ID: 1019897398

View in Genome Browser
Species Human (GRCh38)
Location 7:3993207-3993229
Sequence GCAACCTTGATATTTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019897393_1019897398 -8 Left 1019897393 7:3993192-3993214 CCACCAGTTTCCACGGCAACCTT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1019897398 7:3993207-3993229 GCAACCTTGATATTTGGGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019897398 Original CRISPR GCAACCTTGATATTTGGGAG AGG Intronic
900569829 1:3352805-3352827 GCGGCCCTGAAATTTGGGAGGGG - Intronic
901869387 1:12128654-12128676 GCACCATTGACATTTGGGAATGG + Intronic
901886318 1:12225776-12225798 GCAACCATGTTATTAGAGAGAGG - Intergenic
904761964 1:32811803-32811825 TCACCCTTGATGTTGGGGAGTGG + Intronic
904794011 1:33045245-33045267 GGAACTGTGATATTTGGCAGAGG + Intronic
905019106 1:34796169-34796191 TCATCCTTGGTATTTGGGAAGGG + Intronic
907075573 1:51575175-51575197 AAAACCTAGATATTGGGGAGTGG - Intergenic
907551395 1:55308218-55308240 ACAAACTGGATATCTGGGAGAGG + Intergenic
907687329 1:56624459-56624481 AAAACCATGAGATTTGGGAGGGG + Intronic
913505575 1:119513727-119513749 ACAACCACCATATTTGGGAGTGG + Intronic
915759420 1:158295643-158295665 GCTACCATGATATTTGGATGGGG + Intergenic
917758180 1:178124423-178124445 TTACCCTTGATATTTGGGACAGG - Intronic
918386957 1:184018482-184018504 GAAACCTTGATTTCTGGGAATGG - Intronic
918485703 1:185026501-185026523 AGAAACTTGAGATTTGGGAGTGG - Intergenic
921422265 1:214961915-214961937 GAAACCCTGATATTCTGGAGGGG + Intergenic
923179069 1:231498690-231498712 GAAAACATGAGATTTGGGAGGGG - Intergenic
923428132 1:233892222-233892244 GAGAACATGATATTTGGGAGGGG + Intergenic
924426890 1:243959442-243959464 GCAGAGTTGACATTTGGGAGAGG + Intergenic
924633572 1:245764429-245764451 TCTGCGTTGATATTTGGGAGGGG + Intronic
1064751195 10:18530914-18530936 GCCACTTTGATATGTGGCAGTGG + Intronic
1066040656 10:31545603-31545625 GAAGACATGATATTTGGGAGGGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070198081 10:74177118-74177140 GCAACCCTGGAATTTGGGCGAGG - Intronic
1071921708 10:90357639-90357661 GCAACATTGAAATTTCAGAGTGG - Intergenic
1073743655 10:106440861-106440883 TCAACCCAGGTATTTGGGAGTGG + Intergenic
1073880411 10:107974031-107974053 GAAGACATGATATTTGGGAGGGG + Intergenic
1074770381 10:116729870-116729892 GAAAGGTTGATATTAGGGAGTGG - Intronic
1075554289 10:123418988-123419010 GCTACCCTCATAGTTGGGAGTGG - Intergenic
1076585083 10:131541566-131541588 GAAAACGTGAGATTTGGGAGGGG - Intergenic
1084866577 11:72063083-72063105 AAAACCTTGATATTTGGGCCAGG + Intronic
1086586224 11:88455651-88455673 GGACCCTTGTTATTTAGGAGTGG + Intergenic
1088908980 11:114176329-114176351 GCAACCTTGGCATTTGTGAGAGG - Intronic
1094787259 12:33863266-33863288 GCTACCTGGAAATTTGGGTGTGG + Intergenic
