ID: 1019897345

View in Genome Browser
Species Human (GRCh38)
Location 7:3992505-3992527
Sequence TCCCTGCATTGAGAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019897339_1019897345 7 Left 1019897339 7:3992475-3992497 CCAGGTGGCGGATGAGGGAAGCC 0: 1
1: 0
2: 2
3: 12
4: 153
Right 1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019897345 Original CRISPR TCCCTGCATTGAGAGAGTGC AGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903007587 1:20308846-20308868 TCCCTTCTTTGAGAAAGAGCAGG + Intronic
905361715 1:37425388-37425410 TCCCTAGAGTGAGAGAGTGAGGG - Intergenic
906602083 1:47138823-47138845 TCCCTGCATGGGGAGAGGGGCGG + Intronic
911738658 1:101363750-101363772 TCCTTGGATGGCGAGAGTGCAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915114755 1:153590166-153590188 TCCCAGCATTTAGAGAGGCCAGG + Intergenic
915151198 1:153833255-153833277 TTGTTCCATTGAGAGAGTGCAGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
917511631 1:175673976-175673998 GCCCTGCAGTGAGAGGGTGAAGG - Intronic
917639563 1:176969749-176969771 GCCCTGCATTGAGAGAATATTGG - Intronic
923041813 1:230325076-230325098 ACCCAGCATTGGGAGAGTGGAGG + Intronic
923696432 1:236256507-236256529 TCCTTCCATTGAGAGATTGTGGG - Intronic
1065382374 10:25103056-25103078 TCCCTTCACTGAGACAGTCCTGG - Intergenic
1066649609 10:37642277-37642299 TGCCACCATTGGGAGAGTGCTGG + Intergenic
1067467295 10:46510662-46510684 GCCCTGCAGTGTGGGAGTGCAGG - Intergenic
1067619891 10:47873943-47873965 GCCCTGCAGTGTGGGAGTGCAGG + Intergenic
1070432842 10:76358548-76358570 TCCCTGCATTCTGATAGAGCAGG + Intronic
1071571318 10:86698999-86699021 TCCCTGCCTTGAGTGAGTTGGGG - Intronic
1073069854 10:100786603-100786625 TGCGTGCTTGGAGAGAGTGCCGG + Intronic
1074278052 10:112023733-112023755 TCCCTGCATTGGGGCAGTGCTGG - Intergenic
1074536524 10:114332056-114332078 TCCCTGCAGTAATAGGGTGCAGG + Intronic
1076616979 10:131761552-131761574 TCCCTGCTGTGGGTGAGTGCTGG - Intergenic
1076850776 10:133091673-133091695 TCCCGGCATTGAGAACATGCAGG - Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1080236150 11:30070671-30070693 TCCTTACTTTGAGAGAGGGCTGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081720266 11:45283853-45283875 TCCAGGCACTGAGAGGGTGCTGG + Intronic
1083151104 11:60792258-60792280 TCCCTGAAATGAGAAACTGCAGG - Exonic
1086001652 11:81991270-81991292 TCCCTGCATGCAGAGGGAGCTGG + Intergenic
1086539282 11:87888525-87888547 TCCGTGCCTTGAAAGAATGCTGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090402662 11:126458926-126458948 GCCCTGCATGGAAAGAGGGCTGG - Intronic
1092071413 12:5634425-5634447 TCCCTACATTCAGAGAGGGAAGG + Intronic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096237951 12:49942590-49942612 TTCCTGCCTTCAGAGAGTGCAGG + Intergenic
1096613095 12:52815959-52815981 TCCATGCACAGAGAGAGGGCAGG + Intergenic
1096866430 12:54566381-54566403 TGCCTGCATGGAGAGAGGCCAGG + Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097969726 12:65620243-65620265 TCCCTGCCTTGAGAGATGACAGG + Intergenic
1101011595 12:100456517-100456539 TAGCTGCATTGTGAGAATGCAGG + Intergenic
1103749403 12:123149391-123149413 TCTCTGCAGTGGGAGAGGGCTGG + Intronic
1104323195 12:127771552-127771574 TCCATGCATTGAGAAAGAGATGG + Intergenic
1105975431 13:25468678-25468700 TCCCTGCAGGGAGGGAGCGCAGG + Intronic
1107416678 13:40207583-40207605 GCCCTGCATTGTGAGCATGCTGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108246591 13:48521612-48521634 CCCCTGCATTCAGACAGTGCTGG - Intronic
1111217506 13:85163464-85163486 TCCCTGCATTGAGGCTATGCTGG - Intergenic
1111546633 13:89746681-89746703 TCCCTAGAGAGAGAGAGTGCTGG + Intergenic
1116769068 14:49106318-49106340 TCCCTGCATGGAAAAAGTGCTGG - Intergenic
1116869319 14:50056542-50056564 TCCCTGCACGGTGTGAGTGCTGG - Intergenic
1117665596 14:58052914-58052936 TCCCTGAGATGAGAGAGAGCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1124349135 15:28942811-28942833 TCCCTGCAGGGAGAGAGAGAAGG + Intronic
1126468668 15:48983904-48983926 TCCCAGGATTGAGTTAGTGCAGG + Intergenic
1127830915 15:62750458-62750480 TGACTGCATTGAGAGTGTGATGG + Exonic
1128258141 15:66213087-66213109 TCCCTGCACTGGGGAAGTGCTGG + Intronic
1128603369 15:69016195-69016217 CCCCTGCCTTGGGAGCGTGCAGG + Intronic
1129928109 15:79384192-79384214 TCACTGCCTCGAGAGAGTTCTGG - Intronic
1131407293 15:92175816-92175838 TCCATGGATGGAGAGAGTGGGGG - Intergenic
1133750339 16:8720485-8720507 TGCCTGCAGGGAGAGAGGGCTGG + Intronic
1135652796 16:24221376-24221398 ACTCTGCTCTGAGAGAGTGCGGG - Intergenic
1138116442 16:54364311-54364333 TCCCTGGAGTGGGAGGGTGCAGG - Intergenic
1139359437 16:66388304-66388326 TCCCTGCAGAGAGAGAATCCTGG - Exonic
1141213549 16:82003255-82003277 TAGGTGCATTGAGGGAGTGCTGG - Intronic
1144670699 17:17131123-17131145 TCCCTGCAGAGGGAGGGTGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146075268 17:29722859-29722881 TCTCTGCAGTGAGAGAGGGGTGG + Intronic
1146794860 17:35773813-35773835 TCCCTGCAGTGTCAGAGTGGAGG + Intronic
1147992835 17:44345549-44345571 TCCCTGCTTTGGGGGAATGCTGG - Intronic
1148796389 17:50199325-50199347 TCCCTGCAGGGGGAGAGGGCGGG + Exonic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152367579 17:79865520-79865542 TGCTTGCATTGAGTGACTGCTGG + Intergenic
1152621470 17:81367033-81367055 ACCCTGCATTCATAGAGTGGGGG - Intergenic
1152784660 17:82241515-82241537 TCCCTGCCCTGAGAGGGAGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164930541 19:32172474-32172496 TCCCAGGATTTAGAGAGGGCAGG - Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167668716 19:50837734-50837756 GCCCGGCACTGAGTGAGTGCTGG + Intergenic
926221951 2:10942245-10942267 TCCCTGCCATGGGAGACTGCTGG + Intergenic
927216715 2:20671528-20671550 TCCCTCCTCTGAGAGGGTGCTGG - Exonic
927812895 2:26189975-26189997 TTCCTGCATTGGCAGAATGCCGG + Intergenic
929445477 2:41997534-41997556 TCCCTGCTTTTAGAGAAGGCAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933806618 2:86002982-86003004 TCTCTGCATACAGAGGGTGCTGG - Intergenic
934566072 2:95342103-95342125 ACCCTGAGATGAGAGAGTGCTGG + Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941013838 2:160332190-160332212 TCCCTGCTTTGAAAGAGGACTGG + Intronic
941700325 2:168597367-168597389 TCCATGGAATGAGAGTGTGCAGG - Intronic
944268848 2:197759278-197759300 TCCCTGCAATAAGAAACTGCAGG - Intronic
945368048 2:208980273-208980295 TCACTGCCTAGAGAGAGTACAGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174270982 20:49368227-49368249 TCACAGCATTGACAGAGTCCAGG + Exonic
1175978016 20:62723211-62723233 TCTCAGCATTCAGAGAGTACGGG + Intronic
1178882314 21:36459445-36459467 TCCCTGCATGCAGTGACTGCTGG + Intergenic
1180877508 22:19181564-19181586 TCCCTACAATGGGAGAGCGCTGG + Intronic
1181516313 22:23415568-23415590 TGGCTGCATTTGGAGAGTGCTGG - Intergenic
1184505318 22:44897328-44897350 TCCCTGCCTTGAGTGTGGGCAGG + Intronic
1184872743 22:47251397-47251419 TGCCTGCACTCAGTGAGTGCTGG + Intergenic
955869623 3:63423596-63423618 CCCTTGCTTTGAAAGAGTGCCGG + Intronic
959411276 3:106025451-106025473 TCCCTGCATTCTGAGAGCTCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960266094 3:115623162-115623184 CCACTGCATTGAGAGGGTGATGG - Intergenic
961869294 3:129976206-129976228 TCCCAGCATTGAGACAGGGGAGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
965998094 3:174911583-174911605 TCCCAGCATTGAGAAGGAGCTGG + Intronic
967090019 3:186127153-186127175 GCCATGCATTGTGAGAGAGCTGG - Intronic
967854812 3:194109262-194109284 TCCCTGAAGGTAGAGAGTGCAGG - Intergenic
968931624 4:3582377-3582399 GCCCTGTACAGAGAGAGTGCAGG - Intronic
969370276 4:6727490-6727512 TCACTCCCTTGAGAGAGGGCAGG + Intergenic
972997664 4:44902114-44902136 TCCCTGAGTTAAGATAGTGCTGG - Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
979550598 4:121986879-121986901 ACCCTGCATTAAAACAGTGCTGG - Intergenic
982043739 4:151420890-151420912 GCACTGCATTGAGAGAGCTCTGG - Intronic
982843849 4:160224666-160224688 TCCCTGCATGGCGACACTGCTGG + Intergenic
984172792 4:176380929-176380951 TCCCTGCATTCAGAGAGAGGAGG - Intergenic
985095631 4:186409946-186409968 TCCCTGCATTGAGAGCATCTGGG + Intergenic
986788190 5:11134417-11134439 CCCCTGCATTTCTAGAGTGCAGG + Intronic
987605848 5:20135086-20135108 TCCAGGCAATGAGAAAGTGCTGG + Intronic
991559730 5:67937166-67937188 TCCCAGCATGGAGAGACTGGTGG + Intergenic
992068833 5:73130753-73130775 GCCCTGCATGGAGAAAGGGCAGG + Intronic
1002114548 5:176948603-176948625 TCCCTGCACTCAGAGGGTTCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004428798 6:15524925-15524947 TCTCTGCATTAAGTGAGTCCCGG + Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007765724 6:44158760-44158782 CCACTGCAATGAGAGAGTTCTGG + Intergenic
1010180082 6:73076184-73076206 TCCCTGCACTGAGAAAGGTCTGG - Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1014003163 6:116387538-116387560 TCCCAGGATTGAGACACTGCAGG + Intronic
1014921560 6:127219888-127219910 TCCATCCATTGAGAGAGGTCTGG + Intergenic
1016642057 6:146360612-146360634 TCCCTGAAGTGGGAGAGTGAGGG + Intronic
1017410708 6:154164962-154164984 TCCCTGCACTGGGATAGTACTGG - Intronic
1017995071 6:159525199-159525221 TTTCTGCCTTGAGAGAGTGCAGG - Intergenic
1018210791 6:161479804-161479826 TCCCTGTATTGTGACAGTGTGGG + Intronic
1018385641 6:163300480-163300502 TCCCTGCAGGAAGAGAGTGAGGG - Intronic
1018839314 6:167507247-167507269 ACCCTTCATTTAAAGAGTGCAGG - Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1022184704 7:27956013-27956035 TCACTGAATTAAGAAAGTGCTGG + Intronic
1022394115 7:29970268-29970290 TGCCGGCATTGTGAGAGTGGAGG - Intronic
1024733386 7:52276824-52276846 TCCCTGCTTTCAGAGAGTCAGGG + Intergenic
1024895003 7:54248764-54248786 TCCCTGCAATGATGAAGTGCTGG - Intergenic
1026975625 7:74495969-74495991 TCACTGCATTCAGACTGTGCTGG + Intronic
1029865675 7:103625527-103625549 TCCTTTCATTGAGACAGTGAAGG + Intronic
1032335239 7:131018690-131018712 ACCCTGGGGTGAGAGAGTGCTGG - Intergenic
1034724646 7:153324297-153324319 TCACTGCGGTGAGACAGTGCTGG - Intergenic
1036471452 8:9056253-9056275 TCCCTGAAGTCAGAGAATGCAGG + Intronic
1037609306 8:20463024-20463046 GCCCTGCAAGCAGAGAGTGCTGG + Intergenic
1040577311 8:48665043-48665065 TGACTGCCTTGAGAGAGTTCTGG - Intergenic
1042448478 8:68917270-68917292 TCCCTGGAAAGAGAGGGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045498762 8:102729361-102729383 TACCTACCTAGAGAGAGTGCTGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1053103363 9:35390185-35390207 TCCCTGGAGTGAGAGACTTCTGG + Intronic
1056623267 9:88233138-88233160 TTCTTGCAGTGAGAGAATGCAGG - Intergenic
1059684665 9:116623464-116623486 ATCCTGCATTGACACAGTGCTGG - Intronic
1060413684 9:123416063-123416085 TCCCTACATTCAGCTAGTGCTGG - Intronic
1061520812 9:131116873-131116895 TCCACGCATTCAGAGAGAGCTGG - Intronic
1185527188 X:789193-789215 CCGCAGCATTGAGTGAGTGCGGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188046771 X:25434292-25434314 TCCTTGCATTTAGAGTGTGTGGG + Intergenic
1188455480 X:30359971-30359993 TCCCAGGATTGAGAGAATGGAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191615672 X:63167311-63167333 TCTCTGCACAGAGAGAGGGCGGG - Intergenic
1191620626 X:63211612-63211634 TCTCTGCACAGAGAGAGGGCGGG + Intergenic
1192851338 X:74959473-74959495 TCCCTCAACTGAGAGAATGCAGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic