-5156452 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1077856543 11:6131699-6131721 TGGAGGGTAAGGCAGGAGAATGG + Intergenic
1078393535 11:10957067-10957089 TGGTGGAGCAGGAGAGAGAGAGG - Intergenic
1078567190 11:12426386-12426408 TGGTGAGTAAGGAGGGGGAGTGG + Intronic
1078859984 11:15238108-15238130 TGGAGCGTCAAGAGGGAAAATGG + Intronic
1079929794 11:26543599-26543621 TGGTGTGGCGGGAGGGAGGAGGG - Intronic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080771142 11:35343097-35343119 TGGTGTGTCAGTAGTGAGACAGG + Intronic
1080887334 11:36378188-36378210 TAGCGGGTCAGGAGGGGAAATGG + Intronic
1081189880 11:40090678-40090700 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081804038 11:45880377-45880399 TGTGGGGGCAGGAGGGAGAGAGG - Intronic
1082063883 11:47883064-47883086 GGTTTGGTCAGGAGGCAGAAAGG + Intergenic
1083320412 11:61842548-61842570 TGTTGCGTCAGGCGGGAGACGGG + Intronic
1083885928 11:65573547-65573569 TGGCGGGTCAGGAGGCAGGCTGG - Exonic
1084203775 11:67578975-67578997 TGGAGGCTGAGGAAGGAGAATGG + Intergenic
1084932797 11:72570529-72570551 TGGTGGGTCAGATGTGAGAATGG - Intergenic
1084963712 11:72732494-72732516 TGGTGAGTCAGGAGGTGGAGCGG - Exonic
1084977953 11:72813750-72813772 TGGGAGGACAGGAGGCAGAAGGG - Intergenic
1085081644 11:73639518-73639540 GGGTGGGGCAAGAGGGAGAGAGG + Intergenic
1085177110 11:74498968-74498990 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1085326526 11:75610760-75610782 TGCTGGGTCAAGAGGGAGAATGG + Intronic
1085352415 11:75807948-75807970 TGGTGGCTGAGGCAGGAGAATGG - Intergenic
1085559663 11:77459795-77459817 GGGTGGCTCAGGCAGGAGAATGG - Intronic
1085918620 11:80923899-80923921 TGTTAGGTCAGGAATGAGAAAGG - Intergenic
1086464444 11:87038319-87038341 TGGGGGGTCGGTAGGGGGAAGGG + Intronic
1086589954 11:88502361-88502383 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087022976 11:93621853-93621875 TGGTGGGATAGCAGTGAGAAAGG - Intergenic
1087039345 11:93783947-93783969 GGGTGGCTGAGGCGGGAGAATGG - Intronic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1087634431 11:100687110-100687132 GGGTGGGGCAGGAGGGCAAAGGG + Intergenic
1087945787 11:104158726-104158748 AGGAGGCTCAGGAAGGAGAATGG + Intronic
1087984525 11:104660808-104660830 TGGGGGTTCAGGAGAGAGAATGG + Intergenic
1088581261 11:111319111-111319133 GGCAGGGTCAGGAGGTAGAAGGG + Intergenic
1088587553 11:111372834-111372856 TTGTGTGTTGGGAGGGAGAAGGG + Intronic
1088982437 11:114875919-114875941 TGGTGGGTCAGGAAGAGCAAAGG + Intergenic
1089413457 11:118266642-118266664 TGGGGGCTCAGGAGACAGAAGGG + Intergenic
1089689692 11:120179556-120179578 TGCTGAGTCAGGGAGGAGAAAGG - Intronic
1089773085 11:120817138-120817160 TGGTGGGGGAGAAGGGAGAGAGG - Intronic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090310377 11:125731373-125731395 AGGTGGGCCAGGAGACAGAATGG + Intergenic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1090977840 11:131691487-131691509 CGGGGGGCCAGGAGGGAGCAAGG - Intronic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091831717 12:3554848-3554870 TGGCAGGTCAGCAGGGAGCATGG - Intronic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092170087 12:6369133-6369155 GGGAGGGGCAGGAGGCAGAAGGG - Intronic
1092352297 12:7765463-7765485 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1092569785 12:9709377-9709399 TGGAGGGGCAGGAGTGAGACTGG - Intergenic
1092726982 12:11496472-11496494 TGGTGGGGCAGAAAGGAGGAAGG + Intronic
1094034738 12:26056078-26056100 TGGAGGCTGAGGAAGGAGAATGG + Intronic
1094250528 12:28354984-28355006 AGGAGAGGCAGGAGGGAGAAGGG - Intronic
1094358280 12:29601938-29601960 TGGAGGCTGAGGAAGGAGAATGG - Intronic
1095494001 12:42765564-42765586 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1095579145 12:43775984-43776006 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1095724112 12:45433451-45433473 GGGTTGGTCAGGAGGGAGGTTGG + Intronic
1095868882 12:47003743-47003765 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1095894946 12:47270641-47270663 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1095962542 12:47844581-47844603 AGGTTGGACAGGAGAGAGAATGG + Exonic
1096101458 12:48972625-48972647 GGGTGAGTCAGGCGGGAGCACGG - Intergenic
1096163460 12:49400492-49400514 TGCTGATGCAGGAGGGAGAAAGG + Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096338304 12:50774850-50774872 GGGAGGCTGAGGAGGGAGAATGG - Intronic
1096338473 12:50776209-50776231 GGCTGAGGCAGGAGGGAGAATGG + Intronic
1096478780 12:51924333-51924355 TGGTGGGAGAGTGGGGAGAAGGG + Intergenic
1096788235 12:54029991-54030013 TGGTGGGGAGCGAGGGAGAAAGG - Exonic
1096891309 12:54774698-54774720 AGGTTGGTCAGGAGGCAGAGAGG + Intergenic
1097174114 12:57133042-57133064 TTGTGGGCTAAGAGGGAGAAAGG + Intronic
1097287197 12:57887463-57887485 AGGGGTGTCAGGAGGGATAAGGG + Intergenic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100432791 12:94545778-94545800 TGGTGTGTCAGGAGAGACGAGGG + Intergenic
1100591976 12:96037795-96037817 TGGAGGCTCAGGCAGGAGAACGG - Intronic
1101556817 12:105817768-105817790 TGATGGGTAAGGAGGTAGAAAGG - Intergenic
1101661329 12:106768093-106768115 GGGTGGGGGAGGAGGGAGCACGG + Intronic
1102038686 12:109786847-109786869 GGGAGGGTCAGGAGGGACATCGG + Intronic
1102221680 12:111199052-111199074 GGGTGGGTGCGGAGAGAGAAGGG + Intronic
1102243652 12:111341614-111341636 AGGAGAGTGAGGAGGGAGAAAGG + Intronic
1102335281 12:112073539-112073561 TGGAGGCTGAGGAGGGAGAATGG - Intronic
1102394380 12:112574630-112574652 GGGTGGTGGAGGAGGGAGAAGGG + Intronic
1102394451 12:112574834-112574856 GGGTGGTGGAGGAGGGAGAAGGG + Intronic
1102691956 12:114768415-114768437 TGCTGGGGCAGGGGGGAGAGGGG - Intergenic
1102752416 12:115307067-115307089 TGGAGGCTCAGGTGGGAGGAAGG - Intergenic
1103039568 12:117684166-117684188 GGGTGGGTCAGGATGAGGAAAGG - Intronic
1103127049 12:118432649-118432671 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1103215835 12:119200707-119200729 TGGTGGGTGAGGATGGATCAAGG + Intronic
1104148655 12:126060326-126060348 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1105911255 13:24870044-24870066 TGGAGGCTGAGGTGGGAGAATGG - Intronic
1105992259 13:25633869-25633891 TGGAGGCTAAGGTGGGAGAATGG + Intronic
1106232038 13:27827967-27827989 TGGTGTGACAGGAGGGAGGCAGG - Intergenic
1106647877 13:31656287-31656309 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1106795713 13:33202820-33202842 GGGTGGGGCAGGAGGGACACGGG + Intronic
1108010758 13:46006255-46006277 TGGCGGGGCAGCAGGGAGACTGG - Intronic
1108362599 13:49680920-49680942 TTGGGAGTCAGGAGGGAGAGAGG - Intronic
1108822075 13:54364172-54364194 GGGAGGCTCAGGAAGGAGAATGG + Intergenic
1109221932 13:59648617-59648639 TGGTGGTTGCGCAGGGAGAAGGG + Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1110065186 13:71095500-71095522 TGGAAGGTCAGGGGTGAGAAGGG + Intergenic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1111110851 13:83707496-83707518 TGGAGGCTGAGGAGGGAGAATGG - Intergenic
1111292519 13:86187144-86187166 TGGAGGGGCAGGAGTGAGACTGG - Intergenic
1111535017 13:89592323-89592345 TGGAGGCTGAGGAAGGAGAATGG - Intergenic
1111576319 13:90158247-90158269 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1112005317 13:95248667-95248689 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1112167366 13:96933895-96933917 TGGTGATGCAGGAGAGAGAAGGG + Intergenic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1112880186 13:104097706-104097728 GGGAGGCTGAGGAGGGAGAACGG - Intergenic
1113043037 13:106125273-106125295 TGGAGGGGAAGGAGGAAGAAGGG - Intergenic
