ID: 1019903202

View in Genome Browser
Species Human (GRCh38)
Location 7:4040720-4040742
Sequence GTGGGTGGCCAGATTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 473}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019903202_1019903212 20 Left 1019903202 7:4040720-4040742 CCTCCAAAAATCTGGCCACCCAC 0: 1
1: 0
2: 2
3: 21
4: 473
Right 1019903212 7:4040763-4040785 GGATGGGTTATCTCCCCCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1019903202_1019903211 4 Left 1019903202 7:4040720-4040742 CCTCCAAAAATCTGGCCACCCAC 0: 1
1: 0
2: 2
3: 21
4: 473
Right 1019903211 7:4040747-4040769 TAATCTTTTATTATGCGGATGGG No data
1019903202_1019903207 -1 Left 1019903202 7:4040720-4040742 CCTCCAAAAATCTGGCCACCCAC 0: 1
1: 0
2: 2
3: 21
4: 473
Right 1019903207 7:4040742-4040764 CACCCTAATCTTTTATTATGCGG No data
1019903202_1019903210 3 Left 1019903202 7:4040720-4040742 CCTCCAAAAATCTGGCCACCCAC 0: 1
1: 0
2: 2
3: 21
4: 473
Right 1019903210 7:4040746-4040768 CTAATCTTTTATTATGCGGATGG 0: 3
1: 67
2: 148
3: 113
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019903202 Original CRISPR GTGGGTGGCCAGATTTTTGG AGG (reversed) Intronic
900086190 1:898664-898686 GTTTATGGCCAGATTTTGGGGGG + Intergenic
900153450 1:1192070-1192092 GTTTATGGCCAGATTTTGGGGGG + Intronic
900466541 1:2828404-2828426 GTTTATGGCCAGATTTTGGGGGG + Intergenic
900541095 1:3203210-3203232 GTGGGGGGCCAGGGCTTTGGCGG + Intronic
901242376 1:7703182-7703204 GAGGGTGGCCAGATTTGAGCTGG + Intronic
901776811 1:11565708-11565730 CTGGGTGGCCACATCTTTTGGGG - Intergenic
902390694 1:16103293-16103315 GTTTATGGCCAGATTTTGGGGGG + Intergenic
902391322 1:16108777-16108799 GTTTATGGCCAGATTTTGGGGGG + Intergenic
902965388 1:19997424-19997446 GTATATGGCCAGATTTTGGGGGG - Intergenic
902966002 1:20003228-20003250 GTATATGGCCAGATTTTGGGGGG - Intergenic
904572858 1:31480373-31480395 GTTTATGGCCAGATTTTGGGGGG - Intergenic
904574275 1:31492925-31492947 GTTTATGGCCAGATTTTGGGGGG + Intergenic
906043095 1:42804670-42804692 GTTTATGGCCAGATTTTGGGGGG + Intergenic
906254695 1:44339156-44339178 GTGGGCCGCCAGCTTTCTGGTGG + Exonic
906774190 1:48513723-48513745 GTTTATGGCCAGATTTTGGGGGG + Intergenic
907383188 1:54108490-54108512 GTAGGTGGCCACATTCTTGCTGG - Intronic
909048521 1:70739541-70739563 GTTTATGGCCAGATTTTGGGGGG + Intergenic
909098169 1:71315813-71315835 GTTTATGGCCAGATTTTGGGCGG + Intergenic
909611450 1:77555403-77555425 GTGGATGGCCAGATATGAGGGGG - Intronic
910585563 1:88875526-88875548 GTGAGTGGCCAAATTTATTGTGG - Intronic
911103691 1:94113699-94113721 TTGGTAGGCCAGATTTTTGTTGG - Intronic
911283382 1:95959267-95959289 GTTTATGGCCAGATTTTGGGAGG - Intergenic
911796942 1:102087962-102087984 GTGACTGGACAGATGTTTGGTGG - Intergenic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
912856459 1:113172848-113172870 GTTTATGGCCAGATTTTGGGGGG - Intergenic
915261446 1:154679419-154679441 GTTTATGGCCAGATTTTGGGGGG - Intergenic
915379618 1:155428479-155428501 GTTTATGGCCAGATTTTGGGGGG - Intronic
916354408 1:163888710-163888732 GTGGCTGGCCATAATTTTAGAGG + Intergenic
917293245 1:173493102-173493124 GTTAATGGCCAGATTTTGGGGGG - Intergenic
918234906 1:182571239-182571261 GTTTATGGCCAGATTTTGGGGGG - Intergenic
919732226 1:200920653-200920675 GTGACTGGGCAGATCTTTGGTGG + Intergenic
919920349 1:202163449-202163471 GTGTGTGGCCAGAGCTTGGGAGG - Intergenic
920070053 1:203296305-203296327 GTGGGAGGTCACATTCTTGGGGG + Intergenic
920413058 1:205777250-205777272 GTTTATGGCCAGATTTTGGGGGG + Intergenic
920428161 1:205895662-205895684 GTTTATGGCCAGATTTTGGGGGG - Intergenic
920543733 1:206798596-206798618 GAGGGTGGCCAGATTTTATGGGG - Intergenic
920924760 1:210330589-210330611 GTGGGTGGCCAGATGTTGGTGGG + Intronic
921226565 1:213025957-213025979 GTTTATGGCCAGATTTTGGGGGG + Intergenic
921227259 1:213032406-213032428 GTTTATGGCCAGATTTTGGGGGG + Intergenic
921465404 1:215481396-215481418 GTTTATGGCCAGACTTTTGGGGG - Intergenic
923548487 1:234942353-234942375 GTGGGTGGCCAGCTTCCTGGTGG + Intergenic
1063083239 10:2788631-2788653 GTGGGTGACCACATTGCTGGAGG - Intergenic
1063314335 10:4986608-4986630 GTTTATGGCCAGATTTTGGGGGG + Intronic
1063468368 10:6263452-6263474 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1066619273 10:37326754-37326776 GTTTATGGCCAGATTTTGGGGGG - Intronic
1066989746 10:42501723-42501745 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1066990282 10:42506547-42506569 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1066990741 10:42510703-42510725 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1067317145 10:45179831-45179853 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1067317484 10:45181638-45181660 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1068075476 10:52248267-52248289 GTTTATGGCCAGATTTTGGGGGG + Intronic
1068445613 10:57118979-57119001 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1068675479 10:59765277-59765299 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1069070257 10:63984881-63984903 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1069172168 10:65245662-65245684 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1070038616 10:72752524-72752546 ATGTGTGGCTAGCTTTTTGGTGG + Intronic
1070509182 10:77144999-77145021 GTGCTTTGGCAGATTTTTGGAGG - Intronic
1070814861 10:79316711-79316733 GTGTGTGGCCGGATGGTTGGGGG + Intergenic
1070895008 10:79976050-79976072 GTTTATGGCCAGATTTTGGGGGG + Intronic
1070947034 10:80401037-80401059 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1071120981 10:82278582-82278604 GTGAGTGGGCAGGTTTTTGCTGG + Intronic
1071795256 10:88998113-88998135 CTGGGTGGCTACAGTTTTGGGGG + Intronic
1072305849 10:94106621-94106643 GTGGGAGGACAGCATTTTGGGGG - Intronic
1073005065 10:100317245-100317267 GTGCTCGGCCAAATTTTTGGGGG - Intronic
1073955721 10:108869073-108869095 GTGGGTGGACAGAGTGTGGGTGG + Intergenic
1075014030 10:118896969-118896991 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1076285320 10:129290012-129290034 TTGGGTGGTAAGATTCTTGGAGG - Intergenic
1076416128 10:130290823-130290845 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1076505881 10:130972264-130972286 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1076690174 10:132219753-132219775 CTGGGTGCCCTGATTTTGGGGGG - Intronic
1076990901 11:272986-273008 GTGGGGGGTCAGAATGTTGGGGG + Intergenic
1077210102 11:1366851-1366873 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1078206501 11:9234518-9234540 GTTTATGGCCAGATTTTGGGGGG - Intronic
1078390848 11:10934193-10934215 GTAGGTGGGCAGCTTTGTGGCGG + Intergenic
1078561154 11:12374225-12374247 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1079830729 11:25264175-25264197 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1080106237 11:28513971-28513993 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1080367471 11:31592115-31592137 ATGGGTGTGCAGTTTTTTGGGGG + Intronic
1080857580 11:36125762-36125784 GGAGGTGGACAGAGTTTTGGTGG + Intronic
1081328096 11:41770335-41770357 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1082188774 11:49216449-49216471 GTTTATGGCCAGATTTTTGGGGG + Intergenic
1082249821 11:49965765-49965787 ATTTATGGCCAGATTTTTGGGGG - Intergenic
1082560855 11:54618945-54618967 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1083757500 11:64799562-64799584 GTGTGTGTGCAGATTTTGGGGGG - Intronic
1085355626 11:75834004-75834026 GTTAATGGCCAGATTTTGGGGGG + Intronic
1085674797 11:78506482-78506504 GTGGGTAGACAGATTCCTGGTGG - Intronic
1086066359 11:82749439-82749461 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1088216670 11:107518420-107518442 GTTTATGGCCAGATTTTGGGGGG - Intronic
1090037188 11:123259348-123259370 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1092292620 12:7171567-7171589 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1092309964 12:7342115-7342137 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1092568629 12:9697110-9697132 GTTTATGGCCAGATTTTGGGGGG - Intronic
1094342139 12:29424431-29424453 GTTCATGGCCAGATTTTGGGGGG + Intronic
1094411191 12:30170159-30170181 GTGGGTTCCCAGTTTTTTGGGGG - Intergenic
1094487713 12:30938281-30938303 GAGGGTGGACAGACATTTGGGGG - Intronic
1094573890 12:31666003-31666025 GTTTATGGCCAGATTTTGGGGGG + Intronic
1094821306 12:34228074-34228096 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1095184832 12:39189457-39189479 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095186041 12:39201187-39201209 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095780964 12:46059070-46059092 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095913126 12:47448732-47448754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1096125086 12:49113226-49113248 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1096307676 12:50492349-50492371 GTTTTTGGCCAGATTTTGGGGGG + Intergenic
1096441928 12:51650591-51650613 GTTTATGGCCAGATTTTGGGGGG - Intronic
1096442034 12:51651231-51651253 GTTTATGGCCAGATTTTGGGGGG + Intronic
1096450285 12:51734676-51734698 GTTTATGGCCAGATTTTGGGGGG + Intronic
1096450917 12:51740237-51740259 GTTTATGGCCAGATTTTGGGGGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1097816122 12:64075486-64075508 GTTTATGGCCAGATTTTGGGGGG + Intronic
1098923798 12:76327445-76327467 GGGTGTGGACATATTTTTGGGGG - Intergenic
1100306128 12:93351765-93351787 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1101223893 12:102668153-102668175 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1101500988 12:105303309-105303331 GTTTATGGCCAGATTTTGGGGGG + Intronic
