ID: 1019906699

View in Genome Browser
Species Human (GRCh38)
Location 7:4070345-4070367
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019906696_1019906699 -2 Left 1019906696 7:4070324-4070346 CCTTATCACAACATCCACCAAAA 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG No data
1019906695_1019906699 15 Left 1019906695 7:4070307-4070329 CCAGGCAGTACTTGTTTCCTTAT 0: 1
1: 0
2: 3
3: 16
4: 204
Right 1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr