ID: 1019906929

View in Genome Browser
Species Human (GRCh38)
Location 7:4071879-4071901
Sequence CTGTGTACACACATCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019906929 Original CRISPR CTGTGTACACACATCTACCA AGG (reversed) Intronic
901081399 1:6586180-6586202 CTGTGTCCCCACCTGTACCAGGG - Intronic
905246111 1:36615117-36615139 CTTTGTACACACATCTATGTCGG - Intergenic
905365541 1:37449196-37449218 CTGGGTGCACACAGCTGCCAGGG + Intergenic
905890253 1:41514432-41514454 GTGTACACACACATCTGCCACGG + Intronic
907324313 1:53626976-53626998 CTGTGAACACACATTCTCCAGGG + Intronic
907972916 1:59402279-59402301 CCGTGTATACTTATCTACCATGG + Intronic
912031979 1:105259289-105259311 CTGTGTACAGACATTTTACATGG + Intergenic
912060793 1:105666149-105666171 CTGGGTACATACATTTGCCAAGG + Intergenic
913552212 1:119926574-119926596 CTGGGGACACACATCGACGAAGG + Exonic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
916142942 1:161715182-161715204 CTTTGGAGACACATCCACCATGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
922907660 1:229186780-229186802 CTGTGGGCAAACATCTACTAGGG + Intergenic
923017802 1:230140287-230140309 CTGTGTACACACTACTGGCAGGG - Intronic
924747058 1:246845975-246845997 CTGTGCACTCACATCACCCAGGG - Intronic
1067081379 10:43214451-43214473 CTCTGTGCACACACCTACGAAGG - Intronic
1068219483 10:54025988-54026010 ATGTGCACACACATATATCAAGG - Intronic
1069746876 10:70720829-70720851 CTGTGTGCACACATCTAATTTGG - Intronic
1071360986 10:84845770-84845792 CTGTGTACAAATAACCACCAGGG + Intergenic
1072314402 10:94187976-94187998 CTAGGTACGCACAGCTACCATGG + Intronic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1076848409 10:133081248-133081270 CTGTGTTCACAAATCTTCCCGGG + Intronic
1077959032 11:7052980-7053002 CTGTGTATACATATATATCATGG - Intronic
1078034748 11:7791555-7791577 CTGTGTACACACACACACAATGG + Intergenic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1085838257 11:79979478-79979500 CTGTGTCCACAAGTCCACCAGGG - Intergenic
1088592009 11:111411597-111411619 ATGTGCACACAAATCAACCAAGG + Intronic
1090646697 11:128772235-128772257 CTGTGTAGAAATTTCTACCAGGG - Intronic
1093958527 12:25249849-25249871 CTGTCTACACTCAACTAGCAAGG + Intronic
1097371617 12:58788578-58788600 ATGTATGCACACATATACCATGG - Intronic
1097802439 12:63929079-63929101 TTGTGTACACACATGTAACCAGG - Intronic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1099210549 12:79782689-79782711 CTCTGTACAAACATCTCCCTTGG + Intronic
1101016346 12:100504885-100504907 CTCTGTACACACTTCTATTATGG - Intronic
1101822284 12:108193247-108193269 TCCTGTACACACATCTACTATGG + Intronic
1102995548 12:117347379-117347401 CAGTGTAAACATATCTTCCATGG - Intronic
1103238418 12:119394186-119394208 CTGTGTTCTCATTTCTACCATGG - Intronic
1103910382 12:124348976-124348998 CCATGTACACACATGTACCAGGG + Intronic
1104449415 12:128857088-128857110 CTGTAAACCCACATCTTCCAAGG + Intronic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1107687932 13:42922856-42922878 ACGTGCACACACATCTTCCATGG + Intronic
1112258395 13:97855994-97856016 CTGTTTACAGTAATCTACCATGG + Intergenic
1113022662 13:105905652-105905674 CTGTGTGTACTGATCTACCAAGG + Intergenic
1114127618 14:19748103-19748125 CTGAGAACACACTTCTGCCAGGG + Exonic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1117025152 14:51611572-51611594 CTGTGTCCACAAATCACCCAAGG + Intronic
1118036904 14:61877710-61877732 CTGAGTACACACAGCTCCCCAGG - Intergenic
1123133800 14:106009465-106009487 ATCTGTATAAACATCTACCATGG - Intergenic
1126877214 15:53056573-53056595 CAGTGACCACACAGCTACCAAGG + Intergenic
1128659680 15:69489585-69489607 ACAAGTACACACATCTACCATGG - Intergenic
1128918529 15:71589718-71589740 CTCTGTGCACACATGTACAAGGG - Intronic
1130134728 15:81173098-81173120 CTGTGCTCCCACATCTCCCAGGG + Intronic
1130654872 15:85785633-85785655 ATGTGGACACACACCTACCCTGG - Intronic
1131408779 15:92188517-92188539 GGGTGTAGACACTTCTACCATGG - Intergenic
1132409993 15:101569402-101569424 CAGCGTTCACACATCTACCCCGG + Intergenic
1133740690 16:8648852-8648874 CTGTGCACACAAATCACCCAGGG - Exonic
1134244687 16:12531310-12531332 CTGAGTTCACACACCTGCCAGGG - Intronic
1135351275 16:21731150-21731172 CTGTCTGCACACATCTGCCTGGG - Intronic
1135449755 16:22547276-22547298 CTGTCTGCACACATCTGCCTGGG - Intergenic
1139610767 16:68056122-68056144 ATGTGTGCACACATCTATAAAGG - Intronic
1140299330 16:73740768-73740790 CTTTCTTCACACATTTACCATGG - Intergenic
1140613298 16:76627513-76627535 CATTGTACACACATGTACAATGG + Intronic
1141127088 16:81408529-81408551 CTTTGTACTCACACCTACCCTGG + Intergenic
1141704866 16:85659203-85659225 CTGTTTAAACACAGCCACCAAGG - Intronic
1142121445 16:88388488-88388510 CTGTTTACACACAGCCACCTTGG - Intergenic
1144186498 17:12801250-12801272 GTGTGCACACACATCTGCAAAGG - Intronic
1146004738 17:29154256-29154278 CTGTCTACACGCCTCTCCCAGGG - Intronic
1146489896 17:33273420-33273442 CTGAGTACACACAGCCCCCAGGG - Intronic
1147421086 17:40322519-40322541 CTGTGTGTACACACCTACCTTGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149110431 17:53021774-53021796 TTGTTTATACACATCTAGCAAGG - Intergenic
1149392522 17:56206371-56206393 CTGTATACATCCATCTACTAAGG - Intronic
1156168362 18:34451366-34451388 CAGTGAACACACATATGCCAAGG - Intergenic
1161218792 19:3108276-3108298 CTGTGCAAAGATATCTACCATGG + Intronic
1161975481 19:7606000-7606022 CTGTGTACACAAATCCTCAAGGG - Intronic
927346639 2:22051641-22051663 ATGTGTCTATACATCTACCAAGG + Intergenic
928832358 2:35502533-35502555 CTGTTTACCCACAACTCCCAAGG - Intergenic
929324677 2:40594841-40594863 ATGTGTACACACATGCACAAAGG - Intronic
930176605 2:48307250-48307272 CTTTGTTCAGACATCTCCCAGGG + Intergenic
932119743 2:69087733-69087755 CTGTGTCTACACCTCTGCCATGG + Intronic
932385052 2:71324252-71324274 CTGTGTACACAGTGCTATCAGGG + Intronic
939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG + Intergenic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941758543 2:169215036-169215058 TTCTGTACACACATCTGACAGGG - Intronic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
942213551 2:173695602-173695624 CTGTGCACTAACAACTACCAAGG + Intergenic
944987829 2:205198570-205198592 CTGAGTTCTCACATCTACAAAGG + Intronic
945007682 2:205425878-205425900 CTGTGCACACACAAATAACACGG - Intronic
945910146 2:215639628-215639650 CTTTGTAGACAGAACTACCATGG + Intergenic
946599835 2:221347713-221347735 CTGGGTACCCACATCCTCCAAGG - Intergenic
948758997 2:240178983-240179005 CTGTGTGGCCACATCCACCAAGG + Intergenic
1168736603 20:145171-145193 CTGTATACAAACACTTACCAGGG - Intronic
1170920664 20:20676495-20676517 CTGTGTTCAAACAGCTAGCAAGG - Intronic
1172607903 20:36227389-36227411 CTCTGGGCACACAGCTACCAAGG - Intronic
1175531285 20:59675306-59675328 CTGTGTACCCACCTGTACAATGG - Intronic
1180643706 22:17320091-17320113 CTCTGTGCAAACACCTACCATGG + Intergenic
1180696638 22:17755344-17755366 ATGTGAACACACATGGACCATGG + Intronic
1181574360 22:23784226-23784248 CACTGTACACACATTTACAATGG - Exonic
1182742800 22:32580970-32580992 CTGTGCACACAGATCACCCAGGG - Intronic
1183669457 22:39263983-39264005 CAGTTTCCTCACATCTACCATGG + Intergenic
1184825220 22:46946076-46946098 CTGTGTACACACACCTTTAAGGG - Intronic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
950686757 3:14623871-14623893 CTGTTTACTCACATTTACTAGGG - Intergenic
953280302 3:41548231-41548253 GTGTCCACACACATCTCCCAAGG + Intronic
953656667 3:44859889-44859911 CTGTGTACACACATCACCTAGGG - Intronic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
954944360 3:54406439-54406461 GTGTGTACACATATATACAATGG + Intronic
959407774 3:105981472-105981494 CTGTAAACACACTTCTAGCAAGG - Intergenic
965550200 3:169956654-169956676 CTTTGTACATCCATCTACCATGG - Intergenic
967737828 3:192972256-192972278 GTGTGTACACACATGTGCTATGG + Intergenic
971918522 4:32907012-32907034 ATATGCACACACATGTACCATGG - Intergenic
972262860 4:37428135-37428157 ACGTGGACACAGATCTACCAAGG + Intronic
974335382 4:60537266-60537288 CTATCTACACACATGTACCTGGG + Intergenic
977611718 4:99041606-99041628 ATGTGTACACTCATCTAATAAGG - Intronic
981113928 4:140967931-140967953 CTGTGTCCACACATCTCACTGGG - Intronic
983123661 4:163921236-163921258 CTGTTTCCAAACATCTACAAGGG - Intronic
987023750 5:13902219-13902241 CTGTGCAAACACATATAACATGG + Intronic
990205669 5:53426381-53426403 CTGTGTAAACACAGCTTCCAGGG + Intergenic
990880753 5:60535023-60535045 GTGTGTACACACATACACAATGG - Intergenic
993973140 5:94444222-94444244 GGGTATACACACCTCTACCAGGG + Intronic
994121093 5:96113669-96113691 CTGTGTACAACCAGCTGCCAAGG - Intergenic
994152428 5:96463119-96463141 CTGTATACACATGTCTACCTGGG - Intergenic
994307261 5:98221655-98221677 TAGTGTATACACATATACCATGG + Intergenic
994318413 5:98360879-98360901 CTATGTATGCCCATCTACCAAGG - Intergenic
995702166 5:114948260-114948282 CCATGTACACACATCTAAAAGGG + Intergenic
997867313 5:137475980-137476002 CTGTGTATAGACTTCTACCTTGG + Intronic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1007418251 6:41704642-41704664 ATGTGCCCACACATCTCCCAGGG - Intronic
1012553342 6:100484216-100484238 CTGTGGCCACACATTTTCCAGGG - Intergenic
1013298308 6:108780147-108780169 CTGTGCACACTCAGGTACCATGG + Intergenic
1015359771 6:132325840-132325862 CAGTGGTCACACATCTACCAGGG + Intronic
1017896924 6:158687976-158687998 CTGTGCACACACATATACACAGG - Intronic
1017958690 6:159203065-159203087 ATGTGGACACACAGATACCAAGG - Intronic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1022217745 7:28281055-28281077 ATGTGTATACACATCATCCAGGG + Intergenic
1031114998 7:117658016-117658038 CTGGGTCCACACCTTTACCATGG + Intronic
1037178876 8:15979633-15979655 GTGTGTATACACATATACCACGG + Intergenic
1037935356 8:22911847-22911869 CTGTGTGCGCTGATCTACCAAGG - Intronic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1040706204 8:50131529-50131551 GTGTGTACACATATGTACAATGG - Intronic
1042748102 8:72129510-72129532 ATGTCTAGACACATCTACTATGG - Intergenic
1046788846 8:118298599-118298621 TTGTTTACACACTTTTACCAAGG + Intronic
1049113254 8:140663228-140663250 GTGTGTACACACATAGACAATGG + Intronic
1050440535 9:5657776-5657798 CTGTGTACAAACAGGCACCAGGG - Intronic
1050456060 9:5835634-5835656 CTGTCACCTCACATCTACCAGGG - Intergenic
1051236853 9:15009850-15009872 ATCTGAACATACATCTACCATGG + Intergenic
1051251471 9:15162930-15162952 CTGTCTTCACACATCTGCTAAGG - Intergenic
1051321482 9:15910157-15910179 GTGTGTGCACATATATACCATGG - Intronic
1052593173 9:30525193-30525215 ATCTGTACATATATCTACCATGG - Intergenic
1056350404 9:85743002-85743024 CTGAATAAAGACATCTACCAAGG - Intergenic
1057904076 9:98971132-98971154 CAGTGTAGACACATAGACCAGGG - Intronic
1058269345 9:102950476-102950498 TTGTCTTCACACATCGACCAGGG + Intergenic
1059730991 9:117056701-117056723 CTATGTTCACACATCAACCCTGG + Intronic
1060204857 9:121676472-121676494 CTGTGTGTTCACACCTACCAGGG + Intronic
1060788505 9:126469267-126469289 CTGTGTACAGACCACTACCAAGG + Intronic
1186129224 X:6448387-6448409 CTTTGTACACACCTATACCATGG - Intergenic
1187297687 X:18017957-18017979 ATGTGTAAACAAATCTCCCAGGG + Intergenic
1189844009 X:45114987-45115009 CTCCGTACACACATCTAAGATGG + Intergenic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1193378069 X:80785391-80785413 ATGTGTACTTACATTTACCAAGG - Intronic
1195006602 X:100691505-100691527 CTGAGTACAGGCATGTACCATGG + Intronic
1195726673 X:107924667-107924689 CTGAGTCCACAAATCTCCCATGG - Intronic
1195944859 X:110198992-110199014 CTCTGTCCACACATCTACTTAGG + Intronic
1198160260 X:134001031-134001053 CTGTGCAAACACTTCTACCTGGG - Intergenic
1199377167 X:147126871-147126893 ATGTGCACACATATATACCATGG - Intergenic
1199467692 X:148157753-148157775 AAATGTACACACATATACCAAGG - Intergenic
1199827832 X:151516920-151516942 CTGTCTGCCGACATCTACCAAGG - Intergenic