1113061963 13:106331671-106331693 TGGGGAGCCAGAAGGGAGAATGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113703300 13:112405085-112405107 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1114235453 14:20819784-20819806 GGCTGAGACAGGAGGGAGAATGG + Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114613783 14:24057878-24057900 AGGTGGGAGAGGAGGGGGAAGGG + Exonic
1114633208 14:24172683-24172705 GGGTGGGGAAGGTGGGAGAATGG - Intronic
1115038393 14:28889031-28889053 TGCTGCTTGAGGAGGGAGAAGGG - Intergenic
1115539006 14:34401187-34401209 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1115645860 14:35368091-35368113 TGCTGGGGCAAGAGGGTGAAAGG - Intergenic
1116295170 14:43098429-43098451 TGGAGGCTCAGGCAGGAGAATGG + Intergenic
1116318747 14:43432651-43432673 GGGAGGCTCAGGTGGGAGAATGG - Intergenic
1116472724 14:45305146-45305168 ATGTGGGTCAGGAGGAAGAGAGG + Intergenic
1116827284 14:49684870-49684892 GGGAGGCTGAGGAGGGAGAACGG + Intronic
1116885845 14:50220299-50220321 GGGTGGCTGAGGAAGGAGAATGG + Intronic
1117640500 14:57793398-57793420 TGGAGGCTCAGAAGGTAGAAGGG - Intronic
1117642016 14:57810143-57810165 TGCTGGCTCAGGATGGAGGAGGG - Intronic
1117991210 14:61435599-61435621 TGGAGGCTCAGGTGGGAGGATGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1118714615 14:68550141-68550163 TCATGGGCCAGGAGGGAGCACGG - Intronic
1120193286 14:81459009-81459031 GGGAGGGTAAGGCGGGAGAATGG - Intergenic
1120913750 14:89691539-89691561 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1121165463 14:91792012-91792034 GGGAGGCTCAGGCGGGAGAATGG + Intronic
1121230519 14:92354253-92354275 GGGTGGGTAAGGCAGGAGAATGG - Intronic
1121354020 14:93198274-93198296 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1121730022 14:96180280-96180302 TGGAGGGTAAGGAGGGAAATTGG - Intergenic
1122464127 14:101918627-101918649 AGGGGGGTCAGGGGGGAGAGGGG - Intronic
1122726361 14:103756861-103756883 GGGAGGCTCAGGCGGGAGAATGG - Intronic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124050898 15:26196859-26196881 TGGAGCCTCTGGAGGGAGAATGG + Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124440867 15:29685492-29685514 TGGTGTGACAGGAGGAAGAAGGG - Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125290867 15:38145336-38145358 TGGTTGGTGGGGAGAGAGAAGGG - Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125490790 15:40147115-40147137 TGGAGGGTCAGGGGTGAGGAAGG + Intergenic
1126493798 15:49268040-49268062 TGGTGGGTTAGCAGGGAAATGGG + Intronic
1126528912 15:49689950-49689972 TGGTGGCTGAGGCAGGAGAATGG + Intergenic
1127456399 15:59159476-59159498 TGGAGTGTCAGGAGGGAGGTGGG + Intronic
1127674423 15:61227131-61227153 GGGGGGGTCAAGAAGGAGAAAGG + Intronic
1128012914 15:64315649-64315671 TGGTGTGGCAGAAGGGAGGAGGG - Intronic
1128262575 15:66242786-66242808 TGATAGGGCAGGAGAGAGAAGGG - Intronic
1128637793 15:69314301-69314323 AGGAGGGACAGGAGGGAGAAGGG - Intronic
1128643008 15:69353727-69353749 TTGTGGGTCACTAGGGATAAGGG - Intronic
1128697606 15:69780372-69780394 TGGTGGGGCAGGGGGGTGAAGGG - Intergenic
1128748195 15:70129876-70129898 TGGTGGTTCAGGAGTCAAAAGGG - Intergenic
1128835238 15:70804171-70804193 GGGTGGGCAATGAGGGAGAAGGG + Intergenic
1128881450 15:71247000-71247022 GGGAGGGTGAGGTGGGAGAATGG - Intronic
1129112448 15:73345411-73345433 TGGTGGGTCATGGGGTAGAGAGG - Intronic
1129194355 15:73955323-73955345 TGCTGGGTCAGGAGTGAAGATGG - Intergenic
1129248097 15:74292267-74292289 TGGTGAGTCAGGGTGGAGGATGG - Intronic
1129337498 15:74861794-74861816 TGGAGGCTGAGGTGGGAGAATGG + Intronic
1130042878 15:80419497-80419519 TGGGTGATCTGGAGGGAGAAGGG + Intronic
1130202971 15:81850598-81850620 GGGGTGGTCAGGAGGCAGAAGGG + Intergenic
1130863334 15:87910090-87910112 TGGAAGGTCAGGAAGGAGACTGG + Intronic
1130924569 15:88375398-88375420 TAGTGGGGGAGGAGGCAGAATGG - Intergenic
1131237702 15:90711219-90711241 GGTTTGGTCAGGAGGCAGAAGGG - Intergenic
1131551645 15:93362386-93362408 TGGGTGGTTAGGAGGGTGAACGG + Intergenic
1131627278 15:94134753-94134775 CGGAGGGTCAGGAGAGTGAATGG - Intergenic
1131822715 15:96289130-96289152 TGGAGGCTGAGGAAGGAGAATGG + Intergenic
1132057797 15:98665332-98665354 TGCAGAGTCAGGAGGGAGACAGG - Intronic
1132176954 15:99723596-99723618 GTGTTGGTCAGGAGGCAGAAGGG - Intronic
1132496717 16:266829-266851 GGGTGGGGCTGGAGGGAGAAGGG + Intronic
1132874973 16:2133107-2133129 ACATGGGTCAGGAGGGAGAAGGG + Intronic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133307640 16:4820916-4820938 TGGTGGGGCAGGTGGGGGAAGGG - Intronic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134885193 16:17784691-17784713 TGATGGTTCAGGAGAGGGAAAGG - Intergenic
1135050015 16:19185145-19185167 AGGAGGGGAAGGAGGGAGAAAGG - Intronic
1135109302 16:19678254-19678276 TGTTGGGCCAGCAGGGAGAGAGG + Intronic
1135968332 16:27053761-27053783 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
1135993668 16:27232562-27232584 GGGTGTGTCAGGAGCGGGAATGG - Intronic
1136020026 16:27434323-27434345 TGGAGGGTCAGTGGGGAGAGAGG - Intronic
1136039352 16:27565677-27565699 TGGAGGCTGAGGTGGGAGAATGG + Intronic
1136401952 16:30024100-30024122 TGGTGGGTGGGGTTGGAGAAAGG - Intronic
1136621815 16:31434583-31434605 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1137010707 16:35317116-35317138 TGCTGGGGAGGGAGGGAGAAGGG - Intergenic
1137625588 16:49905986-49906008 TGGAGGGTCAGATGGGTGAATGG + Intergenic
1138251543 16:55505653-55505675 TGGTGGGATTGGAGGGGGAAGGG - Exonic
1138255634 16:55556641-55556663 TGGTGGCTGAGGCAGGAGAATGG + Intronic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1139592928 16:67943363-67943385 TGGGGGGACAGCAGGGAGAGGGG - Intronic
1139629833 16:68223500-68223522 TGGAGGCTAAGGTGGGAGAATGG + Intronic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140075800 16:71697950-71697972 TGGAGGCTGAGGTGGGAGAATGG - Intronic
1140136119 16:72207039-72207061 TGGTGGGTCAGATGGTAGAGAGG + Intergenic
1140177663 16:72679958-72679980 TGCAGGGTGAGGAGGGGGAATGG + Intergenic
1140911160 16:79454297-79454319 TGGTGGGGCATCAGGGTGAAAGG + Intergenic
1141458090 16:84158098-84158120 TGGTGGCTGAGGCAGGAGAATGG + Intronic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141895363 16:86955597-86955619 GGGTGGGTCAGAGGGGAGACGGG - Intergenic
1142120868 16:88386137-88386159 TGGCTGGCCAGGAGGGAAAATGG - Intergenic
1142377308 16:89712524-89712546 TGGGGGGGGAGGAGGGAGTAAGG + Intronic
1142666718 17:1467694-1467716 TGGGGGGTCAGGAGGTGGATGGG - Intronic
1143129888 17:4671632-4671654 AGGTGGGGCTGGCGGGAGAAGGG - Intronic
1143166110 17:4897974-4897996 GGGTGGGGGGGGAGGGAGAAGGG - Exonic
1143668147 17:8376622-8376644 AGGAAGGTCAGGAAGGAGAAAGG + Intronic
1143969978 17:10788469-10788491 TAGTGGCTCAGGAGAGAGATGGG - Intergenic
1144301265 17:13924470-13924492 TGGAGGGGCAAGAGGGAGACTGG - Intergenic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1145898527 17:28474827-28474849 GGGTGGGGCAGGAGGCAGCAGGG - Intronic
1145936919 17:28719666-28719688 TGGTGGCTGAGGCAGGAGAATGG + Exonic
1146422616 17:32702562-32702584 TGGGGGGCGAGGAGGGACAAAGG - Intronic
1146971301 17:37074579-37074601 GGGAGGCTCAGGCGGGAGAATGG - Intergenic
1147049071 17:37777427-37777449 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1147154159 17:38535025-38535047 TGGAGGCTGAGGTGGGAGAATGG + Intronic
1147188480 17:38725604-38725626 GGGGGGGTCAGGAGGGGTAAGGG - Exonic
1147371650 17:39996971-39996993 TGGTGGGGCAGGAGTGGGAGGGG - Intronic
1147419349 17:40314453-40314475 AGGTGGGGCAGGTGGGAGAGTGG + Intronic