1104171996 12:126291277-126291299 GAAAACATGACATTTGGGAGGGG - Intergenic
1106052973 13:26208697-26208719 GCAACCATGTAACTTGGGAGGGG - Intronic
1109547510 13:63847447-63847469 GCAGCCCTGATACTTGTGAGAGG - Intergenic
1111339408 13:86863472-86863494 GAGAACATGATATTTGGGAGGGG + Intergenic
1113112054 13:106833963-106833985 GTAACCTGCATATTTGGGAGTGG - Intergenic
1114272363 14:21109308-21109330 GCACCATTGATATTTGGGCCAGG + Intergenic
1120128778 14:80780509-80780531 GAAAGCTTGAGATCTGGGAGGGG - Intronic
1123696742 15:22884162-22884184 GCATGATTGAGATTTGGGAGGGG - Intronic
1126195001 15:45921917-45921939 CCACCCTAGATATTTGGGAAGGG - Intergenic
1127680091 15:61286287-61286309 GCAAACTTGATATATGAAAGAGG + Intergenic
1128126670 15:65198069-65198091 GCAACCTGGAGATTCGTGAGAGG - Exonic
1129360907 15:75023582-75023604 GATACCGCGATATTTGGGAGCGG + Exonic
1130409218 15:83630823-83630845 GAAGACTTGAGATTTGGGAGGGG - Intergenic
1130829027 15:87580877-87580899 GCATCCTTGAATTTGGGGAGAGG + Intergenic
1131343285 15:91622969-91622991 GCACCATTGATATTTTGGACTGG + Intergenic
1131499597 15:92948990-92949012 ACAACCTGCATATTTAGGAGGGG + Exonic
1135560978 16:23476720-23476742 TCAACCTTGTTTTTAGGGAGTGG + Intronic
1137485550 16:48887608-48887630 TCAACCTTTGCATTTGGGAGTGG - Intergenic
1138069334 16:53976011-53976033 GGAACTTTGCTATTTTGGAGAGG - Intronic
1139286954 16:65823947-65823969 GCTGCCTTGATGTGTGGGAGAGG - Intergenic
1140585383 16:76285118-76285140 GGAACATTGGTATTTGGAAGAGG + Intronic
1140953319 16:79839617-79839639 GCACTCTTGACATTTGGGGGAGG + Intergenic
1141808068 16:86355080-86355102 GCAACCAGGATGGTTGGGAGTGG + Intergenic
1144457899 17:15433821-15433843 GCAAGCCAGATATTTGGGGGTGG - Intergenic
1146832878 17:36084972-36084994 GCAGCCTTGGTATTTGGCACAGG - Intergenic
1152626418 17:81389849-81389871 GCAACTTTGAGAGTGGGGAGGGG + Intergenic
1154232521 18:12570346-12570368 ACAACCTTGATATTTGATATAGG - Intronic
1160153546 18:76413631-76413653 GCAGCCCAGATATTTGGGGGTGG - Intronic
1160755557 19:755226-755248 GCAACCTGGACCCTTGGGAGAGG + Intronic
1161225173 19:3141129-3141151 GCAACCCTCATATTGGGGAAGGG + Intronic
1165337557 19:35182456-35182478 GCAGCCTGGGTCTTTGGGAGTGG - Intergenic
1168496328 19:56854562-56854584 GAAAACATGAGATTTGGGAGGGG + Intergenic
1168496431 19:56855275-56855297 GAAAACATGAGATTTGGGAGGGG + Intergenic
926444786 2:12928948-12928970 GCAACCACGGTATTAGGGAGTGG - Intergenic
933615602 2:84479490-84479512 GCAAACATGTAATTTGGGAGAGG - Intergenic
933675390 2:85051742-85051764 GCAACCTTATTAATTGGGGGTGG - Intronic
939276995 2:140011828-140011850 ATAAAGTTGATATTTGGGAGTGG - Intergenic
940598129 2:155820244-155820266 AAAACCATGGTATTTGGGAGAGG + Intergenic
1169411472 20:5374160-5374182 GCAACCCTGATCTATGGGGGTGG - Intergenic
1169865736 20:10197924-10197946 CCAATATAGATATTTGGGAGTGG - Intergenic
1170741927 20:19065864-19065886 GAAAACATGAGATTTGGGAGGGG + Intergenic
1172701551 20:36856380-36856402 GCACCCTTTATAGATGGGAGTGG + Intronic
1177258128 21:18692470-18692492 GAAAACATGAGATTTGGGAGGGG - Intergenic
1180644013 22:17322886-17322908 ACAACCTTGATATTTTTGAAGGG - Intergenic
1184640962 22:45869807-45869829 GTAGCCTTTCTATTTGGGAGAGG - Intergenic
949645897 3:6093625-6093647 CCAACCTTGAAGTGTGGGAGAGG - Intergenic
951177046 3:19614608-19614630 GAAAATATGATATTTGGGAGGGG - Intergenic
953608847 3:44430583-44430605 GCACTCTTGACATTTGGGACTGG + Intergenic
953888173 3:46731002-46731024 ACAACCTTGATATATGAGAGAGG + Intronic
955852244 3:63233165-63233187 TCAACCATGCTATTTGAGAGTGG + Intronic
956202323 3:66719309-66719331 GCACTCTTGATATTTTGGACGGG - Intergenic
956246449 3:67187954-67187976 GAAAACATGAGATTTGGGAGTGG - Intergenic
957165779 3:76671607-76671629 ACAACATTGAGATATGGGAGAGG + Intronic
957267097 3:77982047-77982069 GAAAACATGAAATTTGGGAGGGG - Intergenic
957557363 3:81779796-81779818 GAGGACTTGATATTTGGGAGGGG - Intergenic
958084894 3:88794804-88794826 ACAACCATGAGATTTGGGAGGGG - Intergenic
958609549 3:96407260-96407282 TCAGCCTTTATATTTGTGAGTGG - Intergenic
962589428 3:136873574-136873596 GAAGACATGATATTTGGGAGGGG + Intronic
964327463 3:155562839-155562861 GCAACTTTGAGACTTGGAAGTGG - Intronic
969154978 4:5202363-5202385 GCAGCCATGATATTTGGGTGGGG - Intronic
969597437 4:8157396-8157418 CCAACCTAGTTATCTGGGAGTGG - Intronic
970127534 4:12831637-12831659 GAAGACTTGAAATTTGGGAGGGG - Intergenic
970667636 4:18355562-18355584 GCCACATTGGTGTTTGGGAGTGG + Intergenic
971047505 4:22821659-22821681 GCAACCTTGGTATTTGGCAGTGG + Intergenic
971177587 4:24294589-24294611 GCAAACTTGTTTTTTGGGAGTGG - Intergenic
973836476 4:54814886-54814908 GCAACCTACAGGTTTGGGAGTGG + Intergenic
974614637 4:64265901-64265923 GACACCATGAGATTTGGGAGGGG - Intergenic
980509778 4:133771102-133771124 GAAAACATGATATTTGGGAGGGG - Intergenic
981691611 4:147515195-147515217 GCACCAGTGATATTTGGGTGGGG + Intronic
983391366 4:167134374-167134396 AAAAACTAGATATTTGGGAGTGG + Intronic
983911725 4:173247341-173247363 GCAAACTAGATATGGGGGAGTGG + Intronic
985843047 5:2323851-2323873 TCAACCCTGATATTTAAGAGTGG - Intergenic
986428881 5:7662329-7662351 GTAACCTTGAAATTGAGGAGAGG - Intronic
987630059 5:20458724-20458746 TCCTCCTTGATATTTGGAAGAGG + Intronic
988038671 5:25860587-25860609 GAAGACATGATATTTGGGAGGGG - Intergenic
989516441 5:42348849-42348871 GAAGACATGATATTTGGGAGAGG + Intergenic
992804063 5:80319769-80319791 GCAACCTAGAAATTAAGGAGGGG + Intronic
995145743 5:108785705-108785727 GCTTCCTTGATATTTGTCAGAGG + Intronic
1000704788 5:164497256-164497278 ACAACCTTGCTGTTTGGGATAGG - Intergenic