1101767060 12:107711375-107711397 GTTTATGGCCAGATTTTGGGGGG + Intronic
1102146434 12:110658366-110658388 GTGGGAGATCAGATTTGTGGAGG - Intronic
1103017701 12:117508611-117508633 GTGGATGGCTAGATTAATGGTGG + Intronic
1103043258 12:117713702-117713724 GTGAGAGGACAGAATTTTGGAGG - Intronic
1103908595 12:124339880-124339902 GTGGGTGGGCAGATGTGTGGGGG - Intronic
1104446276 12:128836211-128836233 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1105282597 13:18977107-18977129 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1105352732 13:19630731-19630753 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1106273180 13:28174484-28174506 GTGGGAGGTGAGATTTTAGGAGG + Intronic
1108972355 13:56392993-56393015 GTTTATGGCCAGATTTTTGGGGG + Intergenic
1109911974 13:68924033-68924055 CTTGGTGGCCAGTATTTTGGGGG + Intergenic
1110027849 13:70564942-70564964 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1111277039 13:85963705-85963727 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1111415951 13:87944062-87944084 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1111542270 13:89684691-89684713 GTGTGTGGATAGATTTTGGGAGG + Intergenic
1111690091 13:91552838-91552860 GTTTATGGCCAGATTTTGGGGGG + Intronic
1113250206 13:108444474-108444496 GTGGATGGCCACTTTCTTGGTGG - Intergenic
1113830065 13:113288663-113288685 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1113905290 13:113816652-113816674 GTGGGTCTCCAGAGTTTCGGAGG - Exonic
1113923163 13:113925831-113925853 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1114028894 14:18557710-18557732 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1115128325 14:30023330-30023352 GTTTATGGCCAGATTTTGGGGGG - Intronic
1115959439 14:38819252-38819274 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1116107881 14:40534478-40534500 AGGGGTGGCTAGATTTTTGATGG + Intergenic
1116232537 14:42235627-42235649 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1116664290 14:47754806-47754828 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1117600132 14:57365970-57365992 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1118538325 14:66793159-66793181 GTTTATGGCCAGATTTTGGGGGG + Intronic
1119334766 14:73823726-73823748 CTGGGTGGTCAGGTTTGTGGTGG - Intergenic
1119562393 14:75601395-75601417 GTTTATGGCCAGATTTTGGGGGG + Intronic
1120261268 14:82189097-82189119 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1121498442 14:94414237-94414259 GTTTGTGGCCAGATTTTGGGGGG - Intergenic
1121681987 14:95801411-95801433 GTGGGTGGCCCCATTTTTCAGGG + Intergenic
1122316050 14:100826697-100826719 GCTGTTGGCCAGGTTTTTGGTGG + Intergenic
1122652660 14:103234011-103234033 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1122653259 14:103238987-103239009 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1122689054 14:103522962-103522984 GTGGGCGGCCAGGGTGTTGGGGG - Exonic
1123058806 14:105585250-105585272 GTGGGTGGGTAGATCTATGGAGG - Intergenic
1123083134 14:105705476-105705498 GTGGGTGGGTAGATCTATGGAGG - Intergenic
1123177782 14:106438162-106438184 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1123673470 15:22684293-22684315 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1124325472 15:28757278-28757300 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1125271414 15:37942633-37942655 TTGGGTGTCCATATATTTGGGGG - Intronic
1126841947 15:52725755-52725777 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1128869583 15:71143585-71143607 CTGGGTGGCCACATTTTTGAGGG - Intronic
1129032392 15:72628733-72628755 GTGAGGGGCCAGATTCTTGAGGG + Intergenic
1129217502 15:74108506-74108528 GTGAGGGGCCAGATTCTTGAGGG - Intronic
1129338352 15:74867941-74867963 CTGGGTGGTCTGATTTTTAGTGG + Intronic
1129771384 15:78205445-78205467 GGGGCTGGCCAGACTTGTGGGGG + Intronic
1129792321 15:78349626-78349648 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1130080217 15:80726345-80726367 GTTTATGGCCAGATTTTGGGGGG + Intronic
1130999208 15:88925007-88925029 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1132171603 15:99662898-99662920 GTGGGTGGTCAAATTTTTTGTGG + Intronic
1132232245 15:100192885-100192907 GTGGGTGGACACATGTCTGGGGG - Intronic
1132951216 16:2563437-2563459 GTGGGTAGGCAGTTTCTTGGGGG + Intronic
1132963134 16:2636733-2636755 GTGGGTAGGCAGTTTCTTGGGGG - Intergenic
1133682370 16:8131843-8131865 GTGGGTAGACAGAGTTTTGGAGG - Intergenic
1133936363 16:10272584-10272606 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1133948587 16:10370516-10370538 GTGGGAGGTGAGATTTCTGGTGG + Intronic
1134291685 16:12906805-12906827 GTGCATGGCAAGATATTTGGCGG + Intronic
1134315550 16:13115646-13115668 GTTTATGGCCAGATTTTGGGAGG + Intronic