1147478734 17:40738721-40738743 ATGTGGGCCAGGAGGCAGAAAGG - Intergenic
1147665373 17:42143888-42143910 TGGTGGCTGAGGCAGGAGAATGG - Intronic
1148243816 17:46017251-46017273 TCAAGCGTCAGGAGGGAGAAAGG + Intronic
1148354947 17:46969364-46969386 TGGTGGGCCAGGTGGCAGAGTGG + Intronic
1148491323 17:48025588-48025610 CGGAGGGACAGGAGGGTGAAAGG - Intergenic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148696715 17:49564472-49564494 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1149013296 17:51880212-51880234 GGGTTGGTCAGGAGGAATAAAGG - Intronic
1149089919 17:52765149-52765171 TGGTTGTTCCTGAGGGAGAAGGG + Intergenic
1149553279 17:57555589-57555611 AGGGGGTTCAGGAGGGAGGAAGG - Intronic
1149780947 17:59395974-59395996 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1149780986 17:59396441-59396463 GGTTGGGGCAGAAGGGAGAAAGG + Intronic
1149966769 17:61172530-61172552 GGGAGGCTGAGGAGGGAGAAGGG + Intronic
1150106288 17:62464812-62464834 TGGAGGGGCTGGAGGGGGAAAGG + Intronic
1150385383 17:64755288-64755310 GGGAGGCTCAGGAGGGAGGATGG + Intergenic
1150637822 17:66928434-66928456 TTGCGTGTCAGGAGGGAGAGGGG + Intergenic
1150674534 17:67233735-67233757 AGGGAAGTCAGGAGGGAGAATGG - Intronic
1150770951 17:68040332-68040354 GGGAGGCTCAGGAGGGAGGATGG - Intronic
1150986265 17:70200817-70200839 TGGAGGGTGAGGCAGGAGAATGG - Intergenic
1151025045 17:70668670-70668692 TAGTTGGACAGGAGGGAGCAAGG + Intergenic
1151080439 17:71323250-71323272 AGGTGGGGCAGGAAGAAGAAAGG + Intergenic
1151266877 17:72963273-72963295 TGGAGGCTGAGGAAGGAGAATGG - Intronic
1151364889 17:73610877-73610899 TGGAGGGTCAGGCAGGAGTATGG + Intronic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151624293 17:75267072-75267094 TGGATGGTAAGGAGGGAGCAAGG - Intronic
1151626966 17:75282745-75282767 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1151691158 17:75686409-75686431 TGGAGGTTGAGGAAGGAGAATGG + Intronic
1151727788 17:75894632-75894654 TGGTGGCTGAGGCTGGAGAATGG - Intronic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1151954736 17:77374572-77374594 TGGTGGGCCGGGAGGGGGAAAGG + Intronic
1152040348 17:77898877-77898899 TGCTGGGCGAGGAGGGAGACAGG - Intergenic
1152279096 17:79374954-79374976 GGCTGGGGCAGGAGGGAGAGAGG - Intronic
1152622533 17:81372479-81372501 TGGAGCTTCAGGAGGGAGGAGGG - Intergenic
1154021436 18:10667350-10667372 TGGAGGCTGAGGAAGGAGAATGG + Intronic
1154293769 18:13132349-13132371 GGGAGGCTCAGGTGGGAGAATGG + Intergenic
1155315209 18:24564406-24564428 TGGAGGGTTAGGTGAGAGAAAGG + Intergenic
1155938705 18:31781471-31781493 TGATGCCCCAGGAGGGAGAAGGG + Intergenic
1156107087 18:33676117-33676139 GGGAGGGTGAGGAAGGAGAATGG + Intronic
1156338387 18:36188804-36188826 GGGAGAGTCAGGAGGGAGACGGG + Intronic
1157997701 18:52578874-52578896 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1158559970 18:58505469-58505491 AGGTGGTTCAGGATGGAGCAGGG - Intronic
1158594877 18:58807271-58807293 AGGTGGGTCAGGAGGCAGAAAGG - Intergenic
1158619127 18:59015673-59015695 TGGTTGGCCAGGAGGCAGGAGGG + Intergenic
1158688562 18:59639163-59639185 TGGAGGCTGAGGTGGGAGAATGG + Intronic
1158977765 18:62727746-62727768 TTGAGGGACAGTAGGGAGAAAGG + Intronic
1158978998 18:62740172-62740194 GGGTAGGTCGGGAGGCAGAAAGG + Intronic
1159313190 18:66737013-66737035 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1159488498 18:69098031-69098053 TCGTGGGCAAGGAGAGAGAATGG - Intergenic
1159945610 18:74442431-74442453 TGGAGGCTGAGGAAGGAGAATGG - Intronic
1160164786 18:76500949-76500971 GGGAGGGTGAGGCGGGAGAATGG + Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160626790 18:80214359-80214381 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1160698914 19:497108-497130 AGGGGGCTCAGGAGAGAGAAGGG + Intronic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160931784 19:1574191-1574213 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161266614 19:3367252-3367274 TGGAGGCCCAGGAGGGGGAAGGG + Intronic
1161820862 19:6530783-6530805 TGGAGAGACAGCAGGGAGAAAGG + Intergenic
1161820998 19:6531368-6531390 TGGGGGTGCGGGAGGGAGAAGGG - Intronic
1161902670 19:7131235-7131257 TGGTGGGTGAGAAGAGGGAAAGG + Intronic
1161915318 19:7224048-7224070 TGGAGGCTGAGGTGGGAGAACGG - Intronic
1161997380 19:7721781-7721803 GGGAGGCTCAGGTGGGAGAATGG - Intergenic
1162049280 19:8022767-8022789 TGGGGGGTGAGGCAGGAGAATGG - Intronic
1162526837 19:11211142-11211164 AGGTGGGGCAGGGGGGTGAAGGG - Intronic
1162950138 19:14066616-14066638 TGGAGGCTCAGGCGGGAGGATGG - Intergenic
1163124304 19:15236501-15236523 TGGGGGGACAGGATGGAGTAGGG + Exonic
1163385896 19:17000376-17000398 GGTTGGGTCAGGGGGTAGAAGGG + Intronic
1163589097 19:18180969-18180991 TGGTGGCTTAGGAGGGAGTTGGG + Intergenic
1164037152 19:21465298-21465320 TGGAGGGTGAGGCAGGAGAATGG + Intronic
1164246068 19:23430272-23430294 TGGGGTGGCAGGAGGGGGAAAGG - Intergenic
1164558862 19:29274756-29274778 TGGAGGGACAGGAGGTGGAAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164700544 19:30281217-30281239 TGGGGAGCGAGGAGGGAGAAAGG - Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165860987 19:38909200-38909222 GGGTGTGTCAGGAGGAAGGAGGG + Exonic
1165881598 19:39047897-39047919 TGGGGGGACAGGAGGAAGTAAGG + Intergenic
1165987659 19:39784913-39784935 TGGTGGGTCTGGAGTTGGAAAGG - Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166425043 19:42670152-42670174 GGGAGGCTGAGGAGGGAGAATGG - Intronic
1166733902 19:45073473-45073495 TGGTGGCTGAGGCAGGAGAATGG - Intronic
1166778434 19:45326540-45326562 AGTTGGGTCAGGAGGGACAGTGG - Intergenic
1167125498 19:47545714-47545736 CGGTGGGGCAGGAGGGAGCCGGG + Exonic
1167321513 19:48799726-48799748 GGGTCGGCCAGGAGGGAGACCGG + Exonic
1167426815 19:49433871-49433893 GGGGGGGTCAGGAGGGGGATGGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167463793 19:49639853-49639875 TGATGGGTCAAGGGGGAAAAGGG + Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1168144991 19:54415726-54415748 TCCTGGGTCCCGAGGGAGAAGGG + Intronic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168376211 19:55882012-55882034 TGGAGGCTCAGGAGGGTGAGAGG - Intergenic
1202657061 1_KI270708v1_random:33957-33979 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925397907 2:3549839-3549861 GGGAGGGTGAGGAAGGAGAATGG + Intronic
925705918 2:6684705-6684727 TGGAGGGGCAAGAGTGAGAATGG + Intergenic
926173710 2:10570279-10570301 TGGTGAGACAGGAGGAGGAAGGG + Intergenic
926205231 2:10830850-10830872 TGGTGGCTCAGGAGGCACACGGG + Intronic
926398542 2:12470618-12470640 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
926401481 2:12501605-12501627 TGGAGGGGCAGGAAGGGGAAGGG - Intergenic
926846461 2:17146540-17146562 TGGGGGGTGAAGAGAGAGAAAGG + Intergenic
927009081 2:18882874-18882896 AGGAGGGTGAGGCGGGAGAATGG - Intergenic
927256528 2:21044578-21044600 TGCTGGGGGAGGAGAGAGAAGGG + Intergenic
927465206 2:23331612-23331634 TGGTGAGTGAGGAGAGGGAAGGG + Intergenic
927536683 2:23867235-23867257 TGGATGGTCTGGATGGAGAATGG - Intronic
927981049 2:27375461-27375483 GGGTAGATTAGGAGGGAGAATGG - Intronic
929036513 2:37698158-37698180 TGGAGGCTGAGGCGGGAGAATGG - Intronic
929510716 2:42563926-42563948 TGGAGGCTGAGGCGGGAGAATGG - Intronic
929641974 2:43590538-43590560 TGGTGGCTGAGGCAGGAGAATGG + Intronic
929939700 2:46324169-46324191 AGGAGGGTGAGGAAGGAGAATGG - Intronic
930009739 2:46927459-46927481 TGGAGGTTGAGGTGGGAGAATGG - Intronic
930019440 2:46992527-46992549 TGGGGGCTGAGGTGGGAGAAAGG + Intronic
930164121 2:48187118-48187140 TGGTGGGTTGGGATGGGGAAGGG - Intergenic
