ID: 1019896456

View in Genome Browser
Species Human (GRCh38)
Location 7:3987245-3987267
Sequence CCGTGGTGCTCTCTTGGGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019896444_1019896456 20 Left 1019896444 7:3987202-3987224 CCTCAGAACCTCCTGGTCAGCCC 0: 1
1: 0
2: 4
3: 25
4: 243
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019896447_1019896456 0 Left 1019896447 7:3987222-3987244 CCCTAATTCTTCCCACAGCCACG 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019896448_1019896456 -1 Left 1019896448 7:3987223-3987245 CCTAATTCTTCCCACAGCCACGC 0: 1
1: 0
2: 0
3: 17
4: 158
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019896446_1019896456 9 Left 1019896446 7:3987213-3987235 CCTGGTCAGCCCTAATTCTTCCC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019896442_1019896456 29 Left 1019896442 7:3987193-3987215 CCTCATTCACCTCAGAACCTCCT 0: 1
1: 0
2: 4
3: 28
4: 308
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019896445_1019896456 12 Left 1019896445 7:3987210-3987232 CCTCCTGGTCAGCCCTAATTCTT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019896456 Original CRISPR CCGTGGTGCTCTCTTGGGTC CGG Exonic
900206843 1:1435292-1435314 CCCTGGGGTTCTCTTGGGCCTGG + Intronic
906490699 1:46266360-46266382 CAGTCTTGCTCCCTTGGGTCAGG - Intronic
907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG + Intronic
908219335 1:61988140-61988162 CAGTGGTGCGATCTTGGGTCAGG - Intronic
908517555 1:64908924-64908946 CAGTAGTGTTTTCTTGGGTCTGG - Intronic
916124696 1:161558937-161558959 TCGTGATGCTCTCTTAGCTCAGG + Intergenic
916134587 1:161640286-161640308 TCGTGATGCTCTCTTAGCTCAGG + Intronic
916454600 1:164958221-164958243 CCCTGGTGCTCACGTGGGGCTGG - Intergenic
920210745 1:204326509-204326531 CTGTGGTGCTCACTTGGGTTTGG - Intronic
921583911 1:216926130-216926152 CCGAGGTGCTCCTTTGGGTCTGG - Intronic
922197649 1:223373563-223373585 CCCTGGTGCTCTCCTGTGTTTGG - Intergenic
1062834848 10:628888-628910 CCGTGGTTCTCACCTGGGGCTGG - Intronic
1063548077 10:7001359-7001381 GCCTGGTTCTCTCTTGGGACAGG + Intergenic
1067095630 10:43297707-43297729 TCGTGGGCCTCTCTTGGGGCAGG + Intergenic
1070485423 10:76925963-76925985 CCTTGGTGCTATCTTGGGCCAGG - Intronic
1070935661 10:80293001-80293023 CCGTGGTGCTGCCTAGGGTCAGG - Intergenic
1072711342 10:97717626-97717648 CCCTGGTGCTGTCTGTGGTCAGG + Exonic
1072824289 10:98590384-98590406 CAGTGGTGCAATCTTGGCTCCGG - Intronic
1075006049 10:118830936-118830958 CCCTGGTGCTCGCTTGGGGAGGG + Intergenic
1075633575 10:124015887-124015909 CCTTCGTGCCCTCTGGGGTCGGG - Intronic
1076526524 10:131115807-131115829 CTGAGGTGCTGTCCTGGGTCTGG - Intronic
1080894632 11:36439170-36439192 CCATGTTGCTGTCCTGGGTCTGG - Intronic
1083048036 11:59754210-59754232 CCGTAGTTCTCTCTCGCGTCCGG - Intronic
1083714809 11:64569101-64569123 ACTTGGGGCTCTCTTGGGGCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1090431168 11:126647871-126647893 TCATGGTGCTCTCCGGGGTCTGG + Intronic
1095681702 12:44984979-44985001 CAGTGGTGCGGTCTTGGCTCAGG + Intergenic
1095823544 12:46507544-46507566 ACCTGGTGCTCTAATGGGTCTGG - Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097121325 12:56735155-56735177 CAGTGGTGCAATCTTGGCTCGGG + Intronic