1136537003 16:30905638-30905660 GTGGGTTTCCAGATACTTGGGGG - Intergenic
1136743359 16:32559981-32560003 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1137301479 16:47152487-47152509 GTAGATGGCCAGATTTTGGAGGG - Intergenic
1138950437 16:61906373-61906395 GTGGGTGGCCAGAGGGTTTGAGG - Intronic
1139657645 16:68398537-68398559 GTGAATCGCCAGCTTTTTGGTGG - Intronic
1140652740 16:77106469-77106491 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1140757528 16:78081602-78081624 GGGGTTGGCCCTATTTTTGGTGG + Intergenic
1141795908 16:86274041-86274063 ATAGGTGGCCAGATTTTTTGGGG + Intergenic
1142057592 16:88008466-88008488 GGGGGTGGCCAGATCTATGTGGG - Intronic
1203026240 16_KI270728v1_random:515248-515270 GTTTATGGCCAGATTTTGGGTGG - Intergenic
1203045481 16_KI270728v1_random:819183-819205 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1142955446 17:3518430-3518452 GTGTGTGGCCAGGTTTGAGGAGG - Intronic
1143129201 17:4665476-4665498 GTGGCTGGCCAGGTTTACGGGGG - Intergenic
1143430127 17:6875625-6875647 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1143430761 17:6881495-6881517 GTTTATGGCCAGATTTTGGGGGG + Intronic
1143618977 17:8070438-8070460 GTGGGAGGCCAGATATTAAGAGG - Intergenic
1146525609 17:33564665-33564687 GTTTATGGCCAGATTTTGGGGGG - Intronic
1147264684 17:39227536-39227558 GTGGGTGGTAAGATTGTGGGTGG + Intergenic
1148086043 17:44994437-44994459 GTGGGTGGTCAGTACTTTGGTGG - Intergenic
1148897241 17:50845995-50846017 GAGGGTGGCCAGAGTATTGCTGG - Intergenic
1149783462 17:59416564-59416586 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1154428245 18:14288553-14288575 GTTGGTGGCCACATATGTGGGGG + Intergenic
1156269939 18:35521353-35521375 GTAGTTGGCCAGCTGTTTGGTGG - Intergenic
1157349930 18:46875263-46875285 GTGACTGGACAGATGTTTGGTGG + Intronic
1157547316 18:48555552-48555574 GTGGGTGGCCAGATTTTCAGGGG - Intronic
1157900368 18:51509089-51509111 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1157990622 18:52491625-52491647 GGTAGTGGCCAGAATTTTGGTGG + Intronic
1159195685 18:65110965-65110987 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1159937621 18:74381695-74381717 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160569055 18:79804154-79804176 GAAGGTGGCCAGATTTAGGGTGG - Intergenic
1161040001 19:2105238-2105260 GTTTATGGCCAGATTTTGGGGGG - Intronic
1161875760 19:6907949-6907971 GTTTATGGCCAGATTTTGGGGGG - Intronic
1162282694 19:9711986-9712008 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1162652285 19:12098806-12098828 GTTTATGGCCAGATTTTGGGGGG + Intronic
1162652892 19:12104257-12104279 GTTTATGGCCAGATTTTGGGGGG + Intronic
1164024503 19:21338854-21338876 GTATATGGCCAGATTTTGGGAGG + Intergenic
1164031676 19:21412491-21412513 GTTTATGGCCAGATTTTGGGGGG + Intronic
1164060995 19:21673367-21673389 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1164261667 19:23573048-23573070 GTTTATGGCCAGATTTTGGGGGG + Intronic
1164289285 19:23852751-23852773 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1164322650 19:24163655-24163677 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1165296035 19:34926755-34926777 GTAGGTGGCCAGCTTCTTAGAGG - Intergenic
1166252501 19:41581048-41581070 GTTTATGGCCAGATTTTGGGGGG - Intronic
1166659183 19:44634675-44634697 GTTTATGGCCAGATTTTGGGGGG + Intronic
1167016984 19:46847569-46847591 ATGGGTGGGGAGTTTTTTGGGGG - Intronic
1167123902 19:47536286-47536308 GTTTATGGCCAGATTTTGGGGGG + Intronic
1167294235 19:48639982-48640004 GTGGGAGGCCAGTTCTGTGGAGG + Intronic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
1168235362 19:55059563-55059585 TTGGGAGGCCAAAGTTTTGGGGG + Intronic
1168392460 19:56021490-56021512 GTGGTTGTCCAGAGTTTTGAGGG - Intronic
925687257 2:6484721-6484743 GTCGGTGCCCAAATTTTTAGGGG + Intergenic
926215908 2:10905255-10905277 GTGGCTAGAGAGATTTTTGGGGG - Intergenic
927019759 2:19004566-19004588 GTGGGTGTCCAGATTGTCTGGGG - Intergenic
927641440 2:24848073-24848095 GTTTATGGCCAGATTTTGGGGGG - Intronic
930316572 2:49803165-49803187 GTTTATGGCCAGATTTTGGGGGG + Intergenic
930337960 2:50074097-50074119 ATAGGTTGCCAGATTTTTTGAGG + Intronic
930562524 2:52978282-52978304 GTTTGTGGCCAGATTGTTGCTGG + Intergenic
930918573 2:56723722-56723744 GTTTATGGCCAGATTTTGGGGGG - Intergenic
931359970 2:61569967-61569989 GTTTATGGCCAGATTTTGGGGGG - Intergenic
932384446 2:71318278-71318300 GTTTATGGCCAGATTTTGGGGGG + Intronic
933011377 2:77068744-77068766 GTTTATGGCCAGATTTTGGGGGG - Intronic
933500968 2:83110213-83110235 GTTAATGGCCAGATTTTGGGGGG + Intergenic
934931764 2:98431570-98431592 GTTTATGGCCAGATTTTGGGGGG + Intergenic
935240651 2:101175220-101175242 GTTTATGGCCAGATTTTAGGAGG + Intronic
936800036 2:116255646-116255668 GTTTATGGCCAGATTTTGGGGGG - Intergenic
937170957 2:119868466-119868488 GTTTATGGCCAGATTTTGGGGGG - Intronic
937817293 2:126265436-126265458 ATGGATGATCAGATTTTTGGTGG - Intergenic
940311114 2:152279727-152279749 GTTTATGGCCAGATTTTGGGGGG + Intergenic
941239068 2:163014702-163014724 GTTTATGGCCAGATTTTGGGGGG - Intergenic
941258133 2:163259299-163259321 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943062198 2:183050744-183050766 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943062578 2:183053732-183053754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943202547 2:184847645-184847667 GTTGGTGTCCAGAGATTTGGAGG - Intronic
943286476 2:186007951-186007973 GTTTATGGCCAGATTTTGGGGGG - Intergenic
943901795 2:193447922-193447944 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943903656 2:193472073-193472095 GTTTATGGCCAGATTTTGGGGGG - Intergenic
944480390 2:200152019-200152041 GTTTATGGCCAGATTTTGGGGGG - Intergenic
944667070 2:201967495-201967517 AGGGGTGGTCAGATATTTGGAGG - Intergenic
945790892 2:214304216-214304238 GTTTATGGCCAGATTTTGGGGGG - Intronic
946206438 2:218112269-218112291 GTTAATGGCCAGATTTTGGGGGG - Intergenic
946380777 2:219347280-219347302 GTTTATGGCCAGATTTTGGGGGG + Intergenic
946435736 2:219651713-219651735 GTTTATGGCCAGATTTTGGGGGG - Intergenic
946975044 2:225139115-225139137 GTTTATGGCCAGATTTTGGGGGG + Intergenic
947796695 2:232897539-232897561 GTGGGTGGGCAGAGCTTTGCAGG - Intronic
947977958 2:234384137-234384159 GTTTATGGCCAGATTTTGGGGGG - Intergenic
948928057 2:241112165-241112187 GAGGGTGGCTTGATTTTGGGTGG - Intronic
1168936728 20:1671992-1672014 GTTTATGGCCAGATTTTAGGGGG + Intergenic
1169892309 20:10466468-10466490 GTGGGTGGGAAAATTTTTGTTGG + Intronic
1172715759 20:36962311-36962333 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173066786 20:39721025-39721047 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173067410 20:39726643-39726665 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173221382 20:41135787-41135809 GTGGGTGTCCTCAATTTTGGCGG + Intergenic
1173531777 20:43775185-43775207 TTGGATAGCCAGTTTTTTGGTGG + Intergenic
1175733008 20:61366847-61366869 GTTTATGGCCAGATTTTGGGGGG + Intronic
1177377580 21:20293178-20293200 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1177379428 21:20319858-20319880 TTTGGGGGCCAGATTTTTGGGGG - Intergenic
1177419550 21:20838754-20838776 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1177519202 21:22195286-22195308 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1178617436 21:34146150-34146172 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1180027479 21:45176044-45176066 GTGAATGGCCAGGTTTTTGAGGG + Exonic
1180453013 22:15484772-15484794 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1181375806 22:22457154-22457176 GTGACTGGACAGATGTTTGGTGG + Intergenic
1181593721 22:23900221-23900243 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1183548808 22:38469253-38469275 GTGGGCAGCCAGATTTGGGGTGG + Intronic
1183596519 22:38815848-38815870 GTGGGTCTACAGTTTTTTGGGGG - Intergenic
1184520642 22:44991957-44991979 CTGGGTCACAAGATTTTTGGAGG + Intronic
949235981 3:1808384-1808406 GTTTATGGCCAGATTTTGGGGGG + Intergenic
950019896 3:9779897-9779919 GTGGGTGGTAAGGTTTGTGGGGG - Exonic
951270155 3:20614848-20614870 GTTTGTGGCCAGATTGTGGGGGG + Intergenic
951270779 3:20620455-20620477 GTTTATGGTCAGATTTTTGGGGG + Intergenic
951821934 3:26823475-26823497 GTTTATGGCCAGATTTTGGGGGG + Intergenic
952352289 3:32551932-32551954 GTGGGTCACCAGATTTTAGGTGG - Intronic
953836239 3:46347584-46347606 GTTTATGGCCAGATTTTGGGGGG + Intergenic
955632261 3:60987223-60987245 GTTTATGGCCAGATTTTGGGGGG - Intronic
956943570 3:74193953-74193975 GTTTATGGCCAGATTTTGGGGGG - Intergenic
957491126 3:80928874-80928896 GTTTATGGCCAGATTTTGGGGGG - Intergenic
957675693 3:83361445-83361467 GTTTGTGGCCAGATTTTGGGGGG - Intergenic
960788463 3:121399841-121399863 GTTTATGGCCAGATTTTGGGGGG + Intronic
961690059 3:128662886-128662908 GTTTATGGCCAGATTTTGGGGGG + Intronic
961854010 3:129851080-129851102 GTTTATGGCCAGATTTTGGGGGG + Intronic
963415129 3:144984876-144984898 GTTTATGGCCAGATTTTGGGGGG + Intergenic
963511397 3:146252440-146252462 GTTTATGGCCAGATTTTGGGGGG - Intergenic
963898468 3:150711034-150711056 GAGGGCAGCCAGATTTTTGCTGG + Intergenic
964247159 3:154666948-154666970 GTGTGTGGCCTGATTTTTCCTGG - Intergenic
964275366 3:155003919-155003941 GTTTATGGCCAGATTTTGGGGGG - Intergenic
964447880 3:156779218-156779240 GTGGGTGGCACTATTTTAGGAGG - Intergenic
964794655 3:160483777-160483799 GTGTTTGGCCAGAATTCTGGGGG - Intronic
966931303 3:184677522-184677544 GTTGGTGGCCAGATTAGAGGGGG + Intronic
966978186 3:185105216-185105238 GTTTATGGCCAGATTTTGGGGGG - Intronic
967179960 3:186895230-186895252 GTTTATGGCCAGATTTTGGGGGG - Intergenic
968424175 4:510519-510541 GTTTATGGCCAGATTTTGGGAGG + Intronic
968653956 4:1770751-1770773 GTGGGTGTCCTGACTTCTGGGGG - Intergenic
968855142 4:3114370-3114392 GTTTATGGCCAGATTTTGGGGGG + Intronic
970138617 4:12955233-12955255 GTGAGTGGCCAGGTTTTCAGAGG - Intergenic
970255929 4:14170454-14170476 GGGGGTGGCGAAAATTTTGGGGG + Intergenic
970391892 4:15620644-15620666 GTTTATGGCCAGATTTTGGGGGG - Intronic
970422309 4:15916699-15916721 GTTTATGGCCAGAATTTTGGGGG + Intergenic
972080638 4:35144712-35144734 GTTTATGGCCAGATTTTGGGGGG - Intergenic
972444515 4:39130516-39130538 GTTTATGGCCAGATTTTGGGGGG + Intergenic
972460625 4:39298948-39298970 GTTTATGGCCAGATTTTGGGGGG - Intronic
972655439 4:41059403-41059425 GTTTATGGCCAGATTTTGGGGGG - Intronic
973274639 4:48293790-48293812 GTTTATGGCCAGATTTTTGGGGG + Intergenic
974014807 4:56639253-56639275 GTGGCTGGTGAGATTTTTGGAGG + Intergenic
974535098 4:63164289-63164311 GTTTATGGCCAGATTTTGGGTGG + Intergenic
974581220 4:63804281-63804303 GTTTATGGCCAGATTTTGGGAGG + Intergenic
974978449 4:68922196-68922218 GTTTATGGCCAGATTTTGGGAGG - Intergenic
975092949 4:70424791-70424813 GTTGGTGGCCAGAGTTTTGGTGG - Intergenic
976045170 4:80938203-80938225 GTATATGGCCAGATTTTGGGGGG - Intronic
976128516 4:81858646-81858668 GTTTATGGCCAGATTTTGGGGGG + Intronic
976179617 4:82386707-82386729 GTTTATGGCCAGATTTTGGGGGG + Intergenic
976251361 4:83055291-83055313 GTGGGTAGTCAGATTATAGGTGG - Intronic
976977358 4:91181159-91181181 GTTTATGGCCAGATTTTGGGGGG + Intronic
976977984 4:91186991-91187013 GTTTATGGCCAGATTTTGGGGGG + Intronic
977358643 4:95978186-95978208 GTTTATGGCCAGATTTTGGGGGG - Intergenic
977625710 4:99187603-99187625 GTTTATGGCCAGATTTTGGGGGG + Intergenic
977731723 4:100361516-100361538 GTGGGTGGTGAGATTGTGGGAGG + Intergenic
977851886 4:101840382-101840404 GTTTATGGCCAGATTTTGGGGGG - Intronic
978011538 4:103691585-103691607 GTTTATGGCCAGATTTTGGGGGG - Intronic
978311157 4:107386314-107386336 GTGACTGGGCAGATGTTTGGTGG + Intergenic
979149070 4:117285397-117285419 GTTTATGGCCAGATTTTGGGGGG - Intergenic
979893479 4:126130762-126130784 GTTTGTGGCCAGATTTTGGGGGG - Intergenic
979893947 4:126134635-126134657 GTTTATGGCCAGATTTTGGGAGG - Intergenic
980480098 4:133376986-133377008 TGGGATGGCCAGTTTTTTGGGGG - Intergenic
981266643 4:142791912-142791934 GTGGGTGCCAGGATTGTTGGAGG - Intronic
982519291 4:156393148-156393170 GTTTATGGCCAGATTTTGGGGGG - Intergenic
983594727 4:169453434-169453456 GTTTATGGCCAGATTTTGGGGGG - Intronic
984903350 4:184604482-184604504 GCTTGTGGCCAGATTTTGGGGGG - Intergenic
984955905 4:185045272-185045294 GTTTATGGCCAGATTTTGGGGGG + Intergenic
984963985 4:185125590-185125612 GTTTATGGCCAGATTTTGGGGGG - Intergenic
984998819 4:185464639-185464661 GTGGGTGGCAGGATTCTAGGTGG - Intronic
985079721 4:186252480-186252502 GTGGGTGGCAGGATTGGTGGTGG - Intronic
985079756 4:186252602-186252624 GTGGGTGGCGGGATTGGTGGTGG - Intronic
985079783 4:186252681-186252703 GTGGGTGGCGGGATTGGTGGTGG - Intronic
985614221 5:910013-910035 GTTTATGGCCAGATTTTGGGGGG + Intronic
987136281 5:14902352-14902374 GTGCCTGGCCAGATTCTGGGTGG + Intergenic
989065237 5:37453639-37453661 GTTTATGGCCAGATTTTGGGGGG + Intronic
989293597 5:39797207-39797229 GTAGATGGTTAGATTTTTGGTGG + Intergenic
989345520 5:40425274-40425296 GTTTATGGCCAGATTTTGGGGGG - Intergenic
989758555 5:44985933-44985955 GTTTATGGCCAGATTTTGGGTGG - Intergenic
989783381 5:45297425-45297447 GTTTATGGCCAGATTTTGGGGGG + Intronic
990109299 5:52304497-52304519 GTATATGGCCAGATTTTGGGGGG - Intergenic
990655376 5:57949448-57949470 GTGGATGGCCTGCCTTTTGGGGG - Intergenic
991570489 5:68048453-68048475 GTTTATGGCCAGATTTTGGGGGG + Intergenic
992250289 5:74869434-74869456 GTTGATGGCGAGATTTTGGGGGG - Intergenic
992254566 5:74908626-74908648 GTTTATGGCCAGATTTTGGGGGG + Intergenic
993222044 5:85111433-85111455 GTTTATGGCCAGATTTTGGGGGG - Intergenic
993405737 5:87510344-87510366 GTTTCTGGCCAGATTTTGGGGGG - Intergenic
994305878 5:98203741-98203763 GTTTATGGCCAGATTTTGGGGGG - Intergenic
994419051 5:99509460-99509482 GTTTATGGCCAGATTTTGGGGGG + Intergenic
995195096 5:109358056-109358078 GTTTATGGCCAGATTTTGGGAGG - Intronic
995756880 5:115514704-115514726 CTGGGTGGACATATTTTTTGAGG + Intergenic
995959380 5:117821433-117821455 GTTTATGGCCAGATTTTGGGGGG - Intergenic
996291896 5:121860905-121860927 GTTTATGGCCAGATTTTGGGGGG + Intergenic
997393388 5:133535251-133535273 GTTTATGGCCAGATTTTGGGGGG - Intronic
997424888 5:133796427-133796449 GTGTGTGGCCTGATTTTTCTGGG - Intergenic
997948027 5:138219528-138219550 GTTTATGGCCAGATTTTGGGGGG + Intergenic
998343014 5:141434347-141434369 GTTTATGGCCAGATTTTGGGGGG - Intronic
1000588096 5:163124974-163124996 GTTCATGGCCAGATTTTGGGGGG - Intergenic