930771918 2:55137861-55137883 AGGGGGGTCAGTAGGGGGAATGG - Intergenic
931329110 2:61261492-61261514 AGGGGGGTTGGGAGGGAGAATGG + Intronic
931341114 2:61401651-61401673 TGGAGGCTGAGGAAGGAGAATGG - Intronic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932826148 2:74942155-74942177 TGGTGGGGCACGGGGGTGAAGGG + Intergenic
932892921 2:75611713-75611735 TGGTGGGACATGATGGAGGATGG - Intergenic
933377792 2:81502190-81502212 AGGTGGAGCACGAGGGAGAATGG + Intergenic
933573499 2:84040620-84040642 GGGTGGGTGAGGAGGCAGCATGG + Intergenic
933821795 2:86119459-86119481 AGGAGGCTGAGGAGGGAGAATGG - Intronic
934609099 2:95721519-95721541 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
935445637 2:103153539-103153561 TGGGGGTTGAGGAGGGATAAGGG + Intergenic
935721503 2:105983290-105983312 AGGAGAGTCAGGAGGGACAAAGG + Intergenic
935766824 2:106376175-106376197 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936350226 2:111706892-111706914 TGGAGGCTCAGGAGGCACAAGGG - Intergenic
936366181 2:111858655-111858677 TGGAGGCTGAGGCGGGAGAATGG + Intronic
936367966 2:111877677-111877699 GGGAGGGTGAGGCGGGAGAATGG + Intronic
936542420 2:113363100-113363122 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
936544681 2:113380778-113380800 GGGAGGGTGAGGTGGGAGAATGG + Intergenic
936610359 2:113996509-113996531 TAGTGGGTCACCAGGGATAATGG + Intergenic
936646171 2:114375492-114375514 TAGTGGGTCACTAGGGATAACGG + Intergenic
936768844 2:115887466-115887488 GGATGGATCAGGAGGGAGGAAGG - Intergenic
936907536 2:117554599-117554621 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
937116910 2:119413136-119413158 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
937173003 2:119895810-119895832 TGGAGGCTGAGGAAGGAGAACGG + Intronic
937645527 2:124262138-124262160 TGGAGGCTGAGGTGGGAGAATGG + Intronic
937892760 2:126951935-126951957 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
937968896 2:127535084-127535106 TGGAGGTTGAGGAAGGAGAATGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938306750 2:130261848-130261870 TGCCTGGTGAGGAGGGAGAAGGG - Intergenic
939441477 2:142255926-142255948 TGGTGGGGCAGCAGAGAAAAGGG - Intergenic
939724204 2:145694911-145694933 TTCTGGGTCAGTTGGGAGAAAGG - Intergenic
939997954 2:148937744-148937766 TGGTGGGCTAGCAGGGAAAAGGG + Intronic
940258915 2:151760457-151760479 TGTTGGCTCAGCAGGTAGAAGGG + Intergenic
940651324 2:156443804-156443826 AGGTGGGTAAGTAGGGGGAAGGG - Intronic
941457778 2:165730597-165730619 AGGAGGCTAAGGAGGGAGAATGG + Intergenic
941503335 2:166308819-166308841 TGGAGGCTGAGGTGGGAGAATGG + Intronic
941592747 2:167440236-167440258 AGGAGGGTGAGGCGGGAGAATGG + Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
941805393 2:169707057-169707079 GGGTGGCTCAGGCAGGAGAATGG + Intronic
942535782 2:176961895-176961917 GGGTGGCCCAGGAGGGAGGAGGG + Intergenic
942644579 2:178096266-178096288 TGGAGGCTGAGGCGGGAGAATGG - Intronic
942883352 2:180891509-180891531 TGGAGAGTCAGAAGGGAGGAAGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
945846246 2:214948499-214948521 TGGTGGGGCAGGGGGGACAGTGG + Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946174429 2:217913743-217913765 TGGAGTGGCTGGAGGGAGAAGGG - Intronic
946179628 2:217941774-217941796 TGGTGGGTCAGCAGGAGGATGGG - Intronic
946357009 2:219193672-219193694 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
947044931 2:225970986-225971008 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
947154692 2:227150423-227150445 TGGAGTGTCACTAGGGAGAAGGG - Intronic
947224042 2:227822941-227822963 TGGTGGGAGAGGAGTGAGAGAGG + Intergenic
947316205 2:228861964-228861986 TGGCGGGGCAGGAGGGTAAATGG + Intronic
947454122 2:230237462-230237484 AGGTGGGGCAGGAGAGAGAATGG + Intronic
947503199 2:230686538-230686560 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
947523904 2:230867013-230867035 TGCTGGGTGAGGGGGAAGAAAGG - Intronic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
948142982 2:235688004-235688026 TGGAGGCTGAGGCGGGAGAATGG - Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948960252 2:241329228-241329250 TGGAGGCTGAGGTGGGAGAATGG - Intronic
1168863156 20:1060688-1060710 TGGGGTGACAGGTGGGAGAATGG - Intergenic
1168876000 20:1172692-1172714 TGGTGGGTGAGGGGGAGGAAGGG + Intronic
1169217094 20:3800238-3800260 TGATGGGTGCGGAGGGAGCATGG + Intronic
1169228197 20:3869275-3869297 TGGAGGCTGAGGCGGGAGAATGG - Exonic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1170148837 20:13206562-13206584 TGGTGAGACAGGAGGGAGGAAGG + Intergenic
1170335860 20:15269390-15269412 TGGTGGGTCAGCAAGGTGAAGGG - Intronic
1170349631 20:15424613-15424635 AGGAGGCTGAGGAGGGAGAATGG + Intronic
1170598576 20:17823605-17823627 AGGAGGGGGAGGAGGGAGAAGGG - Intergenic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170904406 20:20499704-20499726 TGCTGGGGCAGGAGAGGGAAAGG + Intronic
1171439216 20:25147615-25147637 TGTTGGGGCAGGAGGTAGAAAGG - Intergenic
1171460910 20:25297479-25297501 TGGTGGAAAGGGAGGGAGAATGG - Exonic
1172113985 20:32563061-32563083 TGGAGGGGAAGGAGGGTGAAGGG + Intronic
1172115370 20:32570506-32570528 TGTGGGGACAGGAGGGGGAAGGG - Intronic
1172134165 20:32675974-32675996 TGGTGGGGAAGGTGGGGGAATGG - Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172800734 20:37574421-37574443 TGGGGAGTCAGGACTGAGAAGGG + Intergenic
1173016272 20:39228736-39228758 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1173143175 20:40502616-40502638 TGCTGGGTGAGGAAGGAGGAGGG - Intergenic
1173149060 20:40550403-40550425 TCGTGGGTGAGGAGAGGGAAGGG - Intergenic
1173291192 20:41716718-41716740 TGGAGGCTCAGGAGGGCCAATGG + Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1173911776 20:46675871-46675893 AGGGTGGTCAGGAGGGGGAACGG + Intronic
1175327606 20:58140624-58140646 TGGAGGCTCTGGAGGGAGCACGG - Intergenic
1175517815 20:59579890-59579912 TGGTCGGGGAGGAGGGAGACTGG + Intronic
1175551251 20:59819425-59819447 GGGAGGCTCAGGAGGGAGAGAGG + Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176070280 20:63222626-63222648 AGGTGGGACAGGAATGAGAATGG + Intergenic
1176210804 20:63920361-63920383 TGGTGGGTGTGGTGGGGGAAGGG + Intronic
1177613857 21:23490774-23490796 TGGAGGCTGAGGACGGAGAATGG + Intergenic
1177778860 21:25601001-25601023 GGGAGGGTGAGGCGGGAGAATGG + Intronic
1178144475 21:29722449-29722471 AGGTGGGTGAGGCAGGAGAATGG + Intronic
1178248008 21:30972750-30972772 TGGTGGGGCAGGAAGCAGAGTGG + Intergenic
1178294116 21:31394584-31394606 AGGTGGGCCAGGAGTGAGAGAGG + Intronic
1178351395 21:31874585-31874607 TGGTGGGTGATGAGGGGGCAGGG - Intronic
1178514562 21:33235819-33235841 TGGAGGCTCAGGCAGGAGAATGG + Intronic
1178941880 21:36913408-36913430 GGGTGGGGTAGGAGGGAGAAGGG + Intronic
1179176800 21:39013853-39013875 TGGTGGCTGAGGCAGGAGAATGG - Intergenic
1179287620 21:39991533-39991555 TGGTATCTCAGGAGGGAGAGAGG + Intergenic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179556675 21:42182987-42183009 TGGAGGGTCAGGAGTGAGGTGGG - Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1179958018 21:44751875-44751897 TGGAGGGGGCGGAGGGAGAAAGG - Intergenic
1180050049 21:45326934-45326956 GGGTGGGACAGGAGGGAGAGAGG - Intergenic
1180837428 22:18937141-18937163 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
1180947413 22:19704127-19704149 GGGTGGGGCAGGAAGGAGGAAGG + Intergenic
1181614634 22:24045022-24045044 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1181618005 22:24068189-24068211 TGGGGAAGCAGGAGGGAGAAGGG + Intronic
1181685564 22:24525443-24525465 TGCTGAGGCAGGATGGAGAAGGG - Intronic
