ID: 1019907219

View in Genome Browser
Species Human (GRCh38)
Location 7:4073947-4073969
Sequence TAGGCTGAGCACTATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019907208_1019907219 -4 Left 1019907208 7:4073928-4073950 CCCCTCTCCCAGTTCCTCATAGG 0: 1
1: 0
2: 6
3: 29
4: 251
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907206_1019907219 10 Left 1019907206 7:4073914-4073936 CCCTAGTGCTCAGGCCCCTCTCC 0: 1
1: 0
2: 5
3: 42
4: 339
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907210_1019907219 -5 Left 1019907210 7:4073929-4073951 CCCTCTCCCAGTTCCTCATAGGC 0: 2
1: 11
2: 38
3: 90
4: 367
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907205_1019907219 11 Left 1019907205 7:4073913-4073935 CCCCTAGTGCTCAGGCCCCTCTC 0: 1
1: 0
2: 6
3: 45
4: 302
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907203_1019907219 29 Left 1019907203 7:4073895-4073917 CCACAACAAGCGATTTATCCCCT 0: 1
1: 1
2: 2
3: 5
4: 49
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907207_1019907219 9 Left 1019907207 7:4073915-4073937 CCTAGTGCTCAGGCCCCTCTCCC 0: 1
1: 0
2: 8
3: 70
4: 484
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107
1019907211_1019907219 -6 Left 1019907211 7:4073930-4073952 CCTCTCCCAGTTCCTCATAGGCT 0: 2
1: 10
2: 49
3: 66
4: 291
Right 1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019907219 Original CRISPR TAGGCTGAGCACTATGGGGT GGG Intronic
902827852 1:18989408-18989430 TTGGCTCAGGACTGTGGGGTGGG - Intergenic
903862321 1:26372179-26372201 CAGGCTGTGCACCATGGGCTGGG + Intronic
904028610 1:27520283-27520305 CAGACTGAGCCCTGTGGGGTTGG + Intergenic
906161150 1:43650027-43650049 TAGGCTGAGCACACTGAGGTCGG + Intergenic
912414700 1:109500013-109500035 TAGGCTGAGACCTATGGTGGTGG + Intronic
912866695 1:113264108-113264130 GAGGTGGAGCAGTATGGGGTGGG - Intergenic
913471514 1:119192018-119192040 TATGCTGGGCACTATGGGAAAGG - Intergenic
915626050 1:157114781-157114803 TGGCCTGAGCACTAGGGGTTGGG + Intergenic
923794579 1:237141830-237141852 TTGGCTGGGCACTATGGCCTTGG + Intronic
924950764 1:248881051-248881073 TAGGCTGGGCACCATGGCTTTGG - Intergenic
1063792945 10:9475688-9475710 TAGGCTGAGTACAATGGTTTAGG + Intergenic
1068485003 10:57646512-57646534 CAGGCTGAGGACGATGGGGAAGG + Intergenic
1073122055 10:101128040-101128062 GAGGCTGAAAACTATGGGGAAGG - Intronic
1073708251 10:106011137-106011159 TAAGCTGTGCAGTCTGGGGTTGG + Intergenic
1076711153 10:132335461-132335483 GAGGCTGAGTACTATGGGGGGGG + Intronic
1076711180 10:132335561-132335583 TAGGCTGAGTACTATGGGGGGGG + Intronic
1078903972 11:15667193-15667215 AAGGCTGAGGACGATGGAGTTGG - Intergenic
1080835574 11:35937401-35937423 GAGGCTGATGACCATGGGGTAGG - Intergenic
1090773096 11:129939019-129939041 GAGGCTGAGAACTATGGAATGGG - Intronic
1091623969 12:2108651-2108673 TGTGCTGAGCACCATGTGGTGGG - Intronic
1091776667 12:3189199-3189221 AAGGCTGAGCAGGATGGGGGAGG + Intronic
1094713843 12:32991774-32991796 CAGTCTGAGCAGTATGGGGAGGG + Intergenic
1101457933 12:104856521-104856543 AAGGCAGAGCACTATGGGAAAGG + Intronic
1105278090 13:18947898-18947920 GAGGCTGGGCACTATGGGAGGGG - Intergenic
1114370140 14:22077409-22077431 TATGCTGAGCTCTGTGTGGTGGG + Intergenic
1119530783 14:75359699-75359721 AAAGCTCAGCACTCTGGGGTGGG + Intergenic
1122218829 14:100222372-100222394 TAGGCTGAAAACAATGGGCTGGG + Intergenic
1122987949 14:105221231-105221253 TGGCCTGGGCACTATGGGGCAGG + Intronic
1124824906 15:33084135-33084157 TAGGCAGAGCACAGTGGTGTGGG - Intronic
1128450647 15:67804248-67804270 TAGGCTGTGCACTGTGGACTTGG - Intronic
1131313649 15:91313017-91313039 GAGGCTTAACACTATGGAGTAGG + Intergenic
1132773577 16:1578965-1578987 TAATCTGAGCACTTTGGGGAGGG - Intronic
1133740695 16:8648895-8648917 TAGGTTGAGGGCTATGTGGTAGG - Exonic
1137750210 16:50855894-50855916 TAGGCTGTGGACTTTGAGGTGGG - Intergenic
1137793618 16:51196318-51196340 TAGGCAGAGTCCTATGGGGATGG + Intergenic
1138681666 16:58688064-58688086 TAGGCTGGGCACCATGGCCTTGG - Intergenic
1139430400 16:66908124-66908146 TGGGCTGGGCCCTATGGGATTGG - Exonic
1143520132 17:7440099-7440121 TAGGCGGAGGACGATGGGGGTGG - Intronic
1146480852 17:33203748-33203770 TAGGGTGAGCACACTGGAGTGGG + Intronic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1152380266 17:79938725-79938747 TGGGCTCAGCATTAAGGGGTGGG - Exonic
1153514119 18:5889629-5889651 TTGGGTGAGCACAGTGGGGTGGG + Exonic
1154981853 18:21508892-21508914 TGAGCTGAGCACTCTGGGGAAGG + Intronic
1156483536 18:37450731-37450753 TGGGCTGTGCACCATGGGGGAGG - Intronic
1157952956 18:52060882-52060904 TAGTCTGAGCATTCTGAGGTGGG - Intergenic
1159032712 18:63247613-63247635 TAGGCAGAGCACTAGGGAGAAGG + Intronic
1161613969 19:5259850-5259872 TAGGCAGTGCTCTATGGGGACGG - Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1166275700 19:41752352-41752374 TAGGCTGAGGACTCTGGCCTGGG - Intronic
1166865706 19:45835484-45835506 TAGGCTGAGAACTGAGGGGAGGG + Intronic
927169104 2:20353376-20353398 TAGGCAGATCACTAAAGGGTGGG - Intergenic
929889002 2:45904336-45904358 TGTGCTGAACACTATGGGGGTGG + Intronic
932091333 2:68808845-68808867 TAGCCTATGCACTATGGAGTTGG + Intronic
933406219 2:81863226-81863248 TAGGCTGAACAATATTTGGTAGG - Intergenic
935525416 2:104160436-104160458 TTGGCTGAGGACCATGTGGTGGG - Intergenic
936884325 2:117291841-117291863 GAGGCTGAGAAATATGGGGTGGG + Intergenic
937312035 2:120908532-120908554 TGGGCTGAGAACTATGAGGCAGG + Intronic
938246951 2:129785089-129785111 TAGCCTGAGCACAATGAGATGGG + Intergenic
942381089 2:175391748-175391770 TAGGATGAGCAGTATGGAGGAGG - Intergenic
947807173 2:232976872-232976894 TGGAGTGTGCACTATGGGGTCGG + Intronic
948613518 2:239184485-239184507 GAGGCTGTGCCCTATGGGGGGGG + Intronic
1170594708 20:17796451-17796473 TGAGCTGAACACTCTGGGGTGGG - Intergenic
1172481979 20:35276761-35276783 TAGGCTGAGCCCTCTGGGCCTGG - Exonic
1173430656 20:42984556-42984578 TGAGCTGAGCATCATGGGGTAGG - Intronic
1176249842 20:64115351-64115373 TGGGCTGAGCACACTGGGATGGG - Intergenic
1177338693 21:19768628-19768650 TAGGCGGAGGACTTTGGGGTGGG - Intergenic
1182606981 22:31513403-31513425 TAGTCTGAGCACTTTGGGAGGGG - Intronic
1184510543 22:44930716-44930738 CAGGCAGAGCACTCTGGGGCAGG + Intronic
954329325 3:49881121-49881143 CAGGCTGAGGGCTGTGGGGTGGG + Intergenic
957040836 3:75334157-75334179 TAGGCTGAGCAAGAAAGGGTGGG - Intergenic
960790994 3:121430665-121430687 TAGGATGTGAACTTTGGGGTGGG + Intergenic