1002460816 5:179372839-179372861 GTGGGTGGCAGCGTTTTTGGAGG + Intergenic
1002557689 5:180056763-180056785 GTGGGTTTCCTGCTTTTTGGTGG - Intronic
1002937974 6:1690131-1690153 ATGGGTGCCCAGTTTTTTGTGGG - Intronic
1003196127 6:3916728-3916750 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1003761580 6:9184701-9184723 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1004482847 6:16037632-16037654 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1004638868 6:17494720-17494742 TGGGGTGTCCAGATATTTGGTGG + Intronic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1005155742 6:22804518-22804540 GTGGGTGGACACATCTTTTGGGG - Intergenic
1005185483 6:23159573-23159595 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1006050510 6:31339232-31339254 GTTTACGGCCAGATTTTTGGAGG + Intronic
1006250009 6:32775598-32775620 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1006497092 6:34431610-34431632 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1006961817 6:37939515-37939537 CTGGGTGGACATATTTTGGGAGG + Intronic
1007035257 6:38667367-38667389 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1008093226 6:47313160-47313182 GTATATGGCCAGATTTTGGGGGG + Intergenic
1008190705 6:48453429-48453451 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1009640731 6:66331743-66331765 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1010872788 6:81063019-81063041 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1013475021 6:110499186-110499208 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1015467017 6:133558885-133558907 GTTCATGGCCAGATTTTGGGGGG + Intergenic
1015805972 6:137108822-137108844 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1015839017 6:137456483-137456505 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1017140158 6:151182933-151182955 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1018594473 6:165463679-165463701 GTTTATGGCCAGATTTTTGGGGG - Intronic
1019233742 6:170590606-170590628 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1019903202 7:4040720-4040742 GTGGGTGGCCAGATTTTTGGAGG - Intronic
1020337164 7:7070981-7071003 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1020792319 7:12642199-12642221 GTTGGTGGCCAGATGGGTGGGGG - Intronic
1021789055 7:24181748-24181770 GTGGGTGGGTTGAATTTTGGAGG - Intergenic
1023009374 7:35912129-35912151 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1023960688 7:44923457-44923479 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1024065190 7:45726732-45726754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1024911123 7:54448852-54448874 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1024911734 7:54454683-54454705 GTTTATGGCCAGATTTTAGGGGG - Intergenic
1025122463 7:56316950-56316972 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1025123044 7:56322282-56322304 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1025713769 7:63934535-63934557 GTGGGTGTCCAGATGCTTGTGGG - Intergenic
1025816336 7:64915724-64915746 GTTTATGGCCAGATTTTGGGGGG + Intronic
1026005080 7:66594028-66594050 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1026328316 7:69330345-69330367 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1027518095 7:79167782-79167804 GTTTATGGCCAGATTTTGGGGGG - Intronic
1028732324 7:94165892-94165914 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1029130729 7:98328714-98328736 GTGTGTGGGCACATTTTTGTTGG - Intronic
1029223621 7:99009192-99009214 TTAGGTGGGGAGATTTTTGGGGG + Intronic
1030277606 7:107737138-107737160 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1030783321 7:113627970-113627992 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1031371782 7:120976960-120976982 ATAGTTGGCCACATTTTTGGGGG - Exonic
1031795730 7:126172695-126172717 GTTTGTGGCCAGATTTTGGGGGG - Intergenic
1031890709 7:127290223-127290245 GTGGGTGACCAGAGTTTTCTTGG - Intergenic
1032722186 7:134559319-134559341 GTGACTGGGCAGATGTTTGGTGG + Intronic
1033303007 7:140202941-140202963 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1033878663 7:145855036-145855058 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1034538104 7:151738404-151738426 GTTTATGGCCAGATTTTGGGGGG - Intronic
1034942370 7:155238704-155238726 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1034943003 7:155244152-155244174 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1035588416 8:794740-794762 GTTTATGGCCAGATTTTTGGGGG + Intergenic
1037005653 8:13776251-13776273 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1039454474 8:37697925-37697947 GTGGGAGGCCAGCTGTCTGGGGG + Exonic
1039691569 8:39870398-39870420 GTTAATGGCCAGATTTTGGGGGG - Intergenic
1039692149 8:39875505-39875527 GTTAATGGCCAGATTTTGGGGGG - Intergenic