1182815233 22:33156318-33156340 TGGTGGGGCAGAATGGGGAAAGG + Intergenic
1182825344 22:33260190-33260212 GGGTGGGTCAGGAGGCAGGGGGG - Intronic
1182876361 22:33694708-33694730 TGGAGAGACAGGAGGGGGAAGGG + Intronic
1183038970 22:35161903-35161925 TGGAGGCTTAGGAGGCAGAATGG - Intergenic
1183042953 22:35196985-35197007 TGGTGGGGCAGGAAGAAAAAAGG + Intergenic
1183176738 22:36229937-36229959 TGGTAGGTCAGGAGGCAGTAAGG - Intronic
1183179022 22:36246031-36246053 TGGTAGGTCAGGAGGCAGTAAGG + Intergenic
1183181492 22:36263156-36263178 TGGTAGGTCAGGAGGCAGTAAGG + Intronic
1183281738 22:36935986-36936008 TGGGGTGTCAGGAGGCAGAAGGG + Intronic
1183456946 22:37928010-37928032 TGGGGGCTCAGGCAGGAGAATGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185008204 22:48298199-48298221 GGGTGGGGCAGGGGAGAGAAGGG + Intergenic
1185324086 22:50217181-50217203 TGGAGGATCAGGAGGGTGAGAGG - Intronic
1185380928 22:50507296-50507318 TGGTGGGACAGGTAGGAGATCGG - Intronic
1203287521 22_KI270734v1_random:162440-162462 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
949105108 3:194216-194238 TGATGGTTCAGGAGGGAGGGAGG + Intergenic
949487281 3:4552306-4552328 TGGTGTGTCAGGTGGGAGGTGGG - Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
950246910 3:11428982-11429004 TGGTGGAGCAGAAGGGAGCATGG + Intronic
950329902 3:12148007-12148029 AGGTGGCTGAGGCGGGAGAATGG + Intronic
950552723 3:13676384-13676406 TCGGGGGTCAGAAGGGAGAGGGG + Intergenic
950562997 3:13746577-13746599 TGGTGGGTCAGGAGCCCGCATGG + Intergenic
950623946 3:14230670-14230692 TGTGGGGTCAAGAGGGAAAACGG - Intergenic
950922183 3:16705673-16705695 TGGTGGTGGAGGTGGGAGAAGGG - Intergenic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951815638 3:26751044-26751066 TGGGGGCTCAGGATGGAGATTGG - Intergenic
952210109 3:31221985-31222007 TGTGGGGTCAGGAGTGAGAAGGG + Intergenic
952210561 3:31225483-31225505 TGTGGGGTCAGGAGTGAGAAGGG + Intergenic
952730524 3:36633514-36633536 TGGTGGGGCAGGCAGGTGAAAGG - Intergenic
953094379 3:39760353-39760375 TGGGGGGTCAGGGGGCATAAGGG - Intergenic
953887442 3:46723493-46723515 GGGAGGCTGAGGAGGGAGAATGG + Intronic
954432240 3:50477032-50477054 TGGAGGCTGAGGCGGGAGAATGG - Intronic
954678627 3:52329232-52329254 TGGTGGCCCAGGTGGGAGGAGGG + Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955080036 3:55649931-55649953 AGGTGGGCCAGGAGGCAGAGGGG + Intronic
955213776 3:56966504-56966526 TGGTGGGGAAGGAGGCAGAAAGG + Intronic
955455925 3:59121775-59121797 TGATGGGGCAGTAGGGAGAGTGG + Intergenic
955715549 3:61825747-61825769 AGGAGGATGAGGAGGGAGAATGG - Intronic
956337904 3:68185367-68185389 TGGTATGTAAGGAGGTAGAAGGG + Intronic
956946123 3:74225681-74225703 TGGAGGGTGAGGTAGGAGAATGG - Intergenic
958466974 3:94471315-94471337 TGGAGGGGCAGGAGTGAGACTGG + Intergenic
959027305 3:101254962-101254984 TGGTGGAGCAGGAGGGAGGTAGG - Intronic
959063882 3:101638453-101638475 TGGTGAGTCAGGTTGCAGAAAGG - Intergenic
959896916 3:111616429-111616451 TGGTGGGACAGGAAGCTGAAAGG + Intronic
960378538 3:116932411-116932433 GGGTGGGTGGGAAGGGAGAATGG - Intronic
961132230 3:124479826-124479848 GGGAGGCTGAGGAGGGAGAATGG - Intronic
961546017 3:127633882-127633904 TGGTGGGACAGGACAGAGATGGG + Intronic
961588638 3:127958116-127958138 GGGCGGTGCAGGAGGGAGAAGGG + Intronic
961845717 3:129761221-129761243 GGGAGGGTGAGGCGGGAGAATGG + Intronic
962056745 3:131880218-131880240 TGGAGGGTGAGGCAGGAGAATGG - Intronic
962109965 3:132434103-132434125 TGGAGGCTGAGGAAGGAGAATGG + Intronic
962237110 3:133716059-133716081 TGCAGTGTCAGGAGGGGGAAGGG - Intergenic
962476202 3:135757611-135757633 TGGTAGGTCATGAAGGAGATTGG + Intergenic
962518274 3:136173875-136173897 TGGTGGGTGAGAATGGAGTATGG - Intronic
962983193 3:140509026-140509048 TGGTGGGGCAAGAGGGAGACTGG + Intronic
963054702 3:141176172-141176194 TGGAGGCTGAGGAAGGAGAATGG + Intergenic
963787250 3:149547419-149547441 GGGAGGCTGAGGAGGGAGAATGG + Intronic
964694165 3:159488196-159488218 TGGTGGGGCAGGAGTGGGGATGG + Intronic
965785148 3:172327503-172327525 AGGGGGCTGAGGAGGGAGAATGG - Intronic
965822382 3:172697664-172697686 TGGAGGGAGAGGAGGGAGAAGGG + Intronic
966486653 3:180478652-180478674 TGGTGGCTCTGGAGGAAGACAGG + Intergenic
966865324 3:184255677-184255699 GGTAGGGTCAGGATGGAGAAGGG - Intronic
967284603 3:187856351-187856373 TGATGGTTCAGGAGGCTGAAAGG - Intergenic
967512379 3:190326559-190326581 GGGTTGGCCAAGAGGGAGAATGG + Intronic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
967759755 3:193210165-193210187 TGGTGGGATAGGAGGTAGAGTGG + Intergenic
967986719 3:195100673-195100695 TGGTGGACGAGGAGGGAGAAGGG - Intronic
968469919 4:775291-775313 TGGAGGGTGAGGTGGGAGTATGG - Intergenic
968832972 4:2942750-2942772 TGGAGGGGCAGGAGGGAGACAGG + Intronic
968956484 4:3722270-3722292 TGGAGGGTCAGGAGGGGGCGGGG + Intergenic
969130434 4:4987094-4987116 GGGTCAGTCAGGAGGCAGAAGGG - Intergenic
969207670 4:5659491-5659513 TGTTGGGACGGGAGGGAGGATGG + Intronic
969675301 4:8611231-8611253 TGGTGGGTCAGGCAGGCGAAGGG - Intronic
969677610 4:8622853-8622875 TGGTGGCTGAGGCAGGAGAATGG + Intergenic
969678565 4:8628494-8628516 TGGTGGCTGAGGCAGGAGAATGG + Intergenic
969679521 4:8634132-8634154 TGGTGGCTGAGGCAGGAGAATGG + Intergenic
970103582 4:12554552-12554574 GGGTGGGTCAGCACAGAGAATGG + Intergenic
970369769 4:15395081-15395103 TGGCTGGTCAGGGGGCAGAAGGG + Intronic
971093174 4:23369422-23369444 AGGTGGCTCAGGACGGAGACAGG - Intergenic
971946070 4:33279012-33279034 GGGAGGCTCAGGCGGGAGAATGG + Intergenic
973052529 4:45612492-45612514 TGGAGTGTCATGAGGGTGAAAGG - Intergenic
973909390 4:55564232-55564254 GGGTGGGTCAGTAGTGTGAATGG + Intronic
974038416 4:56837465-56837487 TGGAGGCTGAGGTGGGAGAATGG + Intergenic
974318443 4:60312355-60312377 TGGAGGCTGAGGAAGGAGAATGG - Intergenic
974980321 4:68948550-68948572 GGGAGGCTCAGGTGGGAGAACGG - Intronic
975246551 4:72127197-72127219 GGGAGGGTGAGGCGGGAGAATGG + Intronic
975310576 4:72898797-72898819 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
975379016 4:73677170-73677192 TGCTGGGTCTGGAGCCAGAAAGG + Intergenic
975530437 4:75394567-75394589 TGGTGGGTAGGGATGGAGAACGG + Intergenic
975873507 4:78808368-78808390 AGGAGGGTGAGGCGGGAGAATGG - Intronic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
976709076 4:88050077-88050099 AGGAGGCTGAGGAGGGAGAATGG - Intronic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977995198 4:103492630-103492652 TGGAGGGTGAGGCAGGAGAATGG + Intergenic
978234608 4:106443542-106443564 TGGAGGCTGAGGAGGGAGTATGG - Intergenic
978376730 4:108081816-108081838 TGGAGGGTAAGGAAGGGGAACGG - Intronic
978752206 4:112262207-112262229 TGGAGGCTGAGGTGGGAGAATGG + Intronic
979154670 4:117369305-117369327 AGGTGGGGCAGGAGGGGAAATGG - Intergenic
979548624 4:121964984-121965006 TGGGGAGAAAGGAGGGAGAATGG - Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980382290 4:132038398-132038420 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
981029312 4:140108117-140108139 TGGTGGGTTGGGAGGGATAGAGG - Intronic
981566170 4:146104057-146104079 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981992098 4:150933917-150933939 TGGAGGCTGAGGTGGGAGAATGG + Intronic
982186962 4:152812430-152812452 TGGGAGGCCAGGAGGGAGAATGG - Intronic
982211839 4:153043538-153043560 TGGTGGGGGAGAAGGGAGTAGGG + Intergenic
983218746 4:165024835-165024857 TGGAGGCTGAGGAAGGAGAATGG - Intergenic
984352086 4:178608412-178608434 TGGAGGCTGAGGAAGGAGAATGG - Intergenic
984567388 4:181347238-181347260 AGGTGGGTGAGGCAGGAGAATGG + Intergenic