961866727 3:129958790-129958812 CAGACAGAGCACTGTGGGGTGGG + Intergenic
964359239 3:155877414-155877436 TACACTAAGAACTATGGGGTTGG - Intronic
966120890 3:176518825-176518847 TAGGCTGAGCACCAGGCAGTGGG + Intergenic
966668910 3:182505443-182505465 TAGGCTGAGCACCATGATATTGG - Intergenic
972342138 4:38161378-38161400 TTGGCTGAGCATGATGGGGGAGG + Intergenic
972709007 4:41574790-41574812 TAGGTTGGGCACTTGGGGGTAGG + Intronic
973614007 4:52660975-52660997 TGGGCTGAGCACTCTGGGAGAGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
979346191 4:119590331-119590353 TAGTTTGAGGAGTATGGGGTAGG - Intronic
981748983 4:148075420-148075442 TAAGCTGAGCACAGTAGGGTTGG + Intergenic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
983957344 4:173713831-173713853 TAGTCTGAGCCCTTTGAGGTGGG + Intergenic
992088550 5:73298796-73298818 TGGGCTGAATACTTTGGGGTCGG - Intergenic
993892827 5:93494374-93494396 TAATCTGAGCACTATTGGGAGGG + Intergenic
997203425 5:132026663-132026685 CACCCTGACCACTATGGGGTGGG + Intergenic
997753092 5:136368500-136368522 TAGGCTGAGCTCTATGTGCCAGG - Intronic
998521255 5:142802913-142802935 TTGAATGAGCCCTATGGGGTAGG - Intronic
1001680042 5:173549893-173549915 TAGGCTGAGGACTCTGACGTGGG - Intergenic
1007712057 6:43830848-43830870 TCAGCTGAGCACTAAGGGGTGGG + Intergenic
1013409778 6:109873473-109873495 GAGGCTGAGCACTGTGGGGTTGG + Intergenic
1014627409 6:123744586-123744608 TAAGCTGAGCATTATGGCATGGG + Intergenic
1016250994 6:142042814-142042836 TAGGCAGAGGAAGATGGGGTGGG + Intergenic
1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG + Intronic
1026872112 7:73859205-73859227 AAGGCAGAGGACTCTGGGGTAGG - Intergenic
1032016568 7:128383911-128383933 TAGGCTGAGCACTCAGGGCCTGG - Intergenic
1036999932 8:13705842-13705864 TAGGCTGAGTATCATGGGCTGGG - Intergenic
1038479077 8:27889077-27889099 GTGGCTGAGGACCATGGGGTTGG - Intronic
1039404661 8:37302203-37302225 GAGGCTGAGCAAGATGGGGTGGG + Intergenic
1041986041 8:63923372-63923394 TAGGCTGAGGACTATGATGGTGG + Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1043450531 8:80361803-80361825 TAGGCTGAGCCACAAGGGGTTGG + Intergenic
1045841134 8:106582911-106582933 AAGGCTGAACACTGTGGGGAGGG - Intronic
1046254685 8:111680651-111680673 TAGCCTGAGGACTTTGGGGAAGG + Intergenic
1048136721 8:131753294-131753316 AAGGCTGTGCACAAAGGGGTGGG - Intergenic
1050574570 9:6979958-6979980 TAGGATGAGAACTCTGTGGTGGG + Intronic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1053071037 9:35102222-35102244 AAGGCTGGGAACTATTGGGTTGG + Intronic
1055749075 9:79484777-79484799 TAGGATGAGTACTGTGGAGTTGG - Intergenic
1055961389 9:81823503-81823525 TAGGCTGATTACTTTGGGCTCGG + Intergenic
1056591781 9:87970410-87970432 TATTCTGAGCACTTTGGGGTTGG - Intronic
1062730270 9:138104617-138104639 TAGGCTGAGGACTCTGGATTTGG + Intronic
1186162090 X:6788316-6788338 TAGGCTGAGCAATGTTTGGTAGG + Intergenic
1189151574 X:38714263-38714285 TAGGCTGAGCTATATTTGGTAGG + Intergenic
1192593950 X:72387089-72387111 TAGGCAGAGCACAATGAGCTAGG + Intronic
1199162307 X:144627947-144627969 TGAGCTGTGCAGTATGGGGTTGG - Intergenic
1200316062 X:155134454-155134476 TAGGCTGGGCACCATGGCCTTGG - Intronic