ID: 1019892116

View in Genome Browser
Species Human (GRCh38)
Location 7:3955136-3955158
Sequence CTCGGACGGCGAGTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019892106_1019892116 28 Left 1019892106 7:3955085-3955107 CCAGCTGCTCCCACATGTGCCCT 0: 1
1: 0
2: 3
3: 37
4: 427
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1019892108_1019892116 18 Left 1019892108 7:3955095-3955117 CCACATGTGCCCTGCTCCTGCTG 0: 1
1: 0
2: 5
3: 44
4: 487
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1019892107_1019892116 19 Left 1019892107 7:3955094-3955116 CCCACATGTGCCCTGCTCCTGCT 0: 1
1: 0
2: 4
3: 32
4: 420
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1019892113_1019892116 2 Left 1019892113 7:3955111-3955133 CCTGCTGAGCACGATGGCTCGGA 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1019892110_1019892116 8 Left 1019892110 7:3955105-3955127 CCTGCTCCTGCTGAGCACGATGG 0: 1
1: 0
2: 1
3: 18
4: 141
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1019892109_1019892116 9 Left 1019892109 7:3955104-3955126 CCCTGCTCCTGCTGAGCACGATG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019892116 Original CRISPR CTCGGACGGCGAGTTTTCAC TGG Intronic
912196303 1:107401193-107401215 ATCGGATGGCGGATTTTCACAGG + Intronic
1073342014 10:102752362-102752384 CTTGGACAGCGAGTTTTCGGTGG + Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1094720085 12:33054063-33054085 CTCTGACGGCGGATTTTCACTGG - Intergenic
1139775643 16:69315523-69315545 CCCGGACTGCAAGTTTGCACAGG - Intronic
1152506657 17:80753887-80753909 CTCAGGCTGTGAGTTTTCACTGG - Intronic
1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG + Intronic
1031468727 7:122144459-122144481 CTGGGACGTCGAGTTCTCCCAGG + Intergenic
1031735906 7:125361191-125361213 CTCAGACACTGAGTTTTCACAGG - Intergenic
1032255483 7:130293800-130293822 CTGGGACGTGGAGATTTCACAGG + Intronic
1042722933 8:71844035-71844057 CTCTGCCGACGAGTTGTCACTGG + Exonic
1062111814 9:134785991-134786013 CTGGGACTCCGAGTTTTCCCTGG - Exonic