984697614 4:182795185-182795207 TGCTGAATCAGGAGGCAGAAAGG - Intronic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271302 4:188197124-188197146 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271350 4:188197304-188197326 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271397 4:188197484-188197506 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271411 4:188197544-188197566 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
1202757656 4_GL000008v2_random:80613-80635 GGGAGGCTCAGGCGGGAGAATGG - Intergenic
985597880 5:806033-806055 AGGTGTGGCAGGTGGGAGAATGG + Intronic
986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG + Intergenic
987001837 5:13667759-13667781 TGGTTGGGCAAGAGAGAGAATGG + Intergenic
987302157 5:16606646-16606668 TGGTGGGTAGGGGGAGAGAAAGG - Intronic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
987643369 5:20639958-20639980 AGGAGGCTGAGGAGGGAGAACGG - Intergenic
988029124 5:25739507-25739529 TGGTGGGTCAGGAGGGTGGGCGG - Intergenic
988242265 5:28628958-28628980 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
988310000 5:29544223-29544245 TGCTGGGTCAGGAGACAGCAAGG - Intergenic
988677002 5:33442638-33442660 TGGTGGCTGAGGCAGGAGAATGG - Intronic
988994586 5:36702719-36702741 TGGAGCCTCTGGAGGGAGAATGG - Intergenic
989773455 5:45172952-45172974 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
990629046 5:57647715-57647737 TGGTGGAGCAGGAGAGAGATAGG + Intergenic
990725210 5:58745451-58745473 TGGTGGGTCAGAATGAAGAAAGG - Intronic
991371903 5:65926983-65927005 GGGGGGGGCAGGGGGGAGAAGGG - Intronic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
992079637 5:73222921-73222943 TGGTGGGTCAGGGAGGAGGAGGG + Intergenic
992159844 5:73990645-73990667 AGGGGAGTCAGCAGGGAGAAGGG - Intergenic
992473756 5:77082694-77082716 TGATGTGAAAGGAGGGAGAAGGG + Intronic
992784432 5:80156038-80156060 TGGGGGCTCTGGAGGGCGAAGGG + Intronic
993489943 5:88534839-88534861 TGGTGAGCAATGAGGGAGAAGGG - Intergenic
994968271 5:106702284-106702306 TGGAGGGTGAGGCAGGAGAATGG - Intergenic
994985848 5:106932752-106932774 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
995241095 5:109885672-109885694 AGGAGGCTCAGGCGGGAGAATGG + Intergenic
995311158 5:110713261-110713283 TGGTGGGACAGAAGTGAGGATGG + Intronic
995463256 5:112424495-112424517 AAGTGAGTCAGGAGGCAGAATGG - Intergenic
996174073 5:120332995-120333017 TGGTGGGTGGGGAGGGTTAATGG - Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996431365 5:123381958-123381980 TGGTGGCTCTGGATAGAGAAGGG - Intronic
996747660 5:126858817-126858839 TGGTGGGTCAGCAGGGAGGGCGG - Intergenic
997470020 5:134112483-134112505 GGGTGGGTGAGTAGGGAGAGTGG - Intergenic
997898395 5:137740689-137740711 TGGGGGGTCAGGGGGGATGATGG + Intergenic
997983918 5:138488727-138488749 TGGTGAGTCAGGAGACAGCAGGG + Intergenic
998132420 5:139658104-139658126 AGGTGGGTCAGGCAGGAGAGGGG - Intronic
999537001 5:152528676-152528698 TGGTGGATAAGGAGCCAGAAGGG + Intergenic
1000199786 5:158997061-158997083 TGGAGGATGAGGAGGGAGATTGG - Intronic
1000271581 5:159689316-159689338 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1000532286 5:162438255-162438277 TGGGGGCTGAGGCGGGAGAATGG - Intergenic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001279208 5:170374295-170374317 TGAGGGGTAGGGAGGGAGAATGG + Intronic
1001350366 5:170956963-170956985 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1001582538 5:172808657-172808679 TGGTGGCTGAGGCAGGAGAATGG - Intergenic
1001806515 5:174591374-174591396 TGCTGGGGAGGGAGGGAGAAAGG - Intergenic
1001808157 5:174606759-174606781 TGGTGGATCCAGAGGGAGAGTGG - Intergenic
1002076966 5:176714081-176714103 TAGTGAGACAGAAGGGAGAAAGG + Intergenic
1002278131 5:178116143-178116165 TGGTGGGGGAGGAGGGAGGGAGG - Intronic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1002453232 5:179331396-179331418 TGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002588349 5:180267965-180267987 AGGAGGGTGAGGTGGGAGAATGG - Intronic
1002664690 5:180814465-180814487 TGGTGGGTAAAGAGAGAAAAGGG - Intronic
1003408635 6:5843946-5843968 TGGTGGCTGAGGAGGAAGACAGG + Intergenic
1003518468 6:6837119-6837141 GGGTGGGGTAGGAGGGAGAGGGG + Intergenic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1003873453 6:10418731-10418753 TGGTGGGTGAGGAGGCAGGGGGG - Intronic
1004644176 6:17543514-17543536 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1006102538 6:31694493-31694515 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1006261613 6:32878512-32878534 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006299884 6:33188081-33188103 GGGTGGGTGAGGAGAGAGAGGGG + Intronic
1006380618 6:33695147-33695169 GGGTGGGTCAGGAAGGATGAAGG - Intronic
1006448052 6:34090926-34090948 GGGTCTGCCAGGAGGGAGAAGGG + Intronic
1006727705 6:36211591-36211613 TGGAGGGTAAAGAGGGACAAAGG + Intronic
1007298302 6:40845693-40845715 TGGTGGGAGAGGAGGGAGAGAGG + Intergenic
1007614841 6:43173823-43173845 TGAGGGGTGAGGAGGGAGATGGG - Intronic
1007768742 6:44176997-44177019 TGGTGGGTGAGGGGTGAGAGGGG + Exonic
1008160472 6:48069156-48069178 GGGGGGGAGAGGAGGGAGAAGGG + Intergenic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1008366058 6:50681932-50681954 TAGTGGTTCAGGAGAGAGTAAGG - Intergenic
1008408442 6:51144997-51145019 TGTTGGGTGAAGAGGGAGAGAGG + Intergenic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1008962126 6:57276782-57276804 GGGGGGCTCAGGTGGGAGAATGG + Intergenic
1009042730 6:58199474-58199496 TTGAGAGTCAGGAGGGAGAGAGG + Intergenic
1009710641 6:67314069-67314091 CGGTGGCTGAGGCGGGAGAATGG - Intergenic
1009772106 6:68156937-68156959 TGGTGGGTCAGGACTAAGTAGGG - Intergenic
1010351384 6:74879042-74879064 TCATGTGTCAGGAAGGAGAATGG - Intergenic
1010447780 6:75967342-75967364 TGGTGGGTTGGGGGTGAGAAGGG + Intronic
1011197887 6:84800990-84801012 TGGTAGGTGAGCATGGAGAAGGG + Intergenic
1011325959 6:86150341-86150363 TGGAGGGGCAGGAGTGAGACTGG + Intergenic
1011675986 6:89734553-89734575 GGGAGGGTGAGGTGGGAGAATGG + Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1012164318 6:95929558-95929580 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1012236297 6:96819869-96819891 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1012943928 6:105446542-105446564 TGATGGGGGAGGAGGGAGGAAGG - Intergenic
1013105065 6:107020026-107020048 AGGAGGGTAAGGAAGGAGAATGG + Intergenic
1013180638 6:107714337-107714359 GGGAGGGTCAGTAGGGAGGAGGG - Intronic
1013193623 6:107825830-107825852 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1013429878 6:110046003-110046025 TCGTGGCTCAGGAGGCACAATGG - Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1013900368 6:115148497-115148519 AGGTGTGGCAGGAGGGAGAAAGG + Intergenic
1013918321 6:115368078-115368100 TGGTTTGTCAGAAGGGAGATTGG - Intergenic
1014729088 6:125009617-125009639 AGGAAGGGCAGGAGGGAGAAAGG - Intronic
1014735939 6:125096466-125096488 TGGAGGCTCAGGCAGGAGAATGG - Intergenic
1014999789 6:128200863-128200885 GGGAGGGTGAGGAGGAAGAAGGG + Intronic
1015602933 6:134928130-134928152 CGGTAGGTCAGGAGAGAGAAAGG - Intronic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1015961578 6:138655372-138655394 TGCTGGGTCAAGCGGGAGAGCGG - Intronic
1015973163 6:138762955-138762977 TGGGGGGTCAGGAGGGGCAAGGG - Intronic
1016100826 6:140098015-140098037 TGTTGGGGAAGGAGGGAGCAAGG - Intergenic
1016367978 6:143339504-143339526 GGGTGTGTCAGGAGGGTGAATGG + Intronic
1016497605 6:144682129-144682151 TGGTGGGGCAGGGGGGTGATGGG - Intronic
1016519755 6:144933634-144933656 TGCTGGGGCAGGAGGGAGGATGG - Intergenic
1016746091 6:147581834-147581856 TGGTGGGGCAGGAGGATGAGAGG + Intronic
1016935766 6:149448541-149448563 TGGTGGGGGAGGAGGGGGCAGGG - Intronic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1016995574 6:149960573-149960595 TGGGGGGTCAGGAGGAAGGGAGG - Intergenic
1016998636 6:149979248-149979270 AGAGGAGTCAGGAGGGAGAAGGG - Intergenic
1016999754 6:149988562-149988584 AGAAGAGTCAGGAGGGAGAAGGG + Intergenic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017006862 6:150033712-150033734 AGAAGAGTCAGGAGGGAGAAGGG - Intergenic
1017016659 6:150106460-150106482 GGGAGGGTCAGGCAGGAGAATGG + Intergenic
1018816860 6:167339578-167339600 TGATGGGTCAGGTGGGTGCATGG + Intronic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019134974 6:169902324-169902346 TGGTGGGTGATGATGGGGAATGG + Intergenic
1019148417 6:169988470-169988492 GGGTGGGTCCGGAGGGACAGTGG + Intergenic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019936781 7:4262935-4262957 TGGTGGGTGATGAGGTAGAAGGG - Intronic
1019936836 7:4263070-4263092 TGGGGGGTGATGAGGTAGAAGGG - Intronic
1020243172 7:6410987-6411009 TGGTGGCTGAGGCAGGAGAATGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021008895 7:15437637-15437659 GGGAGGGTGAGGCGGGAGAATGG - Intronic
1021110198 7:16685120-16685142 AGGAGAGTCAGGAGAGAGAAGGG + Intronic
1021352280 7:19609903-19609925 AGGAAGGTCAGGAGGGAGGAAGG - Intergenic
1021455481 7:20825463-20825485 TGGAGGCTGAGGTGGGAGAATGG + Intergenic
1021587366 7:22223582-22223604 TGATGATGCAGGAGGGAGAAGGG + Intronic
1021686405 7:23191292-23191314 TGCTGTGTGAGGGGGGAGAAAGG + Intronic
1021807969 7:24375514-24375536 GGGTGGATCAGGAGGCAGAGGGG - Intergenic
1022028816 7:26473115-26473137 GGGTGGGCCAGGAGGAAGGAGGG - Intergenic
1022092076 7:27114130-27114152 GGGAGGGACCGGAGGGAGAAGGG + Intronic
1023098360 7:36686845-36686867 TGGAGGGACAGGAGAAAGAAAGG + Intronic
1023436358 7:40144169-40144191 AGGAGAGTCAGGAGGGAGAGAGG + Intronic
1023623737 7:42096629-42096651 TGGAGGGTCAGGAGTCTGAAGGG - Intronic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024041267 7:45557862-45557884 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
1024083841 7:45877584-45877606 TGGTGGAGCAGGAGAGAGAGAGG + Intergenic
1024288532 7:47782126-47782148 TGGTGGGTCAGAGTGGAGAGGGG - Intronic
1024344208 7:48296562-48296584 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1024615672 7:51109502-51109524 TGGGGGGCAAGGAGGGAGATGGG - Intronic
1025184364 7:56845633-56845655 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1025192580 7:56907317-56907339 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
1025215307 7:57051125-57051147 TGGAGGCTCAGGTAGGAGAATGG + Intergenic
1025656641 7:63525705-63525727 TGGAGGCTCAGGTAGGAGAATGG - Intergenic
1025679365 7:63669603-63669625 TGGAGGCTGAGGTGGGAGAATGG + Intergenic
1025687564 7:63731335-63731357 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1025953417 7:66163956-66163978 AGGAGGCTCAGGTGGGAGAATGG + Intergenic
1025976141 7:66371552-66371574 GGGAGGGAAAGGAGGGAGAAAGG + Intronic
1026654770 7:72247350-72247372 TGGAGGGTGAGGCAGGAGAATGG - Intronic
1026776103 7:73231915-73231937 TGGTGGGTCATCAGGTAGGAGGG + Intergenic
1027005099 7:74685946-74685968 TGGAGGCTGAGGTGGGAGAATGG + Intronic
1027016960 7:74785286-74785308 TGGTGGGTCATCAGGTAGGAGGG + Exonic
1027071067 7:75160650-75160672 TGGTGGGTCATCAGGTAGGAGGG - Intergenic
1028408009 7:90497457-90497479 GGGAGGCTGAGGAGGGAGAATGG + Intronic
1028451751 7:90993029-90993051 TGATAGTTCAGAAGGGAGAAGGG + Intronic
1028711981 7:93919983-93920005 CGGAGGCTCAGGCGGGAGAATGG + Intergenic
1029282433 7:99444687-99444709 TGGTGGGTCAGAGGTCAGAAGGG + Intronic
1029339073 7:99928564-99928586 TGGAAGTTCAGGAGGGACAACGG + Intronic
1029674667 7:102060171-102060193 GGGAGGCTCAGGCGGGAGAATGG + Intronic
1029713470 7:102312783-102312805 TGGTGAGGCAGGAGGGTCAATGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029801195 7:102949222-102949244 TAGTGGGGCAGGAGAGACAATGG + Intronic
1030183492 7:106735785-106735807 TTGTGGGTCAGAAGGGAGTGAGG - Intergenic
1030192547 7:106824016-106824038 TAGTGGGTCAATAGGGATAATGG + Intergenic
1030231338 7:107210802-107210824 TGGTGGGTCAGCAAAGAAAATGG + Intronic
1030862902 7:114658814-114658836 AGGTGGGGGAGAAGGGAGAAGGG - Intronic
1031050429 7:116939317-116939339 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1031089535 7:117337692-117337714 GGGTGGGGTAGGATGGAGAAAGG + Intergenic
1031992297 7:128206364-128206386 AGGTGGGGCAGGAGGGAGTTAGG + Intergenic
1032011289 7:128349845-128349867 TGGTGGGTGAAAAGGTAGAAAGG + Intergenic
1032035353 7:128517400-128517422 TGGAGGGGCTGGAGGGGGAAAGG + Intergenic
1032092899 7:128920540-128920562 TGAGGGGGCAGGAGGGAGAATGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1033035208 7:137868979-137869001 GGGAGGCTGAGGAGGGAGAATGG + Intergenic
1033168072 7:139058507-139058529 TGGTGGGGAGGGAGGGGGAAGGG + Intronic
1033195956 7:139327497-139327519 TGTTGTGTCAGAAGGCAGAAGGG + Intergenic
1033630088 7:143148992-143149014 GGGTGTCCCAGGAGGGAGAATGG - Intergenic
1033952063 7:146797029-146797051 TGGTGGCTGAGGCAGGAGAATGG + Intronic
1034029646 7:147746513-147746535 TGATGGGGTAGAAGGGAGAAAGG - Intronic
1034607371 7:152329661-152329683 TGGAGGGGAAGGAGGGAGAAAGG + Intronic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035252679 7:157607487-157607509 AGCAGGGTCAGGAGGGAGCAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035960977 8:4137980-4138002 TGGAGGCTGAGGCGGGAGAATGG - Intronic
1036612525 8:10362639-10362661 TGGTGGGGGAGCAGGGACAACGG - Intronic
1037569734 8:20148106-20148128 AGATGGGTCAGGTGGGAGCAAGG + Intronic
1037755759 8:21709215-21709237 TGGTGGGTCAGGAGAGAGCTGGG - Intronic
1037884581 8:22589419-22589441 GGGAGGGGCAGGAGGGAGACGGG + Intronic
1037948226 8:23002727-23002749 GGGAGGGTTAGGAGAGAGAAGGG + Intronic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038201403 8:25416326-25416348 TGGTGGGTCAAGTTGGAGAGAGG + Intronic
1038216664 8:25567859-25567881 TCTTGGGTCAGGAGGCAGCAGGG - Intergenic
1038427038 8:27470321-27470343 TGGCGGGGCTGCAGGGAGAAGGG + Intronic
1038503602 8:28065263-28065285 TGGGGAGTCAGGCAGGAGAATGG - Intronic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1038948838 8:32391500-32391522 TGGAGGGTCAGGGTGGAGAGAGG - Intronic
1039155715 8:34554335-34554357 TGATGGGTCCCAAGGGAGAAAGG - Intergenic
1039252771 8:35684768-35684790 TGGTGGATCAGAAGGGAAAAGGG - Intronic
1039465020 8:37778827-37778849 TGGTGGCTGAGGTGGAAGAATGG + Exonic
1039500344 8:38011655-38011677 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1039527056 8:38226275-38226297 TAGTGGGTCACTAGGGATAATGG + Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040951389 8:52941213-52941235 GGGTGGGGCAGCAGGGAGCAGGG - Intergenic
1041881176 8:62751214-62751236 AGGTGGGGTAGGAGGGAGAAGGG - Intronic
1042316833 8:67434864-67434886 TGGGGGGTCAGGAGGGGTAAGGG - Intronic
1043190902 8:77222014-77222036 GGGTGGCTGAGGTGGGAGAATGG - Intergenic
1043263241 8:78228265-78228287 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1044593056 8:93932355-93932377 TGGTGGGTGATGAGGTGGAAAGG + Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045330927 8:101155092-101155114 TGGTGCCTCATGGGGGAGAAGGG - Intergenic
1045432775 8:102128708-102128730 GGGTTGGTCAGGAGGCAGTATGG + Intergenic
1046857298 8:119047521-119047543 TTATGGGTCAGGAAGTAGAAAGG + Intronic
1047055266 8:121157020-121157042 TGGAGGCTGAGGAAGGAGAATGG + Intergenic