1040381380 8:46876549-46876571 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1040381848 8:46880779-46880801 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1040528449 8:48244992-48245014 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1040782467 8:51125923-51125945 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1041493455 8:58460720-58460742 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1042189307 8:66169148-66169170 TTGGGTAGCCACATTTGTGGGGG - Intronic
1044313017 8:90717161-90717183 GTTTATGGCCAGATTTTGGGGGG - Intronic
1044354319 8:91203221-91203243 GTGGGTGGGAAGATTTTGGTAGG + Intronic
1044442250 8:92236556-92236578 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1044442873 8:92242219-92242241 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1044547669 8:93477581-93477603 GTGGGTGGAGAAAGTTTTGGGGG - Intergenic
1046389811 8:113555275-113555297 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1047562775 8:126007735-126007757 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1047563391 8:126013492-126013514 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1048686788 8:136912816-136912838 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1048702027 8:137102151-137102173 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1048918156 8:139203773-139203795 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1049098530 8:140563071-140563093 GTGTGTGTCCACATATTTGGAGG - Intronic
1049857352 8:144871064-144871086 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1050009345 9:1170117-1170139 GTGGGCAGCCATATTTTAGGGGG - Intergenic
1050423430 9:5490428-5490450 GTGGGAGGGCAAATATTTGGAGG - Intergenic
1050480847 9:6085600-6085622 GTGACTGGGCAGATGTTTGGTGG + Intergenic
1053205188 9:36180217-36180239 GTTTATGGCCAGATTTTGGGCGG - Intergenic
1055258727 9:74406326-74406348 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1056566785 9:87779760-87779782 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1057286128 9:93755778-93755800 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1057303166 9:93898089-93898111 ATGGGTTGCAAGATTTTAGGAGG - Intergenic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1061603037 9:131685314-131685336 GTTTATGGCCAGATTTTGGGGGG - Intronic
1186095796 X:6100335-6100357 GTTTATGGCCAGATTTTAGGGGG + Intronic
1186705458 X:12135947-12135969 GTCGGTGGCCACTCTTTTGGGGG + Intergenic
1187115003 X:16340646-16340668 GTTTGTGGCCAGATTTTGCGGGG - Intergenic
1187381173 X:18803433-18803455 GTTTATGGCCAGATTTTAGGGGG + Intronic
1188116070 X:26244064-26244086 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1188894150 X:35645655-35645677 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1189330378 X:40141150-40141172 GGGTGTGCCCAGGTTTTTGGGGG + Intronic
1189670288 X:43401062-43401084 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1189978038 X:46481994-46482016 GTTTATGGCCAGATTTTGGGGGG + Intronic
1190184113 X:48219948-48219970 GTTTATGGCCAGATTTTGGGGGG - Intronic
1190614861 X:52220066-52220088 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1191949148 X:66569611-66569633 GTTTAGGGCCAGATTTTTGGGGG + Intergenic
1192687821 X:73325103-73325125 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1192767661 X:74158791-74158813 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1193048960 X:77081428-77081450 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1193063187 X:77228899-77228921 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1194913280 X:99673511-99673533 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1196930856 X:120680789-120680811 GTGTGTTTCCAGATATTTGGGGG + Intergenic
1197173287 X:123457897-123457919 TTGGGAGGCCACATTTTAGGAGG + Intronic
1197479238 X:126962451-126962473 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1197622628 X:128767788-128767810 GAAGATGGACAGATTTTTGGGGG - Intergenic
1199008338 X:142729240-142729262 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1200412286 Y:2872636-2872658 GTTTATGGCCAGATTTTGGGGGG + Intronic
1200884558 Y:8254506-8254528 GTGGGTGGCCATATACTGGGAGG - Intergenic
1200957821 Y:8969745-8969767 GTGGGTGGCCAGGTACTAGGAGG + Intergenic
1200970321 Y:9145736-9145758 GTTTATGGCCAGATTTGTGGGGG + Intergenic
1200970908 Y:9151292-9151314 GTTTTTGGCCAGATTTTGGGGGG + Intergenic
1201700733 Y:16878837-16878859 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1201893022 Y:18963205-18963227 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1202140123 Y:21713022-21713044 GTTTTTGGCCAGATTTTGGGGGG - Intergenic
1202140691 Y:21718584-21718606 GTTTATGGCCAGATTTGTGGGGG - Intergenic
1202146174 Y:21785213-21785235 GTTTATGGCCAGATTTGTGGGGG + Intergenic