ID: 1019891339

View in Genome Browser
Species Human (GRCh38)
Location 7:3949496-3949518
Sequence TCCTCCGCTGCCGCTCACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019891331_1019891339 21 Left 1019891331 7:3949452-3949474 CCCCACCGCCAGCCGGGCAGGCT 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891334_1019891339 16 Left 1019891334 7:3949457-3949479 CCGCCAGCCGGGCAGGCTAGAAC No data
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891329_1019891339 26 Left 1019891329 7:3949447-3949469 CCTCACCCCACCGCCAGCCGGGC 0: 1
1: 0
2: 8
3: 68
4: 595
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891333_1019891339 19 Left 1019891333 7:3949454-3949476 CCACCGCCAGCCGGGCAGGCTAG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891327_1019891339 27 Left 1019891327 7:3949446-3949468 CCCTCACCCCACCGCCAGCCGGG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891337_1019891339 -6 Left 1019891337 7:3949479-3949501 CCTTTCAGTTGCCAGAATCCTCC No data
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891335_1019891339 13 Left 1019891335 7:3949460-3949482 CCAGCCGGGCAGGCTAGAACCTT No data
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891332_1019891339 20 Left 1019891332 7:3949453-3949475 CCCACCGCCAGCCGGGCAGGCTA No data
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data
1019891336_1019891339 9 Left 1019891336 7:3949464-3949486 CCGGGCAGGCTAGAACCTTTCAG No data
Right 1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019891339 Original CRISPR TCCTCCGCTGCCGCTCACGA TGG Intronic