1102385320 12:112504157-112504179 TCCTGGTGCTCCCTGGGGTCTGG - Intronic
1102422135 12:112812231-112812253 CCGTGGTGTTCTGATGGGGCTGG - Intronic
1102711941 12:114935867-114935889 CAGTGGTGCTCAGTTGGGGCAGG - Intergenic
1103123190 12:118397959-118397981 CTTTGGTGCTCTCTTGGGTTGGG + Intronic
1109428506 13:62199922-62199944 CTGGGGTGATCTCTAGGGTCTGG + Intergenic
1122890724 14:104731005-104731027 CTGTGGTGCAGGCTTGGGTCAGG - Intronic
1123122467 14:105923749-105923771 CCTGGGTGCCCTCCTGGGTCTGG + Intronic
1123405113 15:20015173-20015195 CCTGGGTGCCCTCCTGGGTCTGG + Intergenic
1123514444 15:21021821-21021843 CCTGGGTGCCCTCCTGGGTCTGG + Intergenic
1126087453 15:45023265-45023287 CCATGGAGCTCTTTTGGCTCTGG - Exonic
1127329588 15:57925488-57925510 CTCTGTTGCTGTCTTGGGTCAGG + Intergenic
1128151249 15:65364822-65364844 CAGTGGTGCGATCTTGGCTCAGG - Intronic
1134195532 16:12156527-12156549 TCATGGTGCTCTCTGGGGGCAGG - Intronic
1135399352 16:22155608-22155630 CCTTGGTGATCTCCTGGGCCAGG - Exonic
1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG + Intronic
1142996540 17:3763921-3763943 CCCTGGTGTCCTCTTGGTTCTGG + Exonic
1143013762 17:3880736-3880758 TCATGATCCTCTCTTGGGTCTGG - Intronic
1143080724 17:4379588-4379610 CAGTGGTGCGATCTTGGCTCAGG + Intergenic
1143150877 17:4807171-4807193 CCGGTCTGCTCTCTTGGCTCCGG + Exonic
1143614913 17:8044010-8044032 CAGTGGGGCTATCTTGGCTCAGG - Intronic
1143904341 17:10197734-10197756 CGGTCGTGCTGCCTTGGGTCAGG - Intronic
1146472217 17:33133704-33133726 CCGTGGTGATCTCCCGGGTGAGG + Intronic
1146920418 17:36706325-36706347 CTGTGCTGCCCTCTTGGGGCCGG - Intergenic
1148647463 17:49227330-49227352 CCCTGTTGCTCTCAGGGGTCCGG + Intronic
1148897676 17:50849350-50849372 CAGTGGTGCGATCTTGGCTCAGG + Intergenic
1151684256 17:75637491-75637513 CAGTGGTCCCCTCTTGGTTCCGG - Exonic
1151828577 17:76537156-76537178 CCGAGGTGCTCTCCTGCATCTGG + Intronic
1152061290 17:78077579-78077601 CCTTGGTGCTAACTTGGGACTGG + Intronic
1153322367 18:3785749-3785771 CTGTGGTTCTCTTTGGGGTCTGG + Intronic
1153944952 18:10009956-10009978 CCGTGGTCCTCTCCAGGGTCCGG + Intergenic
1160049727 18:75421576-75421598 ACGTGGAGCTCTGTGGGGTCAGG + Intronic
1160214866 18:76919885-76919907 CCGTGGCGCTCTCCTGCGGCCGG - Exonic
1160377148 18:78421730-78421752 CCGTGGTGCTCTCCTGAAGCTGG - Intergenic
1161124375 19:2547532-2547554 CGGTGGTGCTCTCATGACTCAGG + Intronic
1161961110 19:7523595-7523617 CCGTGCTGCTTTCTAGGGCCTGG - Intronic
1162475869 19:10899002-10899024 CCGTGTTCCTCTCTTTGTTCAGG - Intronic
1165416825 19:35699588-35699610 CAGGGGTGATCTCCTGGGTCAGG + Intergenic
1165774202 19:38395395-38395417 CCCTAGCGCACTCTTGGGTCTGG - Intronic
927195083 2:20541384-20541406 ACGTGCTGCTCTCTGGGGTCTGG - Intergenic
929718857 2:44345406-44345428 CAGTGGTGCAATCTTGGCTCAGG + Intronic
931817242 2:65916651-65916673 CCTTGCTGCTTTCTTGGGCCCGG - Intergenic
937039611 2:118810757-118810779 TCATGGTGCTCTCTGAGGTCAGG - Intergenic
937191653 2:120107225-120107247 CCATGGTACTGTCTTTGGTCAGG + Intronic
937895462 2:126974086-126974108 CCTTCTTCCTCTCTTGGGTCTGG - Intergenic
937926959 2:127175000-127175022 CGGTGGAGCTCTCCTGGGTTTGG - Intergenic
940914940 2:159243959-159243981 ACGTGTCTCTCTCTTGGGTCTGG - Intronic
942014056 2:171793313-171793335 CCCTGGTGCTCTCTTTGGGTTGG - Intronic
946418415 2:219551979-219552001 CCGAGGGGCTCTCCTGGGCCGGG - Intronic
948022382 2:234745614-234745636 GCCTGGTGCTCTCCTGGGTGAGG - Intergenic
948643848 2:239391772-239391794 CCTCGGTGCTCTCGTGGGTGTGG - Intronic
1175818671 20:61896818-61896840 CCCTGCTGCGCTCTTGGGCCTGG - Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1181669716 22:24420457-24420479 CCTTGTTGCTCCCTTGGGCCTGG + Intronic
1183529689 22:38346716-38346738 CTGTGGGGCTCACCTGGGTCCGG + Intronic
950273305 3:11637133-11637155 CTGTGGTGAACTCTTGGGGCTGG + Intronic
950464945 3:13148225-13148247 CTATGGTGCTCTCCTGGGTGGGG - Intergenic
954639371 3:52088946-52088968 CCGTGGTTATCTCTGGGGCCTGG - Intronic
956296888 3:67724643-67724665 CTAGGGTGCTCTCTTGGCTCAGG - Intergenic
958955966 3:100466366-100466388 CCCTGTTGCTCTCAGGGGTCAGG + Intergenic
981714240 4:147737205-147737227 CAGTGGTGCAATCTTGGCTCAGG + Intronic
981816846 4:148840414-148840436 CAGTGGTGCAATCTTGGCTCAGG - Intergenic
983529257 4:168792821-168792843 CAGTGGTGCGATCTTGGCTCAGG + Intronic
985043743 4:185918576-185918598 CCGTGGTGACCTCTTGGGGAAGG - Intronic
988701270 5:33677525-33677547 CCCTGCTCCCCTCTTGGGTCGGG - Intronic
992277913 5:75140145-75140167 CAGTGGTGCAGTCTTGGCTCAGG - Intronic
1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG + Intronic
1006465327 6:34190595-34190617 CTGTGGTGCTCTCCTCAGTCTGG - Intergenic
1007606821 6:43123552-43123574 CCGTGTTGCTCTCTGGGCTCAGG - Intronic
1007751386 6:44073804-44073826 GAGTGGTTCTTTCTTGGGTCTGG - Intergenic
1009718990 6:67440296-67440318 CAGTGGTGCGATCTTGGCTCAGG + Intergenic
1015880188 6:137864443-137864465 ACGTGGTGCTCTCTTTCATCAGG + Intergenic
1017021548 6:150143648-150143670 CCGCGGTGCCCTCTGGCGTCGGG + Intronic
1018001289 6:159580805-159580827 CCGTGCTGCTCACCTGGCTCAGG - Intergenic
1018876439 6:167826580-167826602 GGGTGGTGCTGTGTTGGGTCCGG - Intergenic
1018972997 6:168541485-168541507 CAGAGTTGCTTTCTTGGGTCTGG + Intronic
1019760482 7:2808677-2808699 CCATGGCTCTCACTTGGGTCCGG + Intronic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1020115347 7:5473102-5473124 CCCTGGTGATGTCTTGTGTCTGG - Intronic
1026266306 7:68798812-68798834 ACGTGGTGCAATCTTTGGTCAGG - Intergenic
1030598005 7:111562358-111562380 CCTTGGTGGTCTCTTGGGCTGGG - Intronic
1035485300 7:159218811-159218833 CCGTGGGGCTCTGTTCGGTGGGG - Intergenic
1049741454 8:144242962-144242984 CCTAGGTGCTCACTGGGGTCCGG - Intronic
1050028623 9:1362145-1362167 CTGTGTTGCTATGTTGGGTCAGG + Intergenic
1060051978 9:120384254-120384276 CAGTGCTGCCCTCTCGGGTCAGG + Intergenic
1060789818 9:126478489-126478511 CCGAGGTCCTCCCTGGGGTCTGG - Intronic
1185833347 X:3321992-3322014 CCGTGGTGTTCCCTTGGATGTGG + Exonic
1186133297 X:6493060-6493082 CAGTGGTGCAATCTTGGCTCAGG + Intergenic
1187413958 X:19076132-19076154 CCTTGGTCATCCCTTGGGTCTGG + Intronic
1189261304 X:39680665-39680687 CCTTGGTGCTCTATTGGGACTGG - Intergenic
1190120775 X:47657670-47657692 CAGTGGTGAACTCTTAGGTCAGG + Intronic
1192533407 X:71908907-71908929 CCCAGTTGCTCTCTTGGCTCAGG + Intergenic
1199597860 X:149522254-149522276 CCTTGGTGTTCCCCTGGGTCAGG + Intronic
1201328333 Y:12790906-12790928 ACGTTGTACTCTTTTGGGTCTGG + Intronic