1047429082 8:124775348-124775370 GGGAGGCTGAGGAGGGAGAATGG - Intergenic
1047544549 8:125803064-125803086 TGGTGGGGGAGGATGGAGCAGGG + Intergenic
1047600872 8:126424801-126424823 AGATGGGCCAGGATGGAGAAGGG - Intergenic
1047717591 8:127609992-127610014 AGGGTGGTCAGGAGGGAGAAGGG - Intergenic
1048060359 8:130913320-130913342 TGGGGGGTTAGGAGGGAGGTGGG - Intronic
1048145921 8:131843203-131843225 AGATGGGTCAGGATAGAGAATGG + Intergenic
1048521614 8:135160488-135160510 TGGTGGGACAGGATGGTGCAAGG + Intergenic
1048636458 8:136301134-136301156 GTGTGGGTCAGAAGGCAGAAGGG + Intergenic
1048687105 8:136917048-136917070 TGGTGCCTCAGGAGGGTGTATGG + Intergenic
1048747349 8:137629385-137629407 TGGAGGGTGAGGCAGGAGAATGG + Intergenic
1049076544 8:140400847-140400869 TGGAGGCTTGGGAGGGAGAAGGG - Intronic
1049156213 8:141068285-141068307 TGGTGGAACAGAAGGGAAAAAGG + Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049428593 8:142549006-142549028 TGGTCAGTCAGGATGGAGAAGGG - Intergenic
1049571251 8:143371264-143371286 TGGTGGGTCAGGTGGGTGCTGGG + Intronic
1049627549 8:143632561-143632583 GGGTGGGGCAGGTGGGAGAAAGG - Intergenic
1049869952 8:144966713-144966735 TGGAGGCTGAGGAAGGAGAATGG + Intergenic
1049938049 9:518374-518396 TGGGGGTCAAGGAGGGAGAAGGG - Intronic
1050061963 9:1718852-1718874 TGGGAAGTCTGGAGGGAGAAAGG - Intergenic
1050472667 9:6008354-6008376 TGGGCGGTGAGGGGGGAGAAAGG + Intergenic
1051105015 9:13569515-13569537 GGCTGGGGCTGGAGGGAGAAAGG - Intergenic
1051998009 9:23242708-23242730 AGTAGGGCCAGGAGGGAGAAGGG + Intergenic
1052214073 9:25944444-25944466 TGGAGGCTGAGGTGGGAGAATGG - Intergenic
1052460322 9:28754733-28754755 TGGAGGCTGAGGAAGGAGAATGG - Intergenic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1053420808 9:37976482-37976504 TGGGGGCTGAGGAGGGATAATGG - Intronic
1053449325 9:38180005-38180027 TGCTGGGCCAGCAGGGAGATGGG + Intergenic
1053525183 9:38822896-38822918 TGGAGGGTGAGGCAGGAGAATGG - Intergenic
1054197413 9:62047344-62047366 TGGAGGGTGAGGCAGGAGAATGG - Intergenic
1054640997 9:67541358-67541380 TGGAGGGTGAGGCAGGAGAATGG + Intergenic
1056287696 9:85107977-85107999 TGGTGACACAGGAGGGAGGATGG + Intergenic
1056811210 9:89765447-89765469 TGGTCGGGGAGGAGGGAGTAAGG + Intergenic
1056883387 9:90417780-90417802 TGGGGGGTATGGAGAGAGAATGG - Intergenic
1057480341 9:95440479-95440501 GGGAGGGGAAGGAGGGAGAAGGG + Intergenic
1058525850 9:105857144-105857166 TGGTGTGAAAGGAGGCAGAAGGG - Intergenic
1058841293 9:108912071-108912093 TGGTGGGGGAGGGGGGACAATGG + Intronic
1058930552 9:109714819-109714841 TGGTGGATGAGGAGGAATAACGG + Intronic
1058945714 9:109854139-109854161 TGGTGGTTCAGCAGGGAACAAGG - Intronic
1059444191 9:114328048-114328070 TGTTGGGACAGGAGGTACAAAGG - Intergenic
1059445400 9:114334827-114334849 TGTTGGGACAGGAGGTACAAAGG - Exonic
1059592637 9:115678720-115678742 TAGTGGGTCACTAGGGATAATGG - Intergenic
1059618738 9:115979749-115979771 TGGAGGCTGAGGTGGGAGAATGG + Intergenic
1059777363 9:117488914-117488936 TGATGGGGCAGGAAGGAGGAAGG + Intergenic
1060185980 9:121564530-121564552 TGGGGGTTGAGGAGGCAGAAGGG - Intergenic
1060202123 9:121657360-121657382 GGGTGGGTCAGGAAGGACAAAGG - Intronic
1060214835 9:121732499-121732521 TGGCTGGTCTGGAGGGAGAAGGG + Intronic
1060437322 9:123605193-123605215 GGGATGGTCAGGAAGGAGAAGGG - Intronic
1060765350 9:126291643-126291665 AGAAGGATCAGGAGGGAGAAAGG - Intergenic
1060917279 9:127398617-127398639 GCCTGGGTCAGGAGGGGGAAAGG - Intronic
1061056386 9:128224994-128225016 TGGTGGGGCAGATGGGAGAAGGG - Intronic
1061176424 9:129000421-129000443 GGGTGGCTGAGGTGGGAGAATGG - Intronic
1061448655 9:130656532-130656554 AGATGGGTCAGGAGGGACCACGG + Intergenic
1061750348 9:132772740-132772762 TGCTGGGGCAGCAGGAAGAATGG - Intronic
1061803544 9:133126158-133126180 AGCTGGGGCAGGAGGGAGGAAGG - Intronic
1062533916 9:137013377-137013399 TGGTGGGCCAGGCGGGCGAGGGG - Intronic
1062549543 9:137079583-137079605 TGATGGGTCGGGGTGGAGAATGG + Intronic
1062695498 9:137873744-137873766 TGGAGGGTCCGGAGGAAGATGGG + Intergenic
1203489918 Un_GL000224v1:95009-95031 GGTTGAGGCAGGAGGGAGAATGG + Intergenic
1203502541 Un_KI270741v1:36895-36917 GGTTGAGGCAGGAGGGAGAATGG + Intergenic
1203538447 Un_KI270743v1:65477-65499 GGGAGGCTCAGGTGGGAGAATGG - Intergenic
1185818417 X:3178962-3178984 GGGAGGCTAAGGAGGGAGAATGG + Intergenic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186267270 X:7844538-7844560 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186297720 X:8169113-8169135 TGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186325139 X:8467358-8467380 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1187019534 X:15366109-15366131 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1187065341 X:15830246-15830268 TTGTGGGGCAGGAGGAGGAAAGG + Intronic
1187690630 X:21862704-21862726 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1189242061 X:39532972-39532994 TGCTAGCTCAAGAGGGAGAAGGG - Intergenic
1189418824 X:40837401-40837423 TGGAGGCTGAGGCGGGAGAATGG + Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1189976278 X:46463579-46463601 TGGTGGGAGAGGAATGAGAAGGG - Intronic
1191754495 X:64579822-64579844 TAGTGAGTCAGGAAAGAGAAGGG + Intergenic
1191837944 X:65485356-65485378 TGGAGGCTGAGGTGGGAGAATGG - Intronic
1192170703 X:68852760-68852782 TGGTGGGTCAGCAGAGAGCTCGG - Intergenic
1192845009 X:74897535-74897557 TGGAGGGTAAGGAGAGTGAAAGG + Intronic
1193483751 X:82060289-82060311 TGGTGGGGCAGTAGGGAAAAGGG - Intergenic
1194719468 X:97323484-97323506 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1194746240 X:97631375-97631397 TAGAGGGTCAGGAAGGAGTAGGG + Intergenic
1195042440 X:101026822-101026844 TGATGGTGCAGGAGAGAGAAGGG - Intronic
1195676852 X:107513165-107513187 TAGCAGGTCAGGAGGGAGCAGGG - Intergenic
1196385191 X:115141131-115141153 TGGAGGCTGAGGCGGGAGAATGG + Intronic
1197062669 X:122199751-122199773 TAGTGGGTCACTAGGGATAATGG + Intergenic
1197402262 X:126006394-126006416 TGGAGCGTCTGGAGGGAGCAGGG + Intergenic
1197537042 X:127702905-127702927 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1197894178 X:131293084-131293106 TGGTGGGGCAGGGGTGGGAATGG + Intronic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199250687 X:145658713-145658735 TGGAGGGTTCGGAAGGAGAAAGG + Intergenic
1199324466 X:146481138-146481160 TGGAGGGTTGGGTGGGAGAATGG - Intergenic
1199592839 X:149483807-149483829 TGCTGGGTGAGGATGGAGAAAGG - Intronic
1199925360 X:152457368-152457390 TGGAGGCTGAGGCGGGAGAATGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200266516 X:154649128-154649150 AGGTTGGTGAGGAGGGGGAATGG - Intergenic
1201308890 Y:12576722-12576744 AGGAGAGTCAGGAGGGAGAGCGG - Intergenic
1201438423 Y:13984918-13984940 TGGTGTGTTGGGAGGGAGAGAGG - Intergenic
1201438475 Y:13985100-13985122 TGGTGGGTCGGGAGGCAGGGAGG - Intergenic
1201438500 Y:13985183-13985205 TGGTGTGTGGGGAGGGAGACAGG - Intergenic
1201438511 Y:13985216-13985238 AGGTGTGTCAGGAGGGAGACAGG - Intergenic
1201438553 Y:13985362-13985384 TGGTGGGTGGGGAGGGAGTGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201446020 Y:14057346-14057368 TGGTGGGTGGGGAGGGAGTGAGG + Intergenic
1201446062 Y:14057492-14057514 AGGTGTGTCAGGAGGGAGACAGG + Intergenic
1201446073 Y:14057525-14057547 TGGTGTGTGGGGAGGGAGACAGG + Intergenic
1201446098 Y:14057608-14057630 TGGTGGGTCGGGAGGCAGGGAGG + Intergenic
1201446150 Y:14057790-14057812 TGGTGTGTTGGGAGGGAGAGAGG + Intergenic
1202134316 Y:21646138-21646160 TGGAGGCTAAGGAGGGAGAATGG - Intergenic