1001995922 5:176157957-176157979 ACAAGCTTGGAATTTGGGAGTGG + Intergenic
1004120316 6:12815306-12815328 GCAAATTTGATACTGGGGAGGGG - Intronic
1007223591 6:40297396-40297418 GAGAACTTGAGATTTGGGAGGGG + Intergenic
1011870566 6:91886998-91887020 GACAACATGATATTTGGGAGAGG + Intergenic
1012213306 6:96551068-96551090 GCATCCTTGATCTTTATGAGTGG + Intronic
1013928711 6:115503506-115503528 GAGACCATGAGATTTGGGAGGGG + Intergenic
1014760009 6:125346009-125346031 GCAATCTTGATATTGGGCTGTGG - Intergenic
1017363511 6:153604675-153604697 GCAACGGAGAGATTTGGGAGAGG + Intergenic
1018206321 6:161440424-161440446 GCATTCTTGATATTTGGGGTGGG - Intronic
1019897398 7:3993207-3993229 GCAACCTTGATATTTGGGAGAGG + Intronic
1022044929 7:26615021-26615043 GAAATCTTTATATTTGGGAGTGG + Intergenic
1030966405 7:115997205-115997227 GCTACCTGGATCTTGGGGAGGGG - Intronic
1031621862 7:123943823-123943845 GAAACCTTTATCTTTGAGAGAGG + Intronic
1039085503 8:33775856-33775878 GCAACTCTGAAATTTTGGAGGGG + Intergenic
1040436320 8:47394609-47394631 GCACTCTTGACATTTGGGACTGG - Intronic
1041029949 8:53726896-53726918 CCAAACTTGTGATTTGGGAGTGG - Intronic
1042809717 8:72810788-72810810 GCAATCTTGATGTTTGGCAGAGG + Intronic
1044395270 8:91703449-91703471 GCAACCTGGAGCTATGGGAGGGG + Intergenic
1044995313 8:97832606-97832628 TCTACCCTGATATTTCGGAGTGG - Intronic
1045633927 8:104160591-104160613 GCAACCTTCATGTTTGGAAAGGG - Intronic
1047106847 8:121741558-121741580 GCAAACTTTATATTAGGAAGAGG + Intergenic
1047587010 8:126283576-126283598 GAAGACTTGAGATTTGGGAGAGG + Intergenic
1048624430 8:136169582-136169604 GCAAACTTTATATCTGGCAGAGG - Intergenic
1050333536 9:4569287-4569309 GCAACCTTTATAAGTGGGATGGG + Intronic
1051089173 9:13385903-13385925 GAAAACATGAGATTTGGGAGGGG + Intergenic
1051728563 9:20114183-20114205 ACAAACGTGCTATTTGGGAGTGG - Intergenic
1053598673 9:39588539-39588561 GCCACCCTGATATTTCAGAGTGG - Intergenic
1054906999 9:70420577-70420599 GCAACCTTGGAACTTGGGAGGGG - Intergenic
1057571103 9:96204679-96204701 GAAACCTGGATATTTGGGGAAGG - Intergenic
1057926047 9:99150714-99150736 GCACCCTTGTTACTTGGGAGAGG + Exonic
1058006660 9:99923378-99923400 GCAAGGTTGATACTTGGAAGTGG + Intronic
1060924058 9:127443247-127443269 GTAATTTTGATATTTTGGAGAGG - Intronic
1189886024 X:45545796-45545818 AAAACCATGAGATTTGGGAGGGG - Intergenic
1190397363 X:49998590-49998612 GCAAACTTAAAATGTGGGAGGGG - Intronic
1190812231 X:53895972-53895994 GAAACCTTGATATTTGGAATGGG + Intergenic
1194889477 X:99360752-99360774 GTATCCCTGATTTTTGGGAGTGG + Intergenic
1196547105 X:116975274-116975296 GAAAACATGAGATTTGGGAGTGG + Intergenic
1197341674 X:125283154-125283176 GAAAACATGAGATTTGGGAGGGG - Intergenic
1198089060 X:133309737-133309759 GCAAACTTGACATTTGGGTGTGG